The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	48065	58664	4941549	integrase	Enterobacteria_phage(80.0%)	13	47556:47578	58825:58847
47556:47578	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
VEC46736.1|48065_50399_-	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
VEC46737.1|50413_50734_-	P4 phage protein	NA	NA	NA	NA	NA
VEC46738.1|50869_51325_-	putative prophage protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
VEC46739.1|51317_51605_-	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VEC46740.1|52193_52460_-	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
VEC46741.1|53012_53747_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	99.2	7.2e-131
VEC46742.1|53743_54244_+	transcriptional activator Ogr/delta	NA	NA	NA	NA	NA
VEC46743.1|54317_54503_+	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	92.3	2.2e-12
VEC46744.1|54499_54889_+	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.1	1.7e-62
VEC46745.1|55199_55622_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC46746.1|55618_56824_-	excinuclease ABC subunit B	NA	A0A1W6JHS6	Lactococcus_phage	27.5	5.9e-05
VEC46747.1|56834_57491_-	Predicted HKD family nuclease	NA	A0A097BY72	Enterococcus_phage	25.5	1.4e-08
VEC46748.1|57500_58664_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	88.9	2.9e-203
58825:58847	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	1090980	1098120	4941549	tRNA	Escherichia_phage(83.33%)	6	NA	NA
VEC47979.1|1090980_1091619_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VEC47980.1|1091615_1092878_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
VEC47982.1|1092874_1093783_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
VEC47983.1|1093978_1094746_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
VEC47984.1|1094796_1095453_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
VEC47985.1|1095558_1098120_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	1476634	1533764	4941549	transposase,portal,plate,terminase,holin,tail,capsid,tRNA,integrase	Enterobacteria_phage(81.25%)	71	1480063:1480086	1525394:1525417
VEC48782.1|1476634_1478641_-|tRNA	tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC	tRNA	NA	NA	NA	NA
VEC48783.1|1478799_1480020_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
1480063:1480086	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
VEC48785.1|1480312_1481491_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC48786.1|1481487_1482483_-	cell division protein	NA	NA	NA	NA	NA
VEC48787.1|1482712_1483498_-	methyltransferase	NA	Q775B4	Bordetella_phage	52.1	7.3e-65
VEC48788.1|1483881_1484022_-	small toxic polypeptide	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
VEC48789.1|1484213_1484474_-	DNA-binding transcriptional regulator prophage remnant	NA	NA	NA	NA	NA
VEC48790.1|1484558_1485629_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC48792.1|1485801_1486911_-	Gene late control D protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	4.8e-195
VEC48793.1|1487068_1488253_+|tail	Major tail sheath protein FI	tail	A0A0A7NV69	Enterobacteria_phage	97.5	6.4e-222
VEC48794.1|1488252_1488765_+|tail	Major tail tube protein FII	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
VEC48795.1|1488820_1489186_+|tail	phage tail E family protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
VEC48797.1|1489336_1492144_+|tail	tail protein (modular protein)	tail	A0A0A7NRZ9	Enterobacteria_phage	88.2	0.0e+00
VEC48798.1|1492156_1492645_+|tail	tail fiber protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
VEC48799.1|1492741_1493920_-	lipopolysaccharide core biosynthesis	NA	NA	NA	NA	NA
VEC48800.1|1494613_1496725_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	97.7	9.7e-112
VEC48801.1|1496727_1497258_-|tail	putative tail protein I (gpi)	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
VEC48803.1|1497250_1498147_-|plate	Baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	98.7	3.5e-156
VEC48804.1|1498150_1498501_-|plate	Baseplate assembly protein W	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
VEC48805.1|1498497_1499079_-|plate	baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	5.6e-102
VEC48806.1|1499075_1499261_-|tail	phage tail protein S	tail	A0A0A7NV60	Enterobacteria_phage	96.7	3.5e-26
VEC48808.1|1499202_1499721_-|tail	phage tail protein S	tail	A0A0A7NV60	Enterobacteria_phage	99.3	8.2e-73
VEC48809.1|1499704_1500172_-|tail	Phage tail completion protein R	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
VEC48810.1|1500309_1500717_-	Uncharacterised protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	7.7e-66
VEC48811.1|1500713_1501106_-	putative phage PS3	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	9.9e-71
VEC48812.1|1501102_1501426_-|holin	putative phage holin protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
VEC48814.1|1501428_1501629_-	Tail protein X (GpX)	NA	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
VEC48815.1|1501628_1502123_-	Head completion/stabilization protein L	NA	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
VEC48816.1|1502224_1503025_-|terminase	Phage terminase, endonuclease small subunit M	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.3e-130
VEC48817.1|1503070_1504123_-|capsid	Major capsid protein precursor (GpN)	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	2.5e-193
VEC48819.1|1504146_1504983_-	Capsid scaffolding protein O	NA	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
VEC48820.1|1505137_1506889_+	Terminase, ATPase subunit (GpP)	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
VEC48821.1|1506888_1507935_+|capsid,portal	portal capsid protein Q (GpQ)	capsid,portal	A0A0A7NPT9	Enterobacteria_phage	99.7	7.4e-206
VEC48823.1|1508425_1509016_-	putative EA22-like protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
VEC48825.1|1509079_1509391_-	putative plasmid stability protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
VEC48827.1|1509395_1510355_-	Plasmid segregation protein parM (Protein stbA) (ParA locus 36 kDa protein)	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
VEC48829.1|1510431_1511937_-	phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	96.0	2.1e-278
VEC48831.1|1511956_1513255_-	phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	94.8	5.2e-233
VEC48834.1|1513261_1513627_-	Uncharacterised protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
VEC48836.1|1513699_1513930_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
VEC48838.1|1514261_1514462_-	Uncharacterised protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.4	1.3e-23
VEC48840.1|1514424_1514553_-	Uncharacterised protein	NA	A0A0A7NRX6	Enterobacteria_phage	100.0	1.1e-07
VEC48842.1|1514549_1514795_-	Uncharacterized protein conserved in archaea	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
VEC48844.1|1514791_1514995_-	Uncharacterised protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
VEC48846.1|1515190_1515433_-	Uncharacterised protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
VEC48848.1|1515593_1515731_-	Uncharacterised protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.9	2.4e-08
VEC48850.1|1515786_1516083_-	Uncharacterised protein	NA	A0A0A7NV42	Enterobacteria_phage	88.0	2.6e-39
VEC48852.1|1516084_1516192_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC48854.1|1516188_1516296_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC48856.1|1516243_1516543_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC48858.1|1516549_1516837_-	putative regulatory protein Cox	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
VEC48860.1|1516950_1517271_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
VEC48862.1|1517367_1518372_+|integrase	integrase/recombinase, phage integrase family	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
VEC48864.1|1518530_1519688_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
VEC48866.1|1519753_1520767_+	putative semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VEC48868.1|1520766_1521579_+|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
VEC48870.1|1521661_1522321_+	inner membrane protein	NA	NA	NA	NA	NA
VEC48872.1|1522476_1523397_+	acetylCoA carboxylase	NA	NA	NA	NA	NA
VEC48874.1|1523459_1524728_+	bifunctional FolC protein [includes: folylpolyglutamate synthase; dihydrofolate synthase]	NA	NA	NA	NA	NA
VEC48876.1|1524717_1525380_+	putative peptidoglycan-binding protein	NA	NA	NA	NA	NA
VEC48878.1|1525638_1526127_+	colicin V production protein	NA	NA	NA	NA	NA
1525394:1525417	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
VEC48880.1|1526163_1527681_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.0e-86
VEC48882.1|1527775_1528345_+	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
VEC48884.1|1528610_1529393_+	lysine-arginine-ornithine-binding periplasmic protein	NA	NA	NA	NA	NA
VEC48886.1|1529613_1530396_+	histidine ABC transporter, substrate-binding periplasmic protein	NA	NA	NA	NA	NA
VEC48888.1|1530485_1530965_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
VEC48890.1|1530961_1531171_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
VEC48892.1|1531409_1531883_+	Histidine transport system permease protein hisM	NA	NA	NA	NA	NA
VEC48894.1|1531890_1532664_+	histidine/lysine/arginine/ornithine transporter subunit	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
VEC48896.1|1532860_1533184_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	56.5	4.3e-19
VEC48898.1|1533146_1533764_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	39.7	7.1e-39
>prophage 4
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	1721221	1730651	4941549		Enterobacteria_phage(88.89%)	12	NA	NA
VEC49252.1|1721221_1722133_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	5.2e-22
VEC49253.1|1722137_1722869_+	ABC transporter permease	NA	NA	NA	NA	NA
VEC49254.1|1722849_1722957_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEC49255.1|1723016_1723748_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VEC49256.1|1723969_1725655_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VEC49258.1|1725651_1726371_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEC49260.1|1726417_1726636_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	5.6e-31
VEC49262.1|1726613_1726889_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	98.9	2.8e-43
VEC49264.1|1726929_1727391_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VEC49266.1|1727567_1728389_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	95.6	1.3e-128
VEC49268.1|1728345_1729518_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.4	2.0e-220
VEC49270.1|1729514_1730651_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 5
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	1743217	1840008	4941549	plate,terminase,tail,holin,capsid,tRNA,integrase,lysis	Escherichia_phage(34.55%)	109	1734124:1734139	1804599:1804614
1734124:1734139	attL	CGCAGTAAATAAAAAA	NA	NA	NA	NA
VEC49283.1|1743217_1745251_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
VEC49285.1|1745382_1746492_+	ATPase	NA	NA	NA	NA	NA
VEC49287.1|1746754_1747036_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
VEC49289.1|1747328_1747871_+	fimbrial protein	NA	NA	NA	NA	NA
VEC49291.1|1747951_1748626_+	putative periplasmic pilin chaperone	NA	NA	NA	NA	NA
VEC49293.1|1748641_1751122_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEC49295.1|1751137_1752172_+	putative fimbrial adhesin	NA	NA	NA	NA	NA
VEC49297.1|1752253_1752592_-	periplasmic modulator of Ni and Co efflux	NA	NA	NA	NA	NA
VEC49299.1|1752810_1753635_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
VEC49301.1|1753756_1754029_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
VEC49303.1|1754342_1755005_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
VEC49305.1|1755087_1755840_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VEC49307.1|1755904_1756723_+	1,4-beta-N-acetylmuramidase	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
VEC49309.1|1756774_1757521_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEC49311.1|1757494_1758460_-	putative carbohydrate/pyrimidine kinase	NA	NA	NA	NA	NA
VEC49312.1|1758456_1758780_-	putative ADP-ribosylglycohydrolase	NA	NA	NA	NA	NA
VEC49314.1|1758999_1759458_-	putative ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	35.7	1.4e-07
VEC49316.1|1759454_1759811_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC49318.1|1759795_1760734_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC49320.1|1760990_1762043_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
VEC49322.1|1762272_1763127_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
VEC49324.1|1763155_1764109_+	putative tagatose 6-phosphate kinase	NA	NA	NA	NA	NA
VEC49326.1|1764108_1764249_+	putative tagatose 6-phosphate kinase	NA	NA	NA	NA	NA
VEC49328.1|1764245_1764428_+	putative tagatose 6-phosphate kinase	NA	NA	NA	NA	NA
VEC49330.1|1764522_1764879_+	galactitol-specific PTS system EIIA component	NA	NA	NA	NA	NA
VEC49332.1|1764946_1765195_+	PTS system galactitol-specific IIB component	NA	NA	NA	NA	NA
VEC49334.1|1765198_1766554_+	galactitol-specific PTS system EIIC component	NA	NA	NA	NA	NA
VEC49336.1|1766602_1767643_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
VEC49338.1|1767743_1768523_+	galactitol utilization operon repressor	NA	NA	NA	NA	NA
VEC49340.1|1768604_1769504_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
VEC49342.1|1769918_1770236_+	protein	NA	NA	NA	NA	NA
VEC49344.1|1770500_1771514_-|integrase	phage integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
VEC49346.1|1771629_1771929_-	immunity repressor	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
VEC49348.1|1772043_1772319_+	regulatory protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
VEC49350.1|1772329_1772500_+	Uncharacterised protein	NA	S4TNZ7	Salmonella_phage	98.2	1.0e-24
VEC49352.1|1772496_1772997_+	Phage protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
VEC49354.1|1773060_1773285_+	Protein of uncharacterised function (DUF2732)	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
VEC49356.1|1773284_1773584_+	Uncharacterised protein	NA	S4TUD1	Salmonella_phage	98.0	7.1e-45
VEC49358.1|1773586_1773811_+	C4-type zinc finger protein, DksA/TraR family	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
VEC49360.1|1773807_1774083_+	relication initiation protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
VEC49362.1|1774072_1776352_+	Replication gene A protein (GpA)	NA	Q858T4	Yersinia_virus	96.6	0.0e+00
VEC49364.1|1776592_1779076_-	Superfamily II helicase	NA	NA	NA	NA	NA
VEC49366.1|1779199_1779409_+	Uncharacterised protein	NA	M1TAP7	Escherichia_phage	79.2	8.6e-13
VEC49368.1|1779447_1780482_-|capsid	phage capsid protein	capsid	A0A0F7LDI7	Escherichia_phage	99.7	4.2e-201
VEC49370.1|1780481_1782254_-	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
VEC49372.1|1782427_1783282_+|capsid	phage capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	98.9	7.1e-138
VEC49374.1|1783340_1784414_+|capsid	major capsid protein	capsid	Q94MH9	Enterobacteria_phage	99.7	3.9e-202
VEC49376.1|1784417_1785161_+|terminase	small terminase subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.4	8.6e-124
VEC49378.1|1785260_1785770_+|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
VEC49380.1|1785769_1785973_+|tail	phage tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
VEC49382.1|1785976_1786258_+|holin,lysis	phage lysis holin	holin,lysis	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
VEC49384.1|1786257_1786755_+	phage lysin	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
VEC49386.1|1786769_1787195_+	LysA protein	NA	A0A0F7LBP4	Escherichia_phage	95.7	1.2e-58
VEC49388.1|1787182_1787608_+	LysB protein	NA	U5N3W5	Enterobacteria_phage	97.2	2.1e-66
VEC49390.1|1787594_1787753_+|lysis	phage lysis protein LysC	lysis	M1RZ27	Escherichia_phage	100.0	2.6e-22
VEC49392.1|1787715_1788183_+|tail	tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	2.5e-81
VEC49394.1|1788175_1788628_+|tail	tail protein	tail	A0A0F7LDR6	Escherichia_phage	99.3	1.4e-76
VEC49396.1|1788694_1789330_+|plate	Baseplate assembly protein V (GpV)	plate	U5N3F0	Enterobacteria_phage	96.7	1.0e-109
VEC49398.1|1789326_1789674_+|plate	phage baseplate protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
VEC49400.1|1789678_1790587_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	9.8e-162
VEC49402.1|1790579_1791110_+|tail	tail protein I (GpI)	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
VEC49404.1|1791120_1792392_+|tail	putative tail fiber protein (GpH)	tail	U5N099	Enterobacteria_phage	88.1	6.0e-125
VEC49406.1|1792400_1793330_+|tail	putative bacteriophage tail protein	tail	U5N099	Enterobacteria_phage	99.7	7.1e-184
VEC49408.1|1793333_1793861_+|tail	tail assembly chaperone gp38	tail	U5N0T1	Enterobacteria_phage	96.6	2.8e-92
VEC49410.1|1793960_1795067_-	Uncharacterised protein	NA	U5N3F3	Enterobacteria_phage	99.2	1.2e-209
VEC49412.1|1795367_1796558_+|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	99.2	4.0e-224
VEC49414.1|1796570_1797089_+|tail	phage major tail tube protein FII	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
VEC49416.1|1797145_1797421_+|tail	tail protein E (GpE)	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
VEC49418.1|1797565_1800013_+|tail	phage related tail protein	tail	Q858U7	Yersinia_virus	95.8	0.0e+00
VEC49420.1|1800027_1800507_+	gpU phage protein	NA	O64315	Escherichia_phage	100.0	5.1e-85
VEC49422.1|1800506_1801670_+	phage protein D	NA	A0A0F7LDR0	Escherichia_phage	99.2	1.2e-204
VEC49424.1|1801751_1801970_+	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VEC49426.1|1802289_1802589_-	formate acetyltransferase 1	NA	A0A192YAL0	Morganella_phage	67.5	1.2e-23
VEC49428.1|1802542_1803994_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	43.3	2.1e-102
VEC49430.1|1804088_1804574_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	38.0	6.4e-19
VEC49432.1|1804628_1804967_-	formate transporter 1	NA	NA	NA	NA	NA
1804599:1804614	attR	TTTTTTATTTACTGCG	NA	NA	NA	NA
VEC49434.1|1804997_1805486_-	formate transporter 1	NA	NA	NA	NA	NA
VEC49436.1|1805892_1807653_-	putative fatty acid binding protein	NA	NA	NA	NA	NA
VEC49438.1|1807782_1807899_+	membrane protein YcaP	NA	NA	NA	NA	NA
VEC49440.1|1807895_1808501_+	membrane protein YcaP	NA	NA	NA	NA	NA
VEC49442.1|1808673_1808928_+	phosphoserine aminotransferase	NA	M1Q1P2	Streptococcus_phage	50.8	4.4e-11
VEC49444.1|1808957_1809308_+	phosphoserine aminotransferase	NA	A0A2P0VN35	Tetraselmis_virus	46.6	1.6e-08
VEC49446.1|1809312_1809762_+	phosphoserine aminotransferase	NA	M1Q1P2	Streptococcus_phage	52.6	1.2e-32
VEC49448.1|1809833_1810115_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
VEC49450.1|1810128_1811118_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
VEC49452.1|1811286_1812051_+	peptidase, M48B family	NA	NA	NA	NA	NA
VEC49454.1|1812223_1812907_+	cytidylate kinase	NA	NA	NA	NA	NA
VEC49456.1|1813017_1814691_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
VEC49458.1|1814850_1815135_+	integration host factor	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
VEC49460.1|1815341_1817606_+	putative competence-related protein	NA	NA	NA	NA	NA
VEC49462.1|1817642_1819391_+	lipid A export permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
VEC49464.1|1819387_1820374_+	tetraacyldisaccharide 4'-kinase (lipid A 4'-kinase)	NA	NA	NA	NA	NA
VEC49466.1|1820410_1821643_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEC49468.1|1821694_1821877_+	peroxide and acid resistance protein, UPF0434 family	NA	NA	NA	NA	NA
VEC49471.1|1821873_1822620_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
VEC49473.1|1822773_1823667_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC49475.1|1823643_1824423_-	inner membrane protein	NA	NA	NA	NA	NA
VEC49478.1|1824558_1825344_+	metallothionein SmtA	NA	NA	NA	NA	NA
VEC49481.1|1825340_1826663_+	chromosome partition protein	NA	NA	NA	NA	NA
VEC49484.1|1826643_1827348_+	condesin subunit E	NA	NA	NA	NA	NA
VEC49487.1|1827347_1831808_+	chromosome partition protein	NA	NA	NA	NA	NA
VEC49490.1|1832068_1833916_+	putative peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
VEC49493.1|1834096_1834645_+	exported protein YcbK	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
VEC49496.1|1834671_1835319_+	metal-binding hydrolase	NA	NA	NA	NA	NA
VEC49499.1|1835540_1836665_-	aspartate aminotransferase	NA	NA	NA	NA	NA
VEC49502.1|1836621_1836732_-	aspartate aminotransferase	NA	NA	NA	NA	NA
VEC49505.1|1837285_1837768_-	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	50.5	5.4e-18
VEC49507.1|1837876_1838071_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC49510.1|1838607_1840008_-|tRNA	asparaginyl-tRNA synthetase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
>prophage 6
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	2035322	2098389	4941549	transposase,portal,terminase,holin,tail,protease,tRNA,integrase,head	Enterobacteria_phage(45.45%)	87	2048041:2048056	2096631:2096646
VEC50139.1|2035322_2036441_-|integrase	prophage lambda integrase	integrase	Q77Z04	Phage_21	44.4	4.5e-84
VEC50142.1|2036409_2036679_-	excisionase for prophage	NA	NA	NA	NA	NA
VEC50145.1|2036740_2039179_-	exonuclease family protein	NA	A0A192Y6E0	Salmonella_phage	64.1	1.3e-62
VEC50149.1|2039259_2039463_-	phage protein	NA	NA	NA	NA	NA
VEC50151.1|2039465_2039648_-	regulator of cell division encoded by prophage	NA	NA	NA	NA	NA
VEC50153.1|2040215_2040401_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC50156.1|2040542_2040671_-	putative prophage protein	NA	NA	NA	NA	NA
VEC50158.1|2040672_2040828_-	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
VEC50161.1|2040994_2041402_-	repressor protein of division inhibition gene	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
VEC50164.1|2041485_2041716_+	repressor protein of division inhibition gene	NA	NA	NA	NA	NA
VEC50167.1|2041699_2042221_+	YdfX	NA	NA	NA	NA	NA
VEC50170.1|2042201_2043167_+	ybl78	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
VEC50173.1|2043207_2043630_+	phage protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	3.4e-61
VEC50176.1|2043867_2044449_-	FRG domain	NA	Q9AZ51	Lactococcus_phage	58.5	5.7e-06
VEC50179.1|2044732_2045203_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC50182.1|2046375_2046627_+	putative prophage protein	NA	NA	NA	NA	NA
VEC50185.1|2046971_2047244_+	putative prophage protein	NA	A0A1C9IHZ5	Salmonella_phage	60.2	9.1e-23
VEC50188.1|2047191_2047785_+	putative prophage protein	NA	Q8SBE5	Shigella_phage	43.5	7.5e-38
VEC50191.1|2047859_2048021_+	putative prophage protein	NA	U5P0K4	Shigella_phage	76.9	1.2e-17
2048041:2048056	attL	AGAATTTGTTTTGCCT	NA	NA	NA	NA
VEC50194.1|2048050_2048404_+	holliday junction resolvase	NA	V5URS4	Shigella_phage	63.6	2.5e-36
VEC50197.1|2048393_2048726_+	Phage antitermination protein Q	NA	Q777W5	Enterobacteria_phage	84.0	8.2e-50
VEC50200.1|2049052_2049169_+	antirepressor protein	NA	Q8VNP5	Enterobacteria_phage	84.2	3.2e-09
VEC50204.1|2049181_2049580_+	putative antirepressor protein	NA	A0A0P0ZC44	Stx2-converting_phage	75.8	5.1e-22
VEC50207.1|2050686_2050929_+|holin	putative phage holin	holin	Q8W636	Enterobacteria_phage	64.9	1.6e-07
VEC50210.1|2051066_2051345_+|holin	putative phage holin	holin	Q9MBZ4	Enterobacteria_phage	94.5	1.8e-42
VEC50213.1|2051346_2051823_+	Predicted lysozyme (DUF847)	NA	A0A0U2I1S0	Escherichia_phage	89.0	1.4e-79
VEC50216.1|2052210_2052504_-	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	87.6	7.2e-42
VEC50219.1|2052728_2053139_-	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	84.6	5.7e-61
VEC50222.1|2053301_2053601_+|transposase	transposase	transposase	NA	NA	NA	NA
VEC50225.1|2053597_2054464_+|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VEC50228.1|2054729_2055002_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC50231.1|2055145_2055640_+	prophage protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
VEC50234.1|2055639_2056635_+|terminase	DNA packaging protein of prophage (terminase large subunit)	terminase	K7PH40	Enterobacteria_phage	99.7	7.1e-198
VEC50237.1|2056796_2057084_+|integrase	integrase	integrase	A0A0R6PH06	Moraxella_phage	43.4	7.4e-15
VEC50240.1|2057085_2058036_+|integrase	integrase from prophage	integrase	A0A1B5FPC6	Escherichia_phage	34.0	5.8e-40
VEC50243.1|2058048_2058252_+	Predicted transcriptional regulator	NA	NA	NA	NA	NA
VEC50246.1|2058311_2058683_+	putative prophage antirepressor	NA	Q6UAV5	Klebsiella_phage	68.3	7.8e-17
VEC50249.1|2059111_2059555_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC50252.1|2059586_2059781_-	putative repressor	NA	NA	NA	NA	NA
VEC50255.1|2059920_2060148_+	putative prophage protein	NA	NA	NA	NA	NA
VEC50258.1|2060117_2060270_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC50261.1|2060622_2061336_+	putative DNA primase from prophage	NA	NA	NA	NA	NA
VEC50264.1|2061332_2061632_+	putative DNA primase from prophage	NA	Q7M2A8	Enterobacteria_phage	52.6	9.1e-24
VEC50267.1|2061684_2061810_+	nucleoside triphosphatase	NA	NA	NA	NA	NA
VEC50270.1|2061847_2062483_+	putative DNA primase from prophage	NA	Q7M2A8	Enterobacteria_phage	52.5	3.6e-54
VEC50273.1|2062770_2063016_+	putative prophage protein	NA	NA	NA	NA	NA
VEC50276.1|2063012_2063435_+	putative prophage single-stranded DNA binding protein	NA	NA	NA	NA	NA
VEC50279.1|2063403_2063655_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC50282.1|2063858_2064068_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC50285.1|2064064_2065978_+|portal	phage portal protein, lambda family	portal	S5M7Q8	Escherichia_phage	56.6	3.0e-213
VEC50288.1|2066235_2066355_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC50291.1|2066519_2066738_+	prophage protein	NA	A0A291AWV8	Escherichia_phage	58.5	2.3e-08
VEC50294.1|2066718_2067006_+	putative prophage protein	NA	NA	NA	NA	NA
VEC50297.1|2067032_2067257_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC50300.1|2067380_2068496_+|terminase	DNA packaging protein of prophage (terminase large subunit)	terminase	A0A291AWY5	Escherichia_phage	94.4	2.1e-206
VEC50303.1|2068492_2068705_+	prophage protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
VEC50306.1|2068704_2069016_+|head,tail,portal	portal protein (head-tail preconnector protein) from prophage	head,tail,portal	A5LH29	Enterobacteria_phage	98.1	6.8e-22
VEC50309.1|2069107_2069314_+|portal	portal protein	portal	A5LH29	Enterobacteria_phage	95.3	3.8e-29
VEC50312.1|2069279_2069468_+|portal	portal protein	portal	A5LH29	Enterobacteria_phage	91.7	1.6e-10
VEC50315.1|2069685_2070516_+|portal	phage portal protein, lambda family	portal	A5LH29	Enterobacteria_phage	100.0	4.9e-67
VEC50318.1|2070512_2072180_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A5LH30	Enterobacteria_phage	99.6	0.0e+00
VEC50321.1|2072266_2072590_+	prophage protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
VEC50324.1|2072582_2072858_+	prophage protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
VEC50326.1|2072869_2073460_+|tail	prophage minor tail protein Z (GPZ)	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
VEC50329.1|2073456_2073858_+|tail	Minor tail protein U	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
VEC50332.1|2073868_2074612_+|tail	Major tail protein V	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
VEC50335.1|2074672_2075059_+|tail	minor tail component of prophage	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
VEC50338.1|2075067_2075397_+|tail	minor tail protein T of prophage	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
VEC50341.1|2075368_2078443_+|tail	putative tail length tape measure protein from putative prophage	tail	A0A291AWX1	Escherichia_phage	94.5	0.0e+00
VEC50344.1|2078439_2078769_+|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	4.0e-57
VEC50347.1|2078768_2079467_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
VEC50350.1|2079472_2080216_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
VEC50353.1|2080212_2080785_+|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	88.4	2.2e-82
VEC50356.1|2080845_2084244_+|tail	tail:host specificity protein	tail	A0A0K2FI38	Escherichia_phage	99.5	0.0e+00
VEC50359.1|2084305_2084521_+	outer host membrane	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	2.0e-33
VEC50362.1|2084565_2084925_+	outer host membrane	NA	A0A1U8QHD6	Enterobacteria_phage	99.2	1.7e-61
VEC50365.1|2084989_2087314_+	Tail fiber protein	NA	A0A0K2FIZ6	Escherichia_phage	99.7	2.3e-223
VEC50368.1|2088126_2088990_-	spermidine/putrescine ABC transporter membrane protein	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
VEC50371.1|2088973_2089261_-	spermidine/putrescine ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VEC50373.1|2089205_2090111_-	spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	8.3e-28
VEC50376.1|2090360_2091590_+	peptidase T	NA	NA	NA	NA	NA
VEC50378.1|2091735_2092857_-	cupin superfamily protein family	NA	NA	NA	NA	NA
VEC50381.1|2092932_2094393_-	two-component sensor kinase	NA	NA	NA	NA	NA
VEC50384.1|2094392_2095064_-	two-component response regulator	NA	NA	NA	NA	NA
VEC50387.1|2095231_2096602_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
VEC50390.1|2096605_2097247_-	putative lysogenization regulator	NA	NA	NA	NA	NA
2096631:2096646	attR	AGAATTTGTTTTGCCT	NA	NA	NA	NA
VEC50393.1|2097282_2098389_-|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	2290999	2298268	4941549	tRNA	Enterobacteria_phage(33.33%)	8	NA	NA
VEC51048.1|2290999_2292232_-	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
VEC51051.1|2292486_2293470_+	zinc transport protein	NA	NA	NA	NA	NA
VEC51054.1|2293744_2293918_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC51057.1|2293947_2295321_+	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	5.1e-53
VEC51060.1|2295449_2296022_-|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.1e-69
VEC51063.1|2296558_2296993_-	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
VEC51066.1|2297133_2297913_-	outer membrane protein N (porin)	NA	Q1MVN1	Enterobacteria_phage	56.4	9.5e-73
VEC51068.1|2297923_2298268_-	putative outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	63.9	7.2e-25
>prophage 8
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	2502597	2564461	4941549	transposase,portal,coat,terminase,tail,capsid,integrase,head,lysis	Enterobacteria_phage(37.7%)	86	2533602:2533617	2566046:2566061
VEC51603.1|2502597_2504058_-	putative sugar dehydrogenase	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
VEC51605.1|2504146_2504320_-	MFS transporter, metabolite:H+ symporter (MHS) family protein	NA	NA	NA	NA	NA
VEC51607.1|2504316_2505429_-	metabolite transport protein YdfJ	NA	NA	NA	NA	NA
VEC51608.1|2506215_2506449_+	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VEC51610.1|2506765_2507356_+	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
VEC51612.1|2508028_2508256_-|tail	putative tail fiber protein	tail	X2KTY7	Enterobacteria_phage	69.1	8.4e-06
VEC51614.1|2508368_2511428_-|tail	phage tail domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	2.2e-11
VEC51616.1|2511492_2512092_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	95.0	2.9e-106
VEC51618.1|2512159_2513266_-	putative host specificity protein	NA	Q9EYE7	Enterobacteria_phage	94.8	5.8e-201
VEC51620.1|2513319_2515089_-|tail	tail:host specificity protein	tail	A0A291AWT4	Escherichia_phage	98.2	0.0e+00
VEC51622.1|2515085_2515505_-	Host specificity protein J of prophage	NA	K7PKJ2	Enterobacteria_phage	98.5	4.9e-68
VEC51624.1|2515495_2515636_-|tail	putative phage tail component	tail	C6ZCZ5	Enterobacteria_phage	86.4	8.8e-14
VEC51626.1|2515707_2516154_-|tail	putative phage tail component	tail	A0A291AWV5	Escherichia_phage	80.5	2.8e-45
VEC51628.1|2516171_2516336_-|tail	phage tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	96.1	1.6e-19
VEC51630.1|2516621_2516975_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.6	2.5e-65
VEC51631.1|2516980_2517679_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
VEC51633.1|2517678_2518008_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
VEC51635.1|2518004_2519060_-|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.3	1.6e-171
VEC51637.1|2519136_2519247_-|tail	tail component of prophage	tail	NA	NA	NA	NA
VEC51639.1|2519246_2519420_-|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.0	5.6e-18
VEC51641.1|2519583_2520081_-|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	100.0	9.7e-71
VEC51643.1|2520444_2520576_-|tail	putative tail length tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.4	2.4e-13
VEC51645.1|2520560_2520923_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	4.9e-48
VEC51647.1|2521061_2521406_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	90.3	4.7e-40
VEC51649.1|2521421_2521673_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	2.8e-34
VEC51651.1|2521776_2522160_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	99.1	4.5e-60
VEC51653.1|2522167_2522323_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	4.4e-22
VEC51655.1|2522560_2522752_-|tail	tail component of prophage CP-933X	tail	A0A2R9YJK4	Escherichia_phage	94.2	2.1e-18
VEC51657.1|2522696_2523140_-|tail	minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.3	7.3e-54
VEC51659.1|2523296_2523506_-|head,tail	putative head-tail joining	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	7.2e-28
VEC51661.1|2523517_2523913_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
VEC51663.1|2523954_2524980_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
VEC51665.1|2525035_2525368_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
VEC51667.1|2525377_2528278_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.7e-287
VEC51669.1|2528274_2528481_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VEC51671.1|2528477_2530403_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
VEC51673.1|2530377_2530923_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
VEC51675.1|2531602_2532013_+	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VEC51677.1|2532164_2532338_-	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VEC51679.1|2533588_2534086_-	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2533602:2533617	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
VEC51681.1|2534082_2534616_-	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VEC51683.1|2534612_2534924_-	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VEC51685.1|2534928_2535135_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VEC51687.1|2535176_2535296_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC51689.1|2536425_2536626_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
VEC51691.1|2537047_2537800_-	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VEC51693.1|2537813_2538863_-	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VEC51695.1|2539209_2539461_-	putative prophage protein	NA	NA	NA	NA	NA
VEC51697.1|2539677_2539833_-	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VEC51699.1|2539904_2540192_-	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VEC51701.1|2540208_2540430_-	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	52.4	4.1e-13
VEC51703.1|2540962_2541157_+	Qin prophage protein	NA	NA	NA	NA	NA
VEC51705.1|2541128_2541296_+	Qin prophage protein	NA	NA	NA	NA	NA
VEC51707.1|2541732_2543073_-|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VEC51709.1|2543406_2543586_-	membrane protein	NA	NA	NA	NA	NA
VEC51711.1|2544737_2545094_-	putative methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
VEC51713.1|2545090_2545549_-	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	86.0	1.3e-58
VEC51716.1|2545552_2546518_-	ybl78	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
VEC51718.1|2546498_2547020_-	YdfX	NA	NA	NA	NA	NA
VEC51720.1|2547003_2547231_-	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VEC51721.1|2547311_2547719_+	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
VEC51723.1|2547790_2548042_+	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	3.8e-07
VEC51725.1|2548043_2548172_+	putative prophage protein	NA	NA	NA	NA	NA
VEC51727.1|2548201_2548420_+	putative prophage protein	NA	NA	NA	NA	NA
VEC51729.1|2548423_2548588_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC51731.1|2548987_2549176_+	division inhibition protein	NA	NA	NA	NA	NA
VEC51733.1|2549172_2549364_+	putative prophage protein	NA	NA	NA	NA	NA
VEC51735.1|2549457_2550783_+	putative exonuclease from phage origin	NA	NA	NA	NA	NA
VEC51737.1|2550976_2551927_+	Exonuclease RNase T and DNA polymerase III	NA	A0A192Y6E0	Salmonella_phage	56.7	3.3e-59
VEC51739.1|2552112_2552250_+	putative phage excisionase	NA	NA	NA	NA	NA
VEC51741.1|2552284_2552755_+|integrase	defective integrase; Qin prophage	integrase	Q9EY96	Enterobacteria_phage	65.5	5.4e-47
VEC51743.1|2552769_2553564_+|integrase	defective integrase; Qin prophage	integrase	Q859D2	Escherichia_coli_phage	63.3	3.0e-98
VEC51745.1|2553565_2553694_-	protein, truncated	NA	NA	NA	NA	NA
VEC51747.1|2553732_2554770_-	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	9.8e-17
VEC51750.1|2554781_2555996_-	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VEC51752.1|2556193_2556529_-	inner membrane protein	NA	A0A218MNG8	uncultured_virus	58.6	4.3e-22
VEC51754.1|2556663_2557005_+	protein	NA	NA	NA	NA	NA
VEC51756.1|2557039_2557600_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VEC51757.1|2557602_2558349_-	lipoprotein	NA	NA	NA	NA	NA
VEC51760.1|2558420_2558726_+	protein	NA	NA	NA	NA	NA
VEC51763.1|2558924_2561138_+	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	47.3	3.1e-185
VEC51765.1|2561088_2561352_+	putative dimethyl sulfoxide reductase YnfE	NA	A0A077SK27	Escherichia_phage	66.7	4.1e-20
VEC51768.1|2561439_2562618_+	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	49.2	6.6e-94
VEC51771.1|2562584_2563835_+	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	45.7	3.1e-97
VEC51774.1|2563845_2564100_+	Dimethyl sulfoxide reductase chain B	NA	A0A077SL61	Escherichia_phage	57.1	1.7e-15
VEC51777.1|2564092_2564461_+	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.3	2.5e-39
2566046:2566061	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 9
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	3007461	3015869	4941549		Enterobacteria_phage(33.33%)	8	NA	NA
VEC53364.1|3007461_3008280_-	Protein of uncharacterised function (DUF616)	NA	A0A2P0VMU2	Tetraselmis_virus	33.9	6.8e-29
VEC53367.1|3008234_3009053_-	glycosyltransferase	NA	NA	NA	NA	NA
VEC53370.1|3009055_3010114_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53373.1|3010117_3010993_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.1	3.9e-107
VEC53377.1|3011050_3011950_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	1.1e-27
VEC53380.1|3011949_3013035_-	dTDP-D-glucose 4,6-dehydratase rmlB	NA	I7HTA3	Enterobacteria_phage	54.2	2.1e-102
VEC53383.1|3013406_3014300_-	UTP--glucose-1-phosphate uridylyltransferase subunit GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
VEC53385.1|3014474_3015869_-	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	31.9	1.1e-18
>prophage 10
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	3063107	3113231	4941549	plate,terminase,holin,tail,protease,capsid,tRNA,integrase,lysis	Escherichia_phage(56.0%)	64	3089606:3089621	3106555:3106570
VEC53515.1|3063107_3064511_+	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
VEC53518.1|3064507_3065230_+	two-component response regulator	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
VEC53521.1|3065420_3065753_+	protein	NA	NA	NA	NA	NA
VEC53524.1|3066006_3066258_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
VEC53527.1|3066259_3066556_+	plasmid stabilisation system protein	NA	NA	NA	NA	NA
VEC53530.1|3066658_3068020_+|protease	putative protease	protease	Q6DW11	Phage_TP	100.0	1.1e-217
VEC53533.1|3068292_3068511_-	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VEC53536.1|3068592_3069756_-	phage protein D	NA	A0A0F7LDR0	Escherichia_phage	99.2	1.2e-204
VEC53539.1|3069755_3070235_-	gpU phage protein	NA	O64315	Escherichia_phage	100.0	5.1e-85
VEC53542.1|3070249_3070645_-|tail	phage related tail protein	tail	A0A0F7LCI6	Escherichia_phage	100.0	2.7e-68
VEC53545.1|3070701_3072696_-|tail	phage related tail protein	tail	M1T2S3	Escherichia_phage	98.4	0.0e+00
VEC53549.1|3072840_3073116_-|tail	tail protein E (GpE)	tail	A0A0F7LDQ8	Escherichia_phage	97.8	8.3e-40
VEC53552.1|3073172_3073691_-|tail	phage major tail tube protein FII	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
VEC53555.1|3073703_3074198_-|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	99.4	2.9e-91
VEC53559.1|3074194_3074893_-|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	100.0	5.6e-125
VEC53563.1|3075152_3075962_+	Uncharacterised protein	NA	A0A0F7L9X0	Escherichia_phage	98.9	2.8e-160
VEC53567.1|3076089_3076617_-|tail	tail assembly chaperone gp38	tail	U5N0T1	Enterobacteria_phage	94.9	6.8e-91
VEC53570.1|3076620_3078939_-|tail	Phage tail fiber repeat	tail	U5N099	Enterobacteria_phage	67.1	2.2e-213
VEC53574.1|3078949_3079480_-|tail	tail protein I (GpI)	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
VEC53577.1|3079472_3080381_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	9.8e-162
VEC53580.1|3080385_3080733_-|plate	phage baseplate protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
VEC53583.1|3080729_3081365_-|plate	Baseplate assembly protein V (GpV)	plate	U5N3F0	Enterobacteria_phage	96.7	1.0e-109
VEC53586.1|3081431_3081884_-|tail	tail protein	tail	A0A0F7LDR6	Escherichia_phage	99.3	1.4e-76
VEC53589.1|3081876_3082344_-|tail	tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
VEC53592.1|3082306_3082465_-|lysis	phage lysis protein LysC	lysis	M1RZ27	Escherichia_phage	100.0	2.6e-22
VEC53594.1|3082451_3082877_-	LysB protein	NA	U5N3W5	Enterobacteria_phage	97.2	2.1e-66
VEC53597.1|3082864_3083290_-	LysA protein	NA	A0A0F7LBP4	Escherichia_phage	95.7	1.2e-58
VEC53600.1|3083304_3083802_-	phage lysin	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
VEC53603.1|3083801_3084083_-|holin,lysis	phage lysis holin	holin,lysis	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
VEC53606.1|3084086_3084290_-|tail	phage tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
VEC53609.1|3084289_3084655_-|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	100.0	3.5e-62
VEC53612.1|3084644_3084800_-|capsid	capsid completion protein	capsid	A0A0F7LDJ1	Escherichia_phage	88.4	9.8e-14
VEC53614.1|3084753_3085644_-|terminase	small terminase subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.2	1.5e-122
VEC53617.1|3085647_3086292_-|capsid	major capsid protein	capsid	Q94MK7	Enterobacteria_phage	99.5	2.1e-118
VEC53620.1|3086270_3086720_-|capsid	major capsid protein	capsid	Q94MF4	Enterobacteria_phage	98.5	1.3e-29
VEC53622.1|3086778_3087633_-|capsid	phage capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
VEC53625.1|3087806_3089579_+	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
VEC53628.1|3089578_3090613_+|capsid	phage capsid protein	capsid	M1SV64	Escherichia_phage	99.1	1.2e-200
3089606:3089621	attL	CAGCCAGCGGCAAAAA	NA	NA	NA	NA
VEC53631.1|3090932_3092870_-	virulence factor	NA	NA	NA	NA	NA
VEC53634.1|3092856_3093357_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53637.1|3093350_3093728_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53640.1|3093924_3094116_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53643.1|3094617_3096819_-	Replication gene A protein (GpA)	NA	A0A0F7LBQ2	Escherichia_phage	96.3	0.0e+00
VEC53646.1|3096815_3097634_-	Uncharacterised protein	NA	A0A0M4RCP6	Salmonella_phage	78.3	3.4e-129
VEC53648.1|3097648_3097927_-	relication initiation protein	NA	U5N3W1	Enterobacteria_phage	94.2	2.4e-39
VEC53651.1|3097923_3098148_-	C4-type zinc finger protein, DksA/TraR family	NA	Q858T6	Yersinia_virus	97.3	1.1e-34
VEC53654.1|3098147_3098438_-	Uncharacterised protein	NA	M1RZ07	Escherichia_phage	80.6	1.2e-33
VEC53657.1|3098434_3098680_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53660.1|3098694_3098907_-	Protein of uncharacterised function (DUF2732)	NA	S4TP68	Salmonella_phage	91.4	3.3e-28
VEC53663.1|3098970_3099471_-	Phage protein B	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
VEC53666.1|3099467_3099638_-	Uncharacterised protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
VEC53669.1|3099648_3100005_-	Cox protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
VEC53672.1|3100172_3100421_+	Phage protein C	NA	Q1JS25	Enterobacteria_phage	100.0	1.2e-42
VEC53675.1|3100514_3101510_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
VEC53678.1|3101541_3102339_+	pyruvate formate lyase-activating enzyme 1	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
VEC53681.1|3102420_3103011_-	NAD(P)H dehydrogenase (quinone)	NA	NA	NA	NA	NA
VEC53685.1|3103110_3104019_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VEC53688.1|3104019_3105450_-	putative amino acid permease	NA	NA	NA	NA	NA
VEC53691.1|3105659_3106784_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
3106555:3106570	attR	CAGCCAGCGGCAAAAA	NA	NA	NA	NA
VEC53693.1|3107122_3107689_+	protein YcaC	NA	NA	NA	NA	NA
VEC53696.1|3107785_3108649_-	anaerobic dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
VEC53699.1|3108618_3109269_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	63.5	2.6e-63
VEC53702.1|3109279_3111724_-	anaerobic dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
VEC53705.1|3111962_3113231_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.4	4.2e-94
>prophage 11
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	3123583	3199152	4941549	portal,plate,terminase,tail,protease,capsid,tRNA,integrase	Salmonella_phage(66.67%)	92	3147798:3147812	3200862:3200876
VEC53758.1|3123583_3125305_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
VEC53761.1|3125346_3125448_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VEC53764.1|3125407_3126052_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VEC53767.1|3126336_3126555_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VEC53770.1|3127239_3128799_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	47.7	1.2e-135
VEC53773.1|3128798_3129515_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1L2CUT6	Pectobacterium_phage	30.2	1.3e-12
VEC53776.1|3129545_3129866_-|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
VEC53779.1|3130188_3130413_+	stationary phase/starvation inducible regulatory protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
VEC53782.1|3130485_3132432_-	macrolide export ATP-binding/permease protein	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
VEC53784.1|3132428_3133220_-	macrolide-specific efflux protein	NA	NA	NA	NA	NA
VEC53788.1|3133276_3133525_-	macrolide-specific efflux protein	NA	NA	NA	NA	NA
VEC53791.1|3133657_3134650_+	virulence protein	NA	NA	NA	NA	NA
VEC53794.1|3134646_3136305_-	nucleoside triphosphate hydrolase domain	NA	NA	NA	NA	NA
VEC53797.1|3136731_3137145_+	aquaporin Z	NA	NA	NA	NA	NA
VEC53800.1|3137092_3137428_+	aquaporin Z	NA	NA	NA	NA	NA
VEC53803.1|3137922_3138822_+	transporter	NA	NA	NA	NA	NA
VEC53806.1|3138965_3140618_+	hydroxylamine reductase	NA	NA	NA	NA	NA
VEC53809.1|3140629_3141598_+	HCP oxidoreductase, NADH-dependent	NA	NA	NA	NA	NA
VEC53812.1|3141730_3143449_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
VEC53815.1|3143485_3144487_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
VEC53818.1|3144497_3145292_+	NAD(P)-binding Rossmann-fold domain	NA	NA	NA	NA	NA
VEC53821.1|3145378_3145927_+	NAD(P)-binding Rossmann-fold domain	NA	NA	NA	NA	NA
VEC53824.1|3145989_3147039_+	nucleotide di-P-sugar epimerase or dehydratase	NA	NA	NA	NA	NA
VEC53827.1|3147035_3147866_-	putative N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
3147798:3147812	attL	AATGCCTTTTTCGCC	NA	NA	NA	NA
VEC53830.1|3147862_3148186_-	conserved protein, UPF0145 family	NA	NA	NA	NA	NA
VEC53833.1|3148311_3148827_+	lipoprotein	NA	NA	NA	NA	NA
VEC53837.1|3149044_3149512_+	arginine transport system ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	2.3e-10
VEC53840.1|3149511_3149772_+	arginine transport system ATP-binding protein	NA	NA	NA	NA	NA
VEC53843.1|3149789_3150521_+	arginine ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
VEC53846.1|3150527_3151244_+	arginine transport system permease	NA	NA	NA	NA	NA
VEC53848.1|3151243_3151912_+	arginine ABC transporter permease	NA	NA	NA	NA	NA
VEC53851.1|3152203_3152935_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEC53854.1|3153109_3154237_-	23S rRNA (uracil-5-)-methyltransferase	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
VEC53857.1|3154277_3154766_-	inner membrane protein	NA	NA	NA	NA	NA
VEC53860.1|3154825_3155671_-	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VEC53863.1|3155667_3156621_-	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VEC53866.1|3156630_3157764_-	putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
VEC53869.1|3157858_3158728_-	putrescine ABC transporter periplasmic-binding protein	NA	NA	NA	NA	NA
VEC53872.1|3158805_3158973_-	putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEC53876.1|3159324_3159801_-	TPR repeat-containing protein	NA	NA	NA	NA	NA
VEC53879.1|3159888_3160527_-	ribosomal protein S6 modification protein	NA	I3ULC9	Synechococcus_phage	34.5	6.9e-29
VEC53882.1|3160495_3160792_-	ribosomal protein S6 modification protein	NA	NA	NA	NA	NA
VEC53885.1|3160852_3161575_-	nitroreductase NfsA	NA	NA	NA	NA	NA
VEC53888.1|3161558_3161846_-	inner membrane protein	NA	NA	NA	NA	NA
VEC53890.1|3162046_3162265_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	60.7	5.2e-13
VEC53893.1|3163226_3164333_+	putative permease	NA	NA	NA	NA	NA
VEC53897.1|3164371_3164635_+	putative permease	NA	NA	NA	NA	NA
VEC53900.1|3164870_3165089_-	prophage P2 OGR-like protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
VEC53903.1|3165179_3166280_-	Late control protein D protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	4.9e-176
VEC53906.1|3166276_3166762_-|tail	bacteriophage tail protein GpU	tail	E5G6Q2	Salmonella_phage	80.6	8.3e-67
VEC53909.1|3166758_3168255_-|tail	TP901 family phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	58.8	9.8e-143
VEC53912.1|3168193_3168808_-|tail	putative phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	88.8	3.7e-80
VEC53915.1|3169032_3169839_-|tail	TP901 family phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	47.1	1.1e-42
VEC53918.1|3169965_3170268_-|tail	tail E family protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	1.4e-40
VEC53921.1|3170322_3170838_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
VEC53924.1|3170847_3172020_-|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.0	4.7e-201
VEC53928.1|3172152_3172587_-	CPS-53 (KpLE1) prophage protein	NA	A0A0F7LDZ0	Escherichia_phage	40.6	9.4e-22
VEC53931.1|3172586_3174317_-|tail	tail fiber domain-containing protein	tail	A0A0M3ULH6	Salmonella_phage	62.8	3.0e-79
VEC53934.1|3174313_3174919_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
VEC53937.1|3174911_3175820_-|plate	Baseplate assembly protein GpJ	plate	A0A1S6KZY6	Salmonella_phage	90.1	2.3e-142
VEC53940.1|3175806_3176166_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	7.2e-52
VEC53943.1|3176162_3176741_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	2.7e-93
VEC53946.1|3176944_3178903_-	Predicted ATP-binding protein involved in virulence	NA	NA	NA	NA	NA
VEC53948.1|3179048_3179486_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	79.1	8.8e-52
VEC53950.1|3179478_3179910_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	8.4e-71
VEC53954.1|3180005_3180434_-	regulatory protein	NA	E5G6N2	Salmonella_phage	73.8	1.6e-45
VEC53957.1|3180430_3180808_-	membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
VEC53960.1|3180809_3181322_-	glycoside hydrolase family protein	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
VEC53963.1|3181302_3181518_-	putative secretory protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
VEC53966.1|3181521_3181725_-|tail	tail X family protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
VEC53969.1|3181724_3182189_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
VEC53972.1|3182284_3182935_-|terminase	small terminase subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
VEC53975.1|3182938_3183997_-|capsid	P2 family phage major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	4.9e-181
VEC53978.1|3184013_3184847_-|capsid	capsid scaffolding	capsid	A0A1S6KZW9	Salmonella_phage	92.1	5.3e-122
VEC53981.1|3184988_3186755_+	Terminase, ATPase subunit	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
VEC53984.1|3186754_3187780_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	88.9	1.5e-171
VEC53987.1|3187817_3188879_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53990.1|3189553_3190360_+	Uncharacterised protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	7.3e-52
VEC53993.1|3190468_3190768_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC53996.1|3190835_3191024_-	Uncharacterised protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
VEC53999.1|3191177_3193550_-	putative replication protein for prophage	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
VEC54002.1|3193549_3194371_-	Uncharacterised protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
VEC54005.1|3194376_3195231_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	91.5	1.1e-149
VEC54008.1|3195227_3195455_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
VEC54011.1|3195454_3195688_-	Protein of uncharacterised function (DUF2732)	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
VEC54014.1|3195755_3196097_-	Uncharacterised protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
VEC54017.1|3196060_3196261_-	Protein of uncharacterised function (DUF2724)	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
VEC54020.1|3196268_3196778_-	phage regulatory protein CII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
VEC54023.1|3196810_3197032_-	ybl30	NA	NA	NA	NA	NA
VEC54026.1|3197157_3197727_+	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.9e-38
VEC54029.1|3197742_3197934_+	Uncharacterised protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
VEC54032.1|3198120_3199152_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	2.5e-105
3200862:3200876	attR	GGCGAAAAAGGCATT	NA	NA	NA	NA
>prophage 12
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	3509908	3565626	4941549	portal,coat,terminase,tail,protease,capsid,tRNA,integrase,head,lysis	Enterobacteria_phage(41.38%)	70	3509440:3509486	3555420:3555466
3509440:3509486	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VEC54973.1|3509908_3510862_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VEC54976.1|3511048_3512533_+|protease	putative protease	protease	NA	NA	NA	NA
VEC54980.1|3513090_3513747_+	methylase	NA	NA	NA	NA	NA
VEC54983.1|3514294_3514528_+	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VEC54986.1|3514844_3515435_+	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
VEC54989.1|3516107_3519068_-|tail	putative tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
VEC54992.1|3519133_3519733_-	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
VEC54995.1|3519803_3520568_-|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	96.1	3.1e-137
VEC54998.1|3520540_3521452_-	putative host specificity protein	NA	K7PKJ2	Enterobacteria_phage	96.2	4.7e-140
VEC55001.1|3521482_3521734_-	Host specificity protein J of prophage	NA	A0A0K2FI38	Escherichia_phage	97.4	4.0e-33
VEC55004.1|3521721_3522666_-	Host specificity protein J	NA	A0A2I6TCW5	Escherichia_phage	96.8	4.2e-184
VEC55007.1|3522748_3523216_-|tail	tail:host specificity protein	tail	C6ZCZ5	Enterobacteria_phage	98.7	4.5e-78
VEC55010.1|3523276_3523948_-|tail	phage tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
VEC55013.1|3523973_3524588_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	94.4	7.7e-102
VEC55016.1|3524593_3525292_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
VEC55019.1|3525291_3525621_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
VEC55022.1|3525617_3527555_-|tail	tail component of prophage	tail	A0A0K2FI43	Enterobacteria_phage	90.1	2.2e-296
VEC55025.1|3527691_3528177_-|tail	tail component of prophage CP-933X	tail	A0A2R9YJM8	Escherichia_phage	100.0	8.0e-70
VEC55028.1|3528169_3528604_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
VEC55031.1|3528585_3529008_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
VEC55034.1|3529023_3529764_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
VEC55038.1|3529771_3530167_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VEC55041.1|3530163_3530409_-|tail	minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.6e-37
VEC55044.1|3530495_3530741_-|tail	prophage minor tail protein Z	tail	A0A2R9YJK4	Escherichia_phage	96.3	1.8e-30
VEC55047.1|3530752_3531106_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
VEC55050.1|3531117_3531513_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	94.7	2.8e-57
VEC55054.1|3531630_3532581_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.8	6.2e-175
VEC55057.1|3532636_3532969_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
VEC55060.1|3533079_3533586_-|capsid	enterobacteria phage lambda, capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	97.4	1.3e-70
VEC55062.1|3533874_3534066_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A2I6TC87	Escherichia_phage	100.0	3.6e-26
VEC55065.1|3534279_3535881_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	98.7	2.1e-308
VEC55068.1|3535877_3536084_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VEC55071.1|3536080_3538006_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
VEC55074.1|3537980_3538526_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
VEC55078.1|3539273_3539480_-	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
VEC55081.1|3539765_3540176_+	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
VEC55084.1|3540466_3540760_+	lambdoid prophage DLP12 Bor-like protein	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
VEC55087.1|3540791_3541253_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
VEC55090.1|3541249_3541747_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
VEC55093.1|3541746_3541962_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
VEC55096.1|3542550_3543648_+	outer membrane porin; DLP12 prophage	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
VEC55099.1|3543837_3544221_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
VEC55102.1|3544238_3545228_-	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	96.7	7.1e-190
VEC55105.1|3545235_3546033_-	putative KilA-N phage protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
VEC55108.1|3546052_3546142_-	putative Crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	100.0	1.6e-08
VEC55111.1|3546151_3546442_-	putative Crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.0	2.7e-49
VEC55114.1|3546438_3546765_-	putative LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
VEC55117.1|3546764_3547259_-	CPS-53 (KpLE1) prophage protein	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	4.0e-85
VEC55120.1|3547255_3548197_-	phage O protein family	NA	U5P0A0	Shigella_phage	99.0	1.9e-152
VEC55123.1|3548206_3548545_-	Uncharacterised protein	NA	S5FNS9	Shigella_phage	98.2	1.0e-55
VEC55126.1|3548541_3549093_-	nucleic acid-binding protein; e14 prophage	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
VEC55129.1|3549085_3549346_-	putative lambda repressor-like DNA-binding domains	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
VEC55132.1|3549488_3550136_+	regulatory protein	NA	S5FUZ3	Shigella_phage	100.0	2.8e-118
VEC55134.1|3550455_3550971_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC55137.1|3551441_3551804_+	CPS-53 (KpLE1) prophage protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
VEC55140.1|3551869_3552694_+	CPS-53 (KpLE1) prophage protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
VEC55143.1|3552821_3553358_+	CPS-53 (KpLE1) prophage protein	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
VEC55146.1|3553348_3553711_+	CPS-53 (KpLE1) prophage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
VEC55149.1|3553710_3554016_+	CPS-53 (KpLE1) prophage protein	NA	U5P0J0	Shigella_phage	95.0	9.2e-48
VEC55152.1|3554242_3555406_+|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A088CD23	Shigella_phage	86.6	5.2e-200
VEC55155.1|3555740_3556373_+	two component transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
3555420:3555466	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VEC55158.1|3556375_3556891_-	fimbrial protein	NA	NA	NA	NA	NA
VEC55161.1|3556901_3557909_-	fimbrial protein	NA	NA	NA	NA	NA
VEC55164.1|3558067_3560530_-	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEC55167.1|3560560_3561253_-	fimbrial chaperone	NA	NA	NA	NA	NA
VEC55170.1|3561472_3562015_-	fimbrial-like protein	NA	NA	NA	NA	NA
VEC55173.1|3562495_3563362_+	5,10-methylene-tetrahydrofolate dehydrogenase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
VEC55176.1|3563363_3563576_+	putative RNA-binding protein	NA	NA	NA	NA	NA
VEC55179.1|3563683_3564205_+	putative membrane-bound metal-dependent hydrolase	NA	NA	NA	NA	NA
VEC55181.1|3564240_3565626_-|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 13
LR134225	Escherichia coli strain NCTC9054 genome assembly, chromosome: 1	4941549	4254917	4331465	4941549	transposase,tRNA,integrase	Shigella_phage(25.93%)	67	4292535:4292551	4329278:4329294
VEC57207.1|4254917_4255298_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	97.6	2.3e-64
VEC57210.1|4255294_4255642_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
VEC57213.1|4255691_4256120_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.7	7.8e-53
VEC57216.1|4256542_4257076_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	75.0	1.2e-82
VEC57219.1|4257318_4258677_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEC57221.1|4259409_4259667_-	Biofilm development protein YmgB/AriR	NA	NA	NA	NA	NA
VEC57224.1|4260612_4260930_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	87.6	7.6e-45
VEC57227.1|4261445_4261907_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC57230.1|4261936_4262890_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VEC57233.1|4262976_4265301_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
VEC57236.1|4265345_4266248_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VEC57239.1|4266244_4267243_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VEC57242.1|4267239_4268196_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VEC57245.1|4268196_4268964_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VEC57248.1|4269521_4269665_-	KpLE2 phage-like element, protein	NA	NA	NA	NA	NA
VEC57251.1|4269861_4270068_-|transposase	putative transposase	transposase	Q716C2	Shigella_phage	91.0	1.5e-30
VEC57254.1|4270176_4270602_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
VEC57257.1|4270598_4270949_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
VEC57260.1|4270979_4272593_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
VEC57263.1|4272898_4273075_+	Insertion element IS2A protein	NA	Q76S41	Shigella_phage	98.2	4.1e-24
VEC57266.1|4273776_4274559_-	transcriptional regulator	NA	NA	NA	NA	NA
VEC57269.1|4274864_4275785_+	Deoxyribokinase	NA	NA	NA	NA	NA
VEC57272.1|4275813_4275927_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC57275.1|4276042_4276348_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC57278.1|4276575_4277130_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC57281.1|4277141_4278155_+	Deoxyribose specific mutarotase	NA	NA	NA	NA	NA
VEC57284.1|4278344_4278710_+|transposase	transposase	transposase	Q76S41	Shigella_phage	99.2	6.2e-59
VEC57287.1|4278667_4279246_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	98.6	3.1e-76
VEC57290.1|4279191_4279572_+|transposase	IS2 insertion element transposase InsAB'	transposase	Q9ZXG3	Shigella_phage	97.6	3.1e-69
VEC57293.1|4279957_4280197_+|transposase	Putative transposase	transposase	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
VEC57296.1|4280407_4281664_-	PTS system EIIC component	NA	NA	NA	NA	NA
VEC57299.1|4281676_4281964_-	PTS system transporter subunit IIB	NA	NA	NA	NA	NA
VEC57302.1|4281979_4282423_-	PTS system EIIA component	NA	NA	NA	NA	NA
VEC57305.1|4282693_4283725_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
VEC57308.1|4284251_4285172_-	maturase-related protein	NA	NA	NA	NA	NA
VEC57311.1|4286418_4286745_+|transposase	transposase	transposase	NA	NA	NA	NA
VEC57314.1|4286954_4287299_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC57318.1|4287653_4289003_-	putative sugar phosphate permease	NA	NA	NA	NA	NA
VEC57321.1|4289016_4289940_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
VEC57325.1|4289951_4291148_-	CoA-transferase	NA	NA	NA	NA	NA
VEC57328.1|4291446_4293297_+	acetoacetate metabolism regulator (two-component system response regulator)	NA	NA	NA	NA	NA
4292535:4292551	attL	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
VEC57331.1|4293578_4294415_+	putative restriction endonuclease	NA	NA	NA	NA	NA
VEC57334.1|4294448_4295102_-|transposase	putative transposase subunit	transposase	Q716C2	Shigella_phage	99.5	4.1e-130
VEC57337.1|4295363_4296095_-|transposase	transposase, IS30	transposase	W5R8L2	Staphylococcus_phage	36.7	1.1e-33
VEC57340.1|4296431_4296821_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VEC57343.1|4297071_4297434_+	6-pyruvoyl tetrahydrobiopterin synthase	NA	NA	NA	NA	NA
VEC57346.1|4297696_4299868_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC57349.1|4299867_4300413_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC57352.1|4300409_4304924_-	helicase	NA	NA	NA	NA	NA
VEC57355.1|4304923_4305658_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC57358.1|4305644_4308794_-	ATPase	NA	NA	NA	NA	NA
VEC57361.1|4308790_4309690_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC57364.1|4309689_4312140_-	helicase	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	25.5	7.7e-20
VEC57366.1|4312152_4315209_-	helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	43.0	2.9e-08
VEC57369.1|4315525_4316659_-	DGQHR domain	NA	NA	NA	NA	NA
VEC57372.1|4316655_4317927_-|tRNA	tRNA-guanine family transglycosylase	tRNA	NA	NA	NA	NA
VEC57375.1|4317979_4318492_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC57378.1|4319034_4319268_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC57381.1|4319369_4320614_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.2	1.1e-83
VEC57385.1|4321080_4322100_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	3.2e-44
VEC57388.1|4322395_4323049_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	39.0	1.7e-35
VEC57391.1|4323086_4323734_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.2e-18
VEC57395.1|4323852_4324935_-	putative permease	NA	NA	NA	NA	NA
VEC57398.1|4324934_4326014_-	putative permease	NA	NA	NA	NA	NA
VEC57401.1|4326301_4327813_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
VEC57404.1|4328166_4328610_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VEC57408.1|4328609_4331465_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
4329278:4329294	attR	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
