The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134226	Escherichia coli strain NCTC9088 genome assembly, chromosome: 1	4736671	1046702	1053842	4736671	tRNA	Escherichia_phage(83.33%)	6	NA	NA
VEC52773.1|1046702_1047341_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VEC52776.1|1047337_1048600_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
VEC52779.1|1048596_1049505_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
VEC52782.1|1049700_1050468_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
VEC52785.1|1050518_1051175_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	47.2	4.3e-50
VEC52787.1|1051280_1053842_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
LR134226	Escherichia coli strain NCTC9088 genome assembly, chromosome: 1	4736671	1091619	1147211	4736671	transposase,tRNA,integrase	Vibrio_phage(21.43%)	55	1140260:1140319	1147217:1148474
VEC52910.1|1091619_1094250_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
VEC52913.1|1094484_1094670_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
VEC52916.1|1096262_1096829_+	putative phosphatase	NA	NA	NA	NA	NA
VEC52919.1|1096825_1097254_+	inner membrane protein	NA	NA	NA	NA	NA
VEC52922.1|1097326_1098883_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
VEC52923.1|1099032_1099548_+	S-ribosylhomocysteinase	NA	NA	NA	NA	NA
VEC52926.1|1099611_1101150_-	multidrug resistance protein B	NA	NA	NA	NA	NA
VEC52929.1|1101166_1102339_-	multidrug resistance protein A	NA	NA	NA	NA	NA
VEC52932.1|1102465_1102996_-	MarR-family transcriptional repressor	NA	NA	NA	NA	NA
VEC52935.1|1103086_1103422_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEC52938.1|1103411_1104149_-	AzlC-like membrane protein	NA	NA	NA	NA	NA
VEC52941.1|1104272_1105457_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC52944.1|1105747_1106740_-	glycine betaine/L-proline ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
VEC52947.1|1106797_1107862_-	glycine betaine/L-proline ABC transporter permease	NA	NA	NA	NA	NA
VEC52950.1|1107854_1109057_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
VEC52953.1|1109411_1110371_-	ribonucleoside-diphosphate reductase 2 beta chain	NA	R4TBI6	Mycobacterium_phage	71.5	2.2e-132
VEC52956.1|1110380_1112525_-	ribonucleoside-diphosphate reductase 2 alpha chain	NA	A8E2R1	Enterococcus_phage	48.5	2.2e-196
VEC52959.1|1112497_1112908_-	ribonucleotide reductase stimulatory protein	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
VEC52962.1|1112904_1113150_-	glutaredoxin-like protein	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
VEC52965.1|1113397_1113727_-	protein	NA	NA	NA	NA	NA
VEC52968.1|1113878_1114223_+	protein	NA	NA	NA	NA	NA
VEC52971.1|1114259_1114709_-	inner membrane protein	NA	NA	NA	NA	NA
VEC52974.1|1115376_1115781_+	DNA-binding protein	NA	NA	NA	NA	NA
VEC52977.1|1115827_1116352_-	inner membrane protein with hydrolase activity	NA	NA	NA	NA	NA
VEC52980.1|1116361_1116661_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
VEC52983.1|1116843_1117002_+	membrane protein	NA	NA	NA	NA	NA
VEC52986.1|1117085_1117535_+	putative peptidoglycan-binding protein	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
VEC52989.1|1117535_1118198_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEC52992.1|1118218_1119619_-	gamma-aminobutyrate transporter	NA	NA	NA	NA	NA
VEC52995.1|1119855_1121136_-	4-aminobutyrate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	30.3	1.1e-33
VEC52997.1|1121149_1122598_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VEC53000.1|1122620_1123889_-	hydroxyglutarate oxidase	NA	NA	NA	NA	NA
VEC53003.1|1123907_1124885_-	Protein CsiD	NA	NA	NA	NA	NA
VEC53006.1|1125221_1125755_-	alpha amylase	NA	NA	NA	NA	NA
VEC53009.1|1125828_1127475_-	alpha-amylase	NA	NA	NA	NA	NA
VEC53012.1|1128861_1129476_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53015.1|1129490_1130234_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53017.1|1130360_1130834_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53020.1|1131146_1131617_+	outer membrane protein	NA	NA	NA	NA	NA
VEC53023.1|1131586_1132333_-|transposase	IS911 transposase orfB	transposase	Q716C2	Shigella_phage	59.0	2.5e-83
VEC53026.1|1132820_1133120_-	GTP-binding factor (fragment) from CP4-like prophage	NA	NA	NA	NA	NA
VEC53029.1|1133285_1133525_-	phage transcriptional regulator AlpA	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
VEC53032.1|1133638_1134142_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53035.1|1134138_1134519_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53038.1|1134786_1134966_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53041.1|1134952_1135699_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53044.1|1135744_1139596_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53047.1|1140063_1140297_+	Uncharacterised protein	NA	NA	NA	NA	NA
1140260:1140319	attL	TGATCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAGAGGTGA	NA	NA	NA	NA
VEC53048.1|1140324_1140624_+|transposase	transposase	transposase	NA	NA	NA	NA
VEC53051.1|1140620_1141487_+|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VEC53054.1|1141504_1144441_+	addiction module	NA	NA	NA	NA	NA
VEC53057.1|1144437_1145070_+	addiction module	NA	NA	NA	NA	NA
VEC53060.1|1145208_1145907_-|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.2	4.8e-60
VEC53063.1|1146048_1146915_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VEC53066.1|1146911_1147211_-|transposase	transposase	transposase	NA	NA	NA	NA
1147217:1148474	attR	TCACCTCTGACTGAGAGTTTACTCACTTAGCCGCGTGTCCACTATTGCTGGGTAAGATCAAACGTCGCCAATCGCAGGAAAGACGTCTCTTTCAAGAGAGCGCCAGATATCTTCCGCATAGTCCTCTGTCACACTGGCTTTCTTCACATTCCACCAACGTTCAGCTACGAGTTGGAAAGTGTTGGTTTTGGCTTCCAGCGAACTGCGCAATTGTTCTTGCTGATGTTCCTGCGGATCGATCTGTTTAGCCAGTAGTGAGCGGGACTCTGCACGGTAGTTTCTGGCATCGGCAAGGGTAACTGACGGGTAGGAGCCTATGCTCTTCTTTGCTCGTTTCTTGGTGACAGGGCGAATGTAGCGAAACTGCCAGATTTTACTCCCGCTGGATTTAATGAGTAGCTCAAGGCCATCGCCATCATAGAGAACGTAGTCCGCCTCCTTGGGTTTGGCTGATTCTATTTCTTTAACGGATAGAGGTTTGGTTTGTCTTGCCATTGCCGGGTTTCCATAGTTTTAGGCACCTCAAAAAACAATAAAGCTTTATGAGGTGCCTAACAAGGTGCCTAAAAGGATCGGATTTAATTAGTTTTCTTCGGACTTCGCGGGACAAATTGAGGGCACAAAAAAGCCCGCAGGGCTTGCGCCGTGCGGGCTCTTAGGACTTCATCGGATGACTCTGGTAATCACCGATGGAGAATTTTGGTGGGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACATCCTCGGTACTACATGCTTAGTCAGTCTTTACATTCGCTTGCCAGCTGCGGACGGACACGCCACTAACAAACTAGCCTGATTAAGTTTTAACGCTTCAACCCCAGGCAGGGCTTCCACGCGATCTCTTTTGGGTTTGACCTCTCTTGATCCCCGTCCTAAGAGCGGAGGCTAGGGAGAGAGGGCTCTAAGCAGGTTATTAAGCTGCTAAAGCGTAGTTTTCGTCGTTTGCGACTATTTTTTGCGGCTTTTTACGAGGCCAACCGCCCCTCGGCATGCACCTTGGGTTTCGCAAATCCCGTCGAATCCAGAATCAGCCCCAATGTGTAAAGGTAAGTATACCAGATTTATGAGCGCCATGACCAGCCTCAATGGCGTTATCGTTAAAGATTTAGCACCCATGTAGCCTGATTTTTATTCGATTAAGCAATGGGATGGCAACATTTGTGTCGGATGTGATAGCCAATAAGATGTTCATTCGCGCCGCCGGAGAGGGAGGCGCGGTGAGGAACTGGTC	NA	NA	NA	NA
>prophage 3
LR134226	Escherichia coli strain NCTC9088 genome assembly, chromosome: 1	4736671	1649172	1658614	4736671		Enterobacteria_phage(85.71%)	10	NA	NA
VEC54368.1|1649172_1650099_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
VEC54372.1|1650103_1650835_+	ABC transporter permease	NA	NA	NA	NA	NA
VEC54375.1|1650815_1650923_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEC54377.1|1650982_1651714_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VEC54380.1|1651935_1653621_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VEC54383.1|1653617_1654337_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEC54386.1|1654383_1654854_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VEC54389.1|1654894_1655356_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VEC54392.1|1655480_1657481_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
VEC54395.1|1657477_1658614_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 4
LR134226	Escherichia coli strain NCTC9088 genome assembly, chromosome: 1	4736671	1750103	1758896	4736671		Enterobacteria_phage(42.86%)	9	NA	NA
VEC54620.1|1750103_1751498_+	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
VEC54623.1|1751672_1752566_+	UTP--glucose-1-phosphate uridylyltransferase subunit GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.1e-45
VEC54626.1|1753091_1754228_+	H repeat-associated protein	NA	NA	NA	NA	NA
VEC54629.1|1754291_1754885_+	chloramphenicol acetyltransferase (fragment)	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	29.3	2.8e-08
VEC54632.1|1754884_1755469_+	putative lipopolysaccharide biosynthesis O-acetyl transferase WbbJ	NA	NA	NA	NA	NA
VEC54635.1|1755501_1756584_+	dTDP-D-glucose 4,6-dehydratase rmlB	NA	I7HTA3	Enterobacteria_phage	52.5	3.1e-98
VEC54638.1|1756616_1757492_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	62.0	1.9e-101
VEC54641.1|1757518_1758079_+	dTDP-6-deoxy-D-glucose-3,5 epimerase	NA	I7HJC4	Enterobacteria_phage	53.3	2.2e-47
VEC54644.1|1758071_1758896_+	dTDP-6-deoxy-D-xylo-4-hexulose reductase	NA	A0A2H4UUK0	Bodo_saltans_virus	25.9	6.9e-05
>prophage 5
LR134226	Escherichia coli strain NCTC9088 genome assembly, chromosome: 1	4736671	2200542	2263294	4736671	lysis,terminase,tail,integrase,portal,protease,head	Enterobacteria_phage(46.51%)	67	2208119:2208134	2238480:2238495
VEC55932.1|2200542_2201271_-|protease	putative protease	protease	NA	NA	NA	NA
VEC55935.1|2201239_2201365_-|protease	putative protease	protease	NA	NA	NA	NA
VEC55938.1|2201640_2201949_-	acid shock protein	NA	NA	NA	NA	NA
VEC55941.1|2202372_2203626_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC55944.1|2203732_2204626_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEC55947.1|2204760_2205981_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VEC55950.1|2206105_2206801_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VEC55954.1|2206753_2208010_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
2208119:2208134	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
VEC55957.1|2208204_2208819_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VEC55960.1|2208861_2209716_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VEC55963.1|2209717_2210335_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VEC55966.1|2210345_2212742_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
VEC55969.1|2212829_2215256_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
VEC55972.1|2215454_2215760_-	protein	NA	NA	NA	NA	NA
VEC55975.1|2215831_2216578_+	lipoprotein	NA	NA	NA	NA	NA
VEC55978.1|2216580_2217141_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VEC55981.1|2217175_2217517_-	protein	NA	NA	NA	NA	NA
VEC55984.1|2217651_2217978_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VEC55987.1|2218183_2219398_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	5.3e-46
VEC55990.1|2219409_2220429_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
VEC55993.1|2220486_2220615_+	protein, truncated	NA	NA	NA	NA	NA
VEC55995.1|2220616_2221897_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.3	1.5e-155
VEC55998.1|2221931_2222168_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VEC56001.1|2222255_2224748_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.1	2.5e-58
VEC56004.1|2224841_2225033_-	putative prophage protein	NA	NA	NA	NA	NA
VEC56007.1|2225029_2225218_-	division inhibition protein	NA	NA	NA	NA	NA
VEC56010.1|2225704_2226280_-	putative prophage protein	NA	NA	NA	NA	NA
VEC56013.1|2226281_2226437_-	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
VEC56016.1|2226605_2227013_-	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	51.9	1.2e-31
VEC56019.1|2227093_2227321_+	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VEC56022.1|2227304_2227826_+	YdfX	NA	NA	NA	NA	NA
VEC56025.1|2227806_2228772_+	ybl78	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
VEC56028.1|2228812_2229214_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	93.2	7.8e-63
VEC56031.1|2229507_2231799_+	hemin importer ATP-binding subunit	NA	NA	NA	NA	NA
VEC56034.1|2232634_2232886_+	putative prophage protein	NA	NA	NA	NA	NA
VEC56037.1|2233232_2234282_+	putative prophage protein	NA	U5P0K4	Shigella_phage	57.0	3.7e-112
VEC56040.1|2234295_2235048_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VEC56043.1|2235469_2235682_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VEC56046.1|2236961_2237168_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VEC56049.1|2237172_2237484_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VEC56053.1|2237480_2238014_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VEC56056.1|2238010_2238508_+	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2238480:2238495	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
VEC56059.1|2239756_2239930_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VEC56062.1|2240081_2240492_-	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
VEC56065.1|2240792_2240999_+	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
VEC56068.1|2241019_2241187_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC56071.1|2241563_2242091_+|terminase	putative terminase small subunit	terminase	A5LH26	Enterobacteria_phage	99.4	2.8e-92
VEC56073.1|2242099_2244199_+|terminase	terminase large subunit	terminase	A5LH27	Enterobacteria_phage	96.4	0.0e+00
VEC56075.1|2244195_2244408_+	prophage protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
VEC56078.1|2244407_2245022_+|portal	portal protein	portal	A5LH29	Enterobacteria_phage	99.0	9.0e-111
VEC56080.1|2244984_2245917_+|head,tail,portal	portal protein (head-tail preconnector protein) from prophage	head,tail,portal	A5LH29	Enterobacteria_phage	99.0	2.0e-170
VEC56083.1|2245861_2247889_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
VEC56086.1|2247975_2248299_+	prophage protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
VEC56089.1|2248291_2248567_+	prophage protein	NA	K7PH43	Enterobacteria_phage	98.9	1.5e-44
VEC56092.1|2248578_2249157_+|tail	Minor tail protein Z (GPZ) of prophage	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
VEC56095.1|2249153_2249555_+|tail	Minor tail protein U	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
VEC56098.1|2249565_2250309_+|tail	Major tail protein V	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
VEC56101.1|2250369_2250756_+|tail	minor tail component of prophage	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
VEC56104.1|2250764_2251094_+|tail	minor tail protein T of prophage	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
VEC56107.1|2251065_2254131_+|tail	putative tail length tape measure protein from putative prophage	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
VEC56110.1|2254130_2254460_+|tail	Minor tail protein M	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
VEC56113.1|2254469_2255168_+|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	98.7	3.3e-133
VEC56116.1|2255317_2255917_+|tail	tail component	tail	A5LH41	Enterobacteria_phage	97.5	2.3e-119
VEC56118.1|2255913_2256462_+	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	96.2	1.4e-91
VEC56121.1|2256521_2259917_+	Host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.8	0.0e+00
VEC56124.1|2259984_2260584_+	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	95.0	1.1e-105
VEC56127.1|2260648_2263294_+|tail	L-shaped tail fiber protein	tail	K7PGT9	Enterobacteria_phage	97.5	0.0e+00
>prophage 6
LR134226	Escherichia coli strain NCTC9088 genome assembly, chromosome: 1	4736671	2683550	2693554	4736671		Enterobacteria_phage(75.0%)	11	NA	NA
VEC57474.1|2683550_2684123_-	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	8.5e-95
VEC57477.1|2684196_2684697_-	transcriptional activator Ogr/delta	NA	NA	NA	NA	NA
VEC57480.1|2684693_2685428_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	5.2e-129
VEC57483.1|2685979_2686246_+	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
VEC57486.1|2686834_2687122_+	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VEC57489.1|2687114_2687570_+	putative prophage protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
VEC57491.1|2687705_2688026_+	P4 phage protein	NA	NA	NA	NA	NA
VEC57494.1|2688040_2690374_+	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
VEC57497.1|2690856_2691327_-	peptidase T	NA	NA	NA	NA	NA
VEC57500.1|2691576_2692713_+	spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
VEC57503.1|2692696_2693554_+	spermidine/putrescine ABC transporter membrane protein	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 7
LR134226	Escherichia coli strain NCTC9088 genome assembly, chromosome: 1	4736671	2887119	2986163	4736671	lysis,terminase,holin,plate,capsid,protease,tRNA,integrase,tail	Escherichia_phage(45.0%)	94	2896781:2896796	2989478:2989493
VEC58522.1|2887119_2888520_+|tRNA	asparaginyl-tRNA synthetase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
VEC58525.1|2889121_2890210_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
VEC58528.1|2890394_2891585_+	aspartate aminotransferase	NA	NA	NA	NA	NA
VEC58531.1|2891806_2892454_-	metal-binding hydrolase	NA	NA	NA	NA	NA
VEC58534.1|2892480_2893029_-	exported protein YcbK	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
VEC58537.1|2893209_2895057_-	putative peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
VEC58540.1|2895317_2899778_-	chromosome partition protein	NA	NA	NA	NA	NA
2896781:2896796	attL	GCTCCGCTTCCGCCTG	NA	NA	NA	NA
VEC58543.1|2899777_2900482_-	condesin subunit E	NA	NA	NA	NA	NA
VEC58546.1|2900462_2901785_-	chromosome partition protein	NA	NA	NA	NA	NA
VEC58549.1|2901781_2902567_-	metallothionein SmtA	NA	NA	NA	NA	NA
VEC58552.1|2902702_2903482_+	inner membrane protein	NA	NA	NA	NA	NA
VEC58555.1|2903458_2904352_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC58558.1|2904505_2905252_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
VEC58561.1|2905248_2905431_-	peroxide and acid resistance protein, UPF0434 family	NA	NA	NA	NA	NA
VEC58563.1|2905482_2906715_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEC58566.1|2906751_2907738_-	tetraacyldisaccharide 4'-kinase (lipid A 4'-kinase)	NA	NA	NA	NA	NA
VEC58569.1|2907734_2908475_-	lipid A export permease MsbA	NA	W8CYL7	Bacillus_phage	45.0	3.1e-33
VEC58572.1|2908419_2909484_-	Lipid A export ATP-binding/permease protein msbA	NA	NA	NA	NA	NA
VEC58575.1|2909520_2911785_-	putative competence-related protein	NA	NA	NA	NA	NA
VEC58579.1|2911991_2912276_-	integration host factor	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
VEC58582.1|2912435_2914109_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
VEC58585.1|2914219_2914903_-	cytidylate kinase	NA	NA	NA	NA	NA
VEC58588.1|2915261_2915840_-	peptidase, M48B family	NA	NA	NA	NA	NA
VEC58591.1|2916008_2917292_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
VEC58594.1|2917362_2918451_-	phosphoserine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
VEC58597.1|2918649_2919342_-	membrane protein YcaP	NA	NA	NA	NA	NA
VEC58600.1|2919471_2921232_+	putative fatty acid binding protein	NA	NA	NA	NA	NA
VEC58603.1|2921637_2922495_+	formate transporter	NA	NA	NA	NA	NA
VEC58606.1|2922549_2924832_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
VEC58609.1|2925151_2925370_-	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VEC58612.1|2925451_2926615_-	phage protein D	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
VEC58615.1|2926614_2926800_-	gpU phage protein	NA	O64315	Escherichia_phage	95.9	1.0e-17
VEC58618.1|2926750_2927095_-	gpU phage protein	NA	A0A0F7LDE8	Escherichia_phage	99.1	7.6e-59
VEC58621.1|2927109_2927997_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	94.9	4.3e-122
VEC58624.1|2927990_2929556_-|tail	phage related tail protein	tail	Q858U7	Yersinia_virus	99.4	4.6e-260
VEC58627.1|2929700_2929976_-|tail	tail protein E (GpE)	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
VEC58630.1|2930033_2930552_-|tail	phage major tail tube protein FII	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
VEC58633.1|2930564_2931755_-|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	99.7	6.2e-225
VEC58636.1|2932076_2933297_+	Uncharacterised protein	NA	Q858S8	Enterobacteria_phage	59.4	2.8e-103
VEC58639.1|2933436_2933964_-|tail	tail assembly chaperone gp38	tail	U5N0T1	Enterobacteria_phage	91.4	7.8e-87
VEC58643.1|2933967_2936214_-|tail	putative tail fiber protein (GpH)	tail	U5N099	Enterobacteria_phage	56.9	9.5e-166
VEC58646.1|2936224_2936755_-|tail	tail protein I (GpI)	tail	U5N0U8	Enterobacteria_phage	99.4	6.6e-102
VEC58649.1|2936747_2937656_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	3.4e-162
VEC58652.1|2937660_2938008_-|plate	phage baseplate protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	1.9e-57
VEC58655.1|2938004_2938640_-|plate	Baseplate assembly protein V (GpV)	plate	U5N3F0	Enterobacteria_phage	98.6	1.7e-112
VEC58658.1|2938723_2939509_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC58661.1|2939580_2940033_-|tail	tail protein	tail	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
VEC58664.1|2940025_2940493_-|tail	tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
VEC58667.1|2940455_2940614_-|lysis	phage lysis protein LysC	lysis	M1RZ27	Escherichia_phage	100.0	2.6e-22
VEC58670.1|2940600_2941026_-	LysB protein	NA	A0A0F7LDJ6	Escherichia_phage	96.5	1.0e-65
VEC58673.1|2941013_2941439_-	LysA protein	NA	A0A0F7LDU9	Escherichia_phage	97.2	1.5e-59
VEC58676.1|2941453_2941951_-	phage lysin	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
VEC58679.1|2941950_2942232_-|holin,lysis	phage lysis holin	holin,lysis	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
VEC58682.1|2942235_2942439_-|tail	phage tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
VEC58684.1|2942438_2942948_-|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
VEC58687.1|2943047_2943791_-|terminase	small terminase subunit	terminase	Q94MH8	Enterobacteria_phage	99.6	1.2e-125
VEC58690.1|2943794_2944868_-|capsid	major capsid protein	capsid	Q778Y7	Enterobacteria_phage	99.2	4.3e-201
VEC58692.1|2944926_2945781_-|capsid	phage capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	96.8	1.9e-130
VEC58694.1|2945954_2947727_+	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
VEC58696.1|2947726_2948761_+|capsid	phage capsid protein	capsid	A0A0F7LDI7	Escherichia_phage	99.7	5.5e-201
VEC58698.1|2949105_2949957_-	type II 5-cytosoine methyltransferase	NA	Q83VT0	Escherichia_phage	99.6	8.6e-160
VEC58700.1|2950526_2951582_+	SacI restriction endonuclease	NA	Q83VS8	Escherichia_phage	100.0	2.2e-197
VEC58702.1|2951675_2953946_-	Replication gene A protein (GpA)	NA	A0A0F7LBQ2	Escherichia_phage	97.5	0.0e+00
VEC58705.1|2953935_2954211_-	relication initiation protein	NA	M1TAP2	Escherichia_phage	100.0	3.8e-45
VEC58707.1|2954207_2954432_-	C4-type zinc finger protein, DksA/TraR family	NA	A0A0F7LDG9	Escherichia_phage	97.3	5.5e-34
VEC58709.1|2954431_2954722_-	Uncharacterised protein	NA	M1RZ07	Escherichia_phage	81.7	5.5e-34
VEC58711.1|2954718_2954964_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC58713.1|2954978_2955191_-	Protein of uncharacterised function (DUF2732)	NA	S4TP68	Salmonella_phage	92.9	8.6e-29
VEC58715.1|2955254_2955755_-	Phage protein B	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
VEC58716.1|2955751_2955922_-	Uncharacterised protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
VEC58717.1|2955932_2956289_-	Cox protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
VEC58718.1|2956456_2956705_+	Phage protein C	NA	Q1JS25	Enterobacteria_phage	100.0	1.2e-42
VEC58720.1|2956798_2957794_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
VEC58721.1|2957825_2958623_+	pyruvate formate lyase-activating enzyme 1	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
VEC58723.1|2958704_2959295_-	NAD(P)H dehydrogenase (quinone)	NA	NA	NA	NA	NA
VEC58724.1|2959394_2960303_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VEC58726.1|2960303_2961734_-	putative amino acid permease	NA	NA	NA	NA	NA
VEC58729.1|2961943_2963068_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC58732.1|2963406_2964033_+	protein YcaC	NA	NA	NA	NA	NA
VEC58735.1|2964068_2964932_-	anaerobic dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
VEC58738.1|2964933_2965551_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
VEC58741.1|2965561_2968006_-	anaerobic dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
VEC58744.1|2968244_2969537_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
VEC58747.1|2969627_2970971_-	putative ATPase	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
VEC58750.1|2970981_2971593_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VEC58753.1|2971747_2975854_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
VEC58756.1|2975988_2976483_-	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VEC58759.1|2977026_2977992_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
VEC58762.1|2978114_2979881_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
VEC58765.1|2979881_2981603_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
VEC58768.1|2981644_2982349_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VEC58771.1|2982633_2982852_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VEC58774.1|2983535_2985812_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
VEC58777.1|2985842_2986163_-|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
2989478:2989493	attR	GCTCCGCTTCCGCCTG	NA	NA	NA	NA
>prophage 8
LR134226	Escherichia coli strain NCTC9088 genome assembly, chromosome: 1	4736671	3336831	3391042	4736671	lysis,terminase,capsid,protease,tRNA,integrase,portal,tail,head,coat	Enterobacteria_phage(37.5%)	60	3336363:3336409	3380836:3380882
3336363:3336409	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VEC59493.1|3336831_3337785_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VEC59495.1|3338210_3339455_+|protease	putative protease	protease	NA	NA	NA	NA
VEC59497.1|3340012_3340669_+	methylase	NA	NA	NA	NA	NA
VEC59499.1|3341307_3344400_-|tail	putative tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.7e-54
VEC59501.1|3344464_3345064_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	93.5	1.2e-104
VEC59503.1|3345131_3348611_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
VEC59505.1|3348671_3349244_-|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
VEC59507.1|3349240_3349984_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.4	7.3e-147
VEC59509.1|3349989_3350688_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
VEC59511.1|3350687_3351017_-|tail	Minor tail protein M	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
VEC59513.1|3351013_3353593_-|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.8	0.0e+00
VEC59515.1|3353585_3354020_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VEC59517.1|3354001_3354424_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
VEC59519.1|3354439_3355180_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	2.9e-132
VEC59521.1|3355187_3355583_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VEC59523.1|3355579_3356158_-|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
VEC59525.1|3356169_3356523_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
VEC59527.1|3356534_3356930_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
VEC59529.1|3356971_3357997_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
VEC59531.1|3358052_3358385_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
VEC59533.1|3358394_3359714_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
VEC59535.1|3359694_3361296_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.2	8.5e-310
VEC59537.1|3361292_3361499_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VEC59539.1|3361495_3363421_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
VEC59541.1|3363395_3363941_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	6.8e-94
VEC59543.1|3364688_3364895_-	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
VEC59545.1|3365180_3365591_+	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
VEC59546.1|3365881_3366175_+	lambdoid prophage DLP12 Bor-like protein	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
VEC59548.1|3366206_3366668_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
VEC59550.1|3366664_3367162_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
VEC59552.1|3367161_3367377_-|lysis	lysis protein S from lambdoid prophage	lysis	A5LH82	Enterobacteria_phage	97.2	7.7e-33
VEC59554.1|3367966_3369064_+	outer membrane porin; DLP12 prophage	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
VEC59556.1|3369253_3369637_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
VEC59558.1|3369654_3370644_-	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
VEC59560.1|3370651_3371449_-	putative KilA-N phage protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
VEC59562.1|3371468_3371858_-	putative Crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
VEC59564.1|3371854_3372181_-	putative LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
VEC59566.1|3372180_3372669_-	CPS-53 (KpLE1) prophage protein	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	4.0e-85
VEC59568.1|3372671_3373613_-	phage O protein family	NA	U5P0A0	Shigella_phage	99.0	1.9e-152
VEC59570.1|3373622_3373961_-	Uncharacterised protein	NA	S5FNS9	Shigella_phage	98.2	1.0e-55
VEC59572.1|3373957_3374509_-	nucleic acid-binding protein; e14 prophage	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
VEC59574.1|3374501_3374762_-	putative lambda repressor-like DNA-binding domains	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
VEC59576.1|3374904_3375552_+	regulatory protein	NA	S5FUZ3	Shigella_phage	100.0	2.8e-118
VEC59578.1|3375871_3376387_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC59580.1|3376857_3377220_+	CPS-53 (KpLE1) prophage protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
VEC59582.1|3377285_3378110_+	CPS-53 (KpLE1) prophage protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
VEC59584.1|3378237_3378774_+	CPS-53 (KpLE1) prophage protein	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
VEC59586.1|3378764_3379127_+	CPS-53 (KpLE1) prophage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
VEC59588.1|3379126_3379432_+	CPS-53 (KpLE1) prophage protein	NA	U5P0J0	Shigella_phage	94.1	6.0e-47
VEC59590.1|3379658_3380822_+|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A088CD23	Shigella_phage	86.3	1.2e-199
VEC59592.1|3381156_3381789_+	two component transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
3380836:3380882	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VEC59594.1|3381791_3382307_-	fimbrial protein	NA	NA	NA	NA	NA
VEC59596.1|3382317_3383325_-	fimbrial protein	NA	NA	NA	NA	NA
VEC59598.1|3383483_3385946_-	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEC59600.1|3385976_3386669_-	fimbrial chaperone	NA	NA	NA	NA	NA
VEC59601.1|3386888_3387431_-	fimbrial-like protein	NA	NA	NA	NA	NA
VEC59602.1|3387911_3388778_+	5,10-methylene-tetrahydrofolate dehydrogenase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
VEC59603.1|3388779_3388992_+	putative RNA-binding protein	NA	NA	NA	NA	NA
VEC59604.1|3389099_3389621_+	putative membrane-bound metal-dependent hydrolase	NA	NA	NA	NA	NA
VEC59605.1|3389656_3391042_-|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 9
LR134226	Escherichia coli strain NCTC9088 genome assembly, chromosome: 1	4736671	4099685	4112957	4736671	integrase	Enterobacteria_phage(70.0%)	13	4094091:4094105	4124666:4124680
4094091:4094105	attL	GCATTAATGAAATGT	NA	NA	NA	NA
VEC60614.1|4099685_4101155_+	protein kinase from phage origin	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
VEC60616.1|4101356_4102622_-|integrase	site-specific recombinase, phage integrase family protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
VEC60618.1|4102840_4103077_-	Uncharacterised protein	NA	Q38404	Enterobacteria_phage	96.1	3.5e-23
VEC60620.1|4103383_4105717_-	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
VEC60622.1|4105731_4106052_-	P4 phage protein	NA	NA	NA	NA	NA
VEC60624.1|4106187_4106643_-	putative prophage protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
VEC60626.1|4106635_4106923_-	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VEC60628.1|4107502_4107769_-	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
VEC60630.1|4108320_4109055_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	5.2e-129
VEC60632.1|4109051_4109552_+	transcriptional activator Ogr/delta	NA	NA	NA	NA	NA
VEC60634.1|4109625_4110198_+	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
VEC60636.1|4110867_4111596_+	death-on-curing family protein	NA	NA	NA	NA	NA
VEC60638.1|4111697_4112957_-|integrase	site-specific recombinase, phage integrase family	integrase	B7SYF8	Stenotrophomonas_phage	40.7	2.4e-73
4124666:4124680	attR	ACATTTCATTAATGC	NA	NA	NA	NA
