The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134227	Escherichia coli strain NCTC9102 genome assembly, chromosome: 1	4573055	655995	696261	4573055	integrase,transposase,tRNA	Escherichia_phage(29.41%)	47	642520:642550	698770:698800
642520:642550	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGC	NA	NA	NA	NA
VEC62560.1|655995_656328_+|tRNA	putative tRNA-binding protein	tRNA	NA	NA	NA	NA
VEC62561.1|656369_657860_-	putrescine--2-oxoglutarate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
VEC62562.1|658166_659687_+	aerotaxis receptor protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
VEC62563.1|659840_660464_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VEC62564.1|660751_661516_+	siderophore-interacting protein	NA	NA	NA	NA	NA
VEC62565.1|661812_663129_+|integrase	integrase	integrase	A0A248SL35	Klebsiella_phage	28.6	3.9e-34
VEC62566.1|663258_663855_+	Uncharacterised protein	NA	A0A1B0VBK8	Salmonella_phage	86.9	1.0e-95
VEC62567.1|663937_665542_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC62568.1|666320_666548_+	putative AlpA-family regulatory protein from prophage	NA	NA	NA	NA	NA
VEC62569.1|666613_667357_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC62570.1|667577_668138_+	CP4-6 prophage; DNA-binding protein	NA	NA	NA	NA	NA
VEC62571.1|668527_669142_+	CP4-6 prophage protein	NA	NA	NA	NA	NA
VEC62572.1|669169_669736_+	malate transporter	NA	NA	NA	NA	NA
VEC62573.1|670302_671100_-|transposase	Putative transposase	transposase	U5N3V8	Enterobacteria_phage	97.7	2.6e-142
VEC62574.1|671099_672272_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	98.7	5.9e-228
VEC62575.1|672312_672519_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	87.5	7.9e-19
VEC62576.1|672694_672925_-|transposase	transposase	transposase	NA	NA	NA	NA
VEC62577.1|673216_673768_+	type 1 fimbriae regulatory protein	NA	A0A2L1IV36	Escherichia_phage	49.5	3.1e-46
VEC62578.1|673764_674607_-	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	32.4	5.7e-07
VEC62579.1|674757_675357_+	type 1 fimbriae regulatory protein	NA	A0A2L1IV36	Escherichia_phage	64.1	6.8e-71
VEC62580.1|675783_676248_+	DNA-binding transcriptional activator CaiF	NA	NA	NA	NA	NA
VEC62581.1|676244_676862_+	Bacterial regulatory proteins, luxR family	NA	NA	NA	NA	NA
VEC62582.1|677183_678404_+	glycosyltransferase	NA	NA	NA	NA	NA
VEC62583.1|678396_679815_+	Adhesin/invasin tibA precursor (Glycoprotein tibA)	NA	NA	NA	NA	NA
VEC62584.1|680187_680613_+	adhesin	NA	NA	NA	NA	NA
VEC62585.1|680624_681080_+	adhesin	NA	NA	NA	NA	NA
VEC62586.1|681063_681450_+	CP4-57 prophage protein	NA	NA	NA	NA	NA
VEC62587.1|681541_682027_+	anti-restriction protein	NA	A9J566	Pseudomonas_phage	31.7	6.9e-13
VEC62588.1|682042_682519_+	putative DNA repair protein	NA	NA	NA	NA	NA
VEC62589.1|682587_682809_+	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
VEC62590.1|682827_683256_+	intergenic-region protein	NA	NA	NA	NA	NA
VEC62591.1|683345_683723_+	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VEC62592.1|683719_684208_+	aec77	NA	NA	NA	NA	NA
VEC62593.1|684219_684417_+	Aec78	NA	NA	NA	NA	NA
VEC62594.1|684513_685359_+	putative restriction methylase	NA	NA	NA	NA	NA
VEC62595.1|685658_686165_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
VEC62596.1|686243_687077_-	RNA polymerase	NA	A0A2I7SAT0	Vibrio_phage	33.7	3.8e-35
VEC62597.1|687081_688086_-	RNA polymerase	NA	NA	NA	NA	NA
VEC62598.1|688280_690026_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
VEC62599.1|690136_690352_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
VEC62600.1|690589_691603_+	O-sialoglycoprotein endopeptidase	NA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
VEC62601.1|691645_693109_-	putative tartrate carrier protein	NA	NA	NA	NA	NA
VEC62602.1|693156_693762_-	L-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
VEC62603.1|693758_694670_-	L-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
VEC62604.1|694876_695479_+	transcriptional activator TtdR	NA	NA	NA	NA	NA
VEC62605.1|695563_695839_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
VEC62606.1|695883_696261_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
698770:698800	attR	GCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 2
LR134227	Escherichia coli strain NCTC9102 genome assembly, chromosome: 1	4573055	1163456	1174585	4573055	transposase,tail	Bacteriophage(33.33%)	15	NA	NA
VEC63051.1|1163456_1164854_-	phage-related DNA helicase	NA	Q3LZN8	Bacteriophage	74.4	3.4e-214
VEC63052.1|1164918_1165035_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC63053.1|1164977_1165622_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC63054.1|1165613_1165886_-	putative phage related protein	NA	B6SD64	Bacteriophage	67.1	8.0e-27
VEC63055.1|1165875_1166097_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC63056.1|1166163_1166925_-	Predicted nucleotide-binding protein containing TIR-like domain	NA	NA	NA	NA	NA
VEC63057.1|1166978_1169042_-	putative DNA polymerase from bacteriophage origin	NA	Q775A3	Bordetella_phage	67.7	1.9e-274
VEC63058.1|1169103_1169793_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC63059.1|1169821_1170097_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
VEC63060.1|1170141_1170519_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEC63061.1|1170562_1171204_-	Uncharacterised protein	NA	H6WRY3	Salmonella_phage	64.1	1.8e-69
VEC63062.1|1171255_1171804_-	Protein of uncharacterised function (DUF2815)	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
VEC63063.1|1171819_1172287_-	Bbp38	NA	B6SCX9	Bacteriophage	58.5	3.7e-32
VEC63064.1|1173011_1174190_+	lipopolysaccharide core biosynthesis	NA	NA	NA	NA	NA
VEC63065.1|1174345_1174585_-|tail	tail fiber protein	tail	A0A0A7NV65	Enterobacteria_phage	85.3	2.8e-28
>prophage 3
LR134227	Escherichia coli strain NCTC9102 genome assembly, chromosome: 1	4573055	1634199	1643641	4573055		Enterobacteria_phage(87.5%)	12	NA	NA
VEC63472.1|1634199_1635126_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
VEC63473.1|1635130_1635862_+	ABC transporter permease	NA	NA	NA	NA	NA
VEC63474.1|1635842_1635950_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEC63475.1|1636009_1636741_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VEC63476.1|1636962_1638648_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VEC63477.1|1638644_1638896_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEC63478.1|1638849_1639365_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEC63479.1|1639411_1639882_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VEC63480.1|1639922_1640384_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
VEC63481.1|1640508_1640949_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.6	5.4e-73
VEC63482.1|1641026_1642508_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.3	2.6e-257
VEC63483.1|1642504_1643641_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
LR134227	Escherichia coli strain NCTC9102 genome assembly, chromosome: 1	4573055	1685802	1695604	4573055	integrase,protease,capsid	Escherichia_phage(37.5%)	10	1687586:1687612	1691280:1691306
VEC63526.1|1685802_1686702_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
VEC63527.1|1687108_1687426_+	protein	NA	NA	NA	NA	NA
1687586:1687612	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VEC63528.1|1687691_1688705_-|integrase	phage integrase	integrase	Q83VS6	Escherichia_phage	98.8	5.4e-193
VEC63529.1|1688820_1689120_-	immunity repressor	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
VEC63530.1|1689275_1690025_-|capsid	phage capsid protein	capsid	M1SV64	Escherichia_phage	99.0	5.8e-120
VEC63531.1|1690024_1690864_-	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCM8	Escherichia_phage	99.6	1.7e-160
VEC63532.1|1691450_1692812_-|protease	putative protease	protease	Q6DW11	Phage_TP	99.7	1.9e-217
1691280:1691306	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VEC63533.1|1692958_1693291_-	protein	NA	NA	NA	NA	NA
VEC63534.1|1693481_1694204_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
VEC63535.1|1694200_1695604_-	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 5
LR134227	Escherichia coli strain NCTC9102 genome assembly, chromosome: 1	4573055	2205200	2244658	4573055	integrase,transposase,terminase,capsid,protease,head,portal,tail	Escherichia_phage(30.43%)	44	2202418:2202432	2236332:2236346
2202418:2202432	attL	CCTTTATCAGCGTTA	NA	NA	NA	NA
VEC64018.1|2205200_2206022_-|protease	putative protease	protease	NA	NA	NA	NA
VEC64019.1|2206297_2206606_-	acid shock protein	NA	NA	NA	NA	NA
VEC64020.1|2207029_2208283_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC64021.1|2208389_2209283_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEC64022.1|2209417_2210638_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VEC64023.1|2210762_2211458_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VEC64024.1|2211410_2212667_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VEC64025.1|2212861_2213476_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VEC64026.1|2213518_2214373_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VEC64027.1|2214374_2214992_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VEC64028.1|2215002_2217399_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	4.8e-208
VEC64029.1|2217486_2219913_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
VEC64030.1|2220111_2220417_-	protein	NA	NA	NA	NA	NA
VEC64031.1|2220488_2221235_+	lipoprotein	NA	NA	NA	NA	NA
VEC64032.1|2221237_2221798_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VEC64033.1|2221832_2222174_-	protein	NA	NA	NA	NA	NA
VEC64034.1|2222308_2222659_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	6.2e-24
VEC64035.1|2222839_2224054_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VEC64036.1|2224065_2225085_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
VEC64037.1|2225272_2226553_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
VEC64038.1|2226587_2226824_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VEC64039.1|2226911_2229383_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
VEC64040.1|2229475_2229667_-	putative prophage protein	NA	NA	NA	NA	NA
VEC64041.1|2229663_2229852_-	division inhibition protein	NA	NA	NA	NA	NA
VEC64042.1|2230251_2230416_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC64043.1|2230419_2230638_-	putative prophage protein	NA	NA	NA	NA	NA
VEC64044.1|2230667_2230796_-	putative prophage protein	NA	NA	NA	NA	NA
VEC64045.1|2230797_2230953_-	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
VEC64046.1|2231119_2231527_-	repressor protein of division inhibition gene	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
VEC64047.1|2231831_2232374_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VEC64048.1|2232810_2233143_-	Qin prophage protein	NA	NA	NA	NA	NA
VEC64049.1|2233675_2233915_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VEC64050.1|2233914_2234202_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VEC64051.1|2234273_2234429_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VEC64052.1|2234645_2235362_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.6	5.4e-115
VEC64053.1|2235783_2235996_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VEC64054.1|2237113_2238025_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.1	2.2e-121
2236332:2236346	attR	TAACGCTGATAAAGG	NA	NA	NA	NA
VEC64055.1|2238021_2238228_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VEC64056.1|2238224_2238647_-|terminase	phage terminase large subunit	terminase	A0A2I6TC92	Escherichia_phage	100.0	1.6e-74
VEC64057.1|2238667_2239225_+|tail	Qin prophage; side tail fiber assembly protein	tail	K7PHC9	Enterobacteria_phage	69.5	1.1e-14
VEC64058.1|2239898_2240489_-	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
VEC64059.1|2240805_2241039_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VEC64060.1|2241825_2243109_+	metabolite transport protein YdfJ	NA	NA	NA	NA	NA
VEC64061.1|2243197_2244658_+	putative sugar dehydrogenase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 6
LR134227	Escherichia coli strain NCTC9102 genome assembly, chromosome: 1	4573055	2408842	2419234	4573055	lysis	Enterobacteria_phage(44.44%)	16	NA	NA
VEC64207.1|2408842_2409976_+	outer membrane protein N (porin)	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
VEC64208.1|2410116_2410551_+	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
VEC64209.1|2410816_2410942_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC64210.1|2411268_2411559_+	iron/manganese transport system periplasmic binding protein SitA	NA	NA	NA	NA	NA
VEC64211.1|2411840_2412629_-	ParB-like nuclease	NA	R4TG31	Halovirus	40.7	9.7e-49
VEC64212.1|2412766_2413378_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VEC64213.1|2413419_2414190_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VEC64214.1|2414419_2414824_-	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	99.3	3.8e-65
VEC64215.1|2414820_2415318_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
VEC64216.1|2415317_2415533_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
VEC64217.1|2415784_2416180_-	tolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VEC64218.1|2416330_2416759_-	TolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VEC64219.1|2417583_2417736_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC64220.1|2417805_2418348_-	antitermination protein	NA	A0A0U2S606	Escherichia_phage	75.1	8.3e-76
VEC64221.1|2418344_2418635_-	phage protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
VEC64222.1|2418634_2419234_-	phage protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
>prophage 7
LR134227	Escherichia coli strain NCTC9102 genome assembly, chromosome: 1	4573055	2423184	2436602	4573055	integrase,tRNA	Escherichia_phage(76.47%)	21	2418815:2418828	2435904:2435917
2418815:2418828	attL	ATAAATATGCTCGG	NA	NA	NA	NA
VEC64226.1|2423184_2423601_-	exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	91.9	3.6e-63
VEC64227.1|2423777_2424077_-	putative phage DNA replication protein	NA	A0A088CBP4	Shigella_phage	77.8	6.5e-38
VEC64228.1|2424083_2424941_-	phage protein	NA	A0A0U2RT81	Escherichia_phage	84.6	2.2e-70
VEC64229.1|2424953_2425376_-	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
VEC64230.1|2425372_2425627_-	putative phage regultory protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	6.3e-18
VEC64231.1|2425706_2426126_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
VEC64232.1|2426416_2426551_+	Rac prophage protein	NA	NA	NA	NA	NA
VEC64233.1|2426561_2426717_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
VEC64234.1|2426713_2427325_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VEC64235.1|2427643_2427865_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
VEC64236.1|2427864_2428035_+	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	69.6	5.1e-16
VEC64237.1|2428109_2428385_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
VEC64238.1|2428486_2429182_+	recombination and repair protein RecT	NA	A0A0U2I1R6	Escherichia_phage	89.0	3.5e-50
VEC64239.1|2429424_2429613_+	Rac prophage; predicted protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
VEC64240.1|2429712_2429928_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VEC64241.1|2429929_2431165_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.3	1.4e-240
VEC64242.1|2431216_2432152_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
VEC64243.1|2432280_2433654_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VEC64244.1|2433683_2433857_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC64245.1|2434131_2435115_-	zinc transport protein	NA	NA	NA	NA	NA
VEC64246.1|2435369_2436602_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2435904:2435917	attR	ATAAATATGCTCGG	NA	NA	NA	NA
>prophage 8
LR134227	Escherichia coli strain NCTC9102 genome assembly, chromosome: 1	4573055	2883703	2948428	4573055	integrase,transposase,tRNA,protease,tail	Salmonella_phage(37.5%)	65	2876666:2876681	2951373:2951388
2876666:2876681	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
VEC64676.1|2883703_2884996_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
VEC64677.1|2885086_2886430_-	putative ATPase	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
VEC64678.1|2886440_2887052_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VEC64679.1|2887210_2891200_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
VEC64680.1|2891334_2891829_-	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VEC64681.1|2892373_2893339_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
VEC64682.1|2893461_2895228_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
VEC64683.1|2895228_2896950_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
VEC64684.1|2896991_2897696_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VEC64685.1|2897980_2898199_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VEC64686.1|2898883_2901160_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
VEC64687.1|2901190_2901511_-|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
VEC64688.1|2901833_2902058_+	stationary phase/starvation inducible regulatory protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
VEC64689.1|2902130_2904077_-	macrolide export ATP-binding/permease protein	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
VEC64690.1|2904073_2905189_-	macrolide-specific efflux protein	NA	NA	NA	NA	NA
VEC64691.1|2905303_2906296_+	virulence protein	NA	NA	NA	NA	NA
VEC64692.1|2906292_2907951_-	nucleoside triphosphate hydrolase domain	NA	NA	NA	NA	NA
VEC64693.1|2908211_2909078_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VEC64694.1|2909074_2909374_-|transposase	transposase	transposase	NA	NA	NA	NA
VEC64695.1|2909637_2910333_+	aquaporin Z	NA	NA	NA	NA	NA
VEC64696.1|2910827_2911727_+	transporter	NA	NA	NA	NA	NA
VEC64697.1|2911870_2913523_+	hydroxylamine reductase	NA	NA	NA	NA	NA
VEC64698.1|2913534_2914503_+	HCP oxidoreductase, NADH-dependent	NA	NA	NA	NA	NA
VEC64699.1|2914635_2916354_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
VEC64700.1|2916390_2917392_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
VEC64701.1|2917402_2918833_+	NAD(P)-binding Rossmann-fold domain	NA	NA	NA	NA	NA
VEC64702.1|2918931_2919945_+	nucleotide di-P-sugar epimerase or dehydratase	NA	NA	NA	NA	NA
VEC64703.1|2919941_2920772_-	putative N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
VEC64704.1|2920768_2921092_-	conserved protein, UPF0145 family	NA	NA	NA	NA	NA
VEC64705.1|2921217_2921733_+	lipoprotein	NA	NA	NA	NA	NA
VEC64706.1|2921950_2922679_+	arginine transport system ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
VEC64707.1|2922696_2923428_+	arginine ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
VEC64708.1|2923434_2924151_+	arginine transport system permease	NA	NA	NA	NA	NA
VEC64709.1|2924150_2924819_+	arginine ABC transporter permease	NA	NA	NA	NA	NA
VEC64710.1|2925109_2925841_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEC64711.1|2926039_2927167_-	23S rRNA (uracil-5-)-methyltransferase	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
VEC64712.1|2927207_2927696_-	inner membrane protein	NA	NA	NA	NA	NA
VEC64713.1|2927755_2928601_-	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VEC64714.1|2928597_2929551_-	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VEC64715.1|2929560_2930694_-	putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
VEC64716.1|2930788_2931901_-	putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEC64717.1|2932251_2932728_-	TPR repeat-containing protein	NA	NA	NA	NA	NA
VEC64718.1|2932815_2933718_-	ribosomal protein S6 modification protein	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
VEC64719.1|2933778_2934501_-	nitroreductase NfsA	NA	NA	NA	NA	NA
VEC64720.1|2934484_2934772_-	inner membrane protein	NA	NA	NA	NA	NA
VEC64721.1|2934931_2935189_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
VEC64722.1|2935218_2935596_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
VEC64723.1|2935865_2936201_+	Putative transport protein ybjL	NA	NA	NA	NA	NA
VEC64724.1|2936145_2937552_+	putative permease	NA	NA	NA	NA	NA
VEC64725.1|2937787_2938006_-	prophage P2 OGR-like protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
VEC64726.1|2938096_2939197_-	Late control protein D protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	2.2e-176
VEC64727.1|2939193_2940261_-|tail	TP901 family phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	75.0	1.4e-106
VEC64728.1|2940896_2941112_-	putative secretory protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
VEC64729.1|2941115_2941319_-|tail	tail X family protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
VEC64730.1|2941318_2942656_-	putative replication protein for prophage	NA	E5G6L9	Salmonella_phage	96.8	1.5e-248
VEC64731.1|2942652_2943510_-	site-specific DNA-methyltransferase	NA	E5G6L8	Salmonella_phage	97.9	4.6e-161
VEC64732.1|2943506_2943734_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
VEC64733.1|2943733_2943967_-	Protein of uncharacterised function (DUF2732)	NA	E5G6L6	Salmonella_phage	97.4	1.4e-32
VEC64734.1|2944034_2944376_-	Uncharacterised protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
VEC64735.1|2944339_2944540_-	Protein of uncharacterised function (DUF2724)	NA	E5G6L4	Salmonella_phage	95.5	4.6e-32
VEC64736.1|2944547_2945057_-	phage regulatory protein CII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
VEC64737.1|2945089_2945311_-	regulator for prophage	NA	NA	NA	NA	NA
VEC64738.1|2945399_2946326_+	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	39.2	2.4e-30
VEC64739.1|2946338_2947310_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC64740.1|2947396_2948428_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.0	1.1e-105
2951373:2951388	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 9
LR134227	Escherichia coli strain NCTC9102 genome assembly, chromosome: 1	4573055	3027606	3056016	4573055	integrase,lysis,tail	Enterobacteria_phage(63.64%)	40	3029522:3029536	3056090:3056104
VEC64861.1|3027606_3028896_+	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
VEC64863.1|3028954_3029431_+	putative phosphatidylethanolamine-binding protein	NA	NA	NA	NA	NA
3029522:3029536	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
VEC64865.1|3029726_3029888_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC64867.1|3030286_3030547_+	ea59	NA	C6ZCZ9	Enterobacteria_phage	98.8	9.9e-43
VEC64869.1|3030839_3031865_+	ea59	NA	K7PHD1	Enterobacteria_phage	100.0	1.2e-192
VEC64871.1|3031861_3032752_+	Uncharacterised protein	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
VEC64873.1|3033342_3034575_+	Uncharacterised protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
VEC64875.1|3035287_3035845_-|tail	Qin prophage; side tail fiber assembly protein	tail	K7PHC9	Enterobacteria_phage	69.5	1.4e-14
VEC64877.1|3036159_3036453_+	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
VEC64879.1|3036484_3036946_-	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	98.0	1.6e-75
VEC64881.1|3036942_3037440_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
VEC64883.1|3037439_3037655_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VEC64885.1|3038243_3039326_+	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	79.0	1.2e-161
VEC64887.1|3039514_3039835_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	82.8	1.9e-43
VEC64889.1|3040110_3040473_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
VEC64891.1|3040469_3040760_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
VEC64893.1|3040752_3040923_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
VEC64895.1|3040922_3041378_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
VEC64897.1|3041592_3042390_-	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VEC64899.1|3042399_3042951_-	kinase inhibitor	NA	NA	NA	NA	NA
VEC64901.1|3043415_3044942_-	site-specific invertase; DLP12 prophage	NA	Q3HQV4	Burkholderia_phage	27.8	1.0e-30
VEC64903.1|3045196_3045529_-	Multidrug transporter emrE	NA	NA	NA	NA	NA
VEC64905.1|3045596_3045899_-	Ren protein from phage origin	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
VEC64907.1|3045895_3046597_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	98.7	2.4e-128
VEC64909.1|3046593_3047613_-	replication protein O	NA	M1FN81	Enterobacteria_phage	67.6	2.3e-111
VEC64911.1|3047609_3048149_-	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
VEC64913.1|3048179_3048407_-	represror Cro	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
VEC64915.1|3048724_3049210_+	Regulatory protein CI from bacteriophage origin	NA	Q76H56	Enterobacteria_phage	84.5	3.1e-74
VEC64917.1|3049329_3049740_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC64919.1|3049764_3050352_+	HTH-type transcriptional regulator ygiT	NA	NA	NA	NA	NA
VEC64921.1|3050348_3050852_+	Uncharacterised protein	NA	A0A2H4J2Z0	uncultured_Caudovirales_phage	38.4	7.3e-26
VEC64923.1|3051340_3051547_+	prophage Kil protein	NA	K7P6H3	Enterobacteria_phage	83.8	3.5e-27
VEC64924.1|3051622_3051919_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
VEC64926.1|3051924_3052710_+	bacteriophage recombination protein	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
VEC64928.1|3052706_3053387_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	7.9e-132
VEC64930.1|3053383_3053566_+	phage protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
VEC64932.1|3053538_3053730_+	phage protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
VEC64934.1|3053806_3054022_+	ybl17	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
VEC64936.1|3054385_3054664_+	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
VEC64938.1|3054945_3056016_+|integrase	putative integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
3056090:3056104	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
