The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	1040063	1047203	5008027	tRNA	Escherichia_phage(83.33%)	6	NA	NA
VEC42526.1|1040063_1040702_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VEC42527.1|1040698_1041961_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
VEC42528.1|1041957_1042866_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
VEC42529.1|1043061_1043829_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
VEC42530.1|1043879_1044536_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
VEC42531.1|1044641_1047203_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	1082556	1138721	5008027	transposase,tRNA,integrase	Vibrio_phage(14.29%)	53	1080995:1081011	1142008:1142024
1080995:1081011	attL	AGCAGGCACTGGAAATC	NA	NA	NA	NA
VEC42568.1|1082556_1085187_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
VEC42569.1|1085421_1085607_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
VEC42570.1|1087199_1087766_+	putative phosphatase	NA	NA	NA	NA	NA
VEC42571.1|1087762_1088191_+	inner membrane protein	NA	NA	NA	NA	NA
VEC42572.1|1088263_1089820_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
VEC42573.1|1089969_1090485_+	S-ribosylhomocysteinase	NA	NA	NA	NA	NA
VEC42574.1|1090548_1092087_-	multidrug resistance protein B	NA	NA	NA	NA	NA
VEC42575.1|1092103_1093276_-	multidrug resistance protein A	NA	NA	NA	NA	NA
VEC42576.1|1093402_1093933_-	MarR-family transcriptional repressor	NA	NA	NA	NA	NA
VEC42577.1|1094023_1094359_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEC42578.1|1094348_1095086_-	AzlC-like membrane protein	NA	NA	NA	NA	NA
VEC42579.1|1095209_1096394_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC42580.1|1096684_1097677_-	glycine betaine/L-proline ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
VEC42581.1|1097733_1098798_-	glycine betaine/L-proline ABC transporter permease	NA	NA	NA	NA	NA
VEC42582.1|1098790_1099993_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
VEC42583.1|1100347_1101307_-	ribonucleoside-diphosphate reductase 2 beta chain	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
VEC42584.1|1101316_1103461_-	ribonucleoside-diphosphate reductase 2 alpha chain	NA	A8E2R1	Enterococcus_phage	48.0	2.1e-194
VEC42585.1|1103433_1103844_-	ribonucleotide reductase stimulatory protein	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
VEC42586.1|1103840_1104086_-	glutaredoxin-like protein	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
VEC42587.1|1104333_1104663_-	protein	NA	NA	NA	NA	NA
VEC42588.1|1104814_1105159_+	protein	NA	NA	NA	NA	NA
VEC42589.1|1105195_1105645_-	inner membrane protein	NA	NA	NA	NA	NA
VEC42590.1|1106312_1106717_+	DNA-binding protein	NA	NA	NA	NA	NA
VEC42591.1|1106763_1107288_-	inner membrane protein with hydrolase activity	NA	NA	NA	NA	NA
VEC42592.1|1107297_1107597_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
VEC42593.1|1107779_1107938_+	membrane protein	NA	NA	NA	NA	NA
VEC42594.1|1108021_1108471_+	putative peptidoglycan-binding protein	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
VEC42595.1|1108471_1109134_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEC42596.1|1109154_1110555_-	gamma-aminobutyrate transporter	NA	NA	NA	NA	NA
VEC42597.1|1110865_1112146_-	4-aminobutyrate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
VEC42598.1|1112159_1113608_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VEC42599.1|1113630_1114899_-	hydroxyglutarate oxidase	NA	NA	NA	NA	NA
VEC42600.1|1114918_1115896_-	Protein CsiD	NA	NA	NA	NA	NA
VEC42601.1|1116838_1118485_-	alpha-amylase	NA	NA	NA	NA	NA
VEC42602.1|1119870_1120353_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC42603.1|1120452_1121244_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC42604.1|1122155_1122626_+	outer membrane protein	NA	NA	NA	NA	NA
VEC42605.1|1122595_1123342_-|transposase	IS911 transposase orfB	transposase	Q716C2	Shigella_phage	58.6	7.4e-83
VEC42606.1|1123829_1124129_-	GTP-binding factor (fragment) from CP4-like prophage	NA	NA	NA	NA	NA
VEC42607.1|1124294_1124534_-	phage transcriptional regulator AlpA	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
VEC42608.1|1124647_1125529_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC42609.1|1125796_1125976_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC42610.1|1125962_1126709_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC42611.1|1126754_1130606_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC42612.1|1131073_1131307_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC42613.1|1131334_1131634_+|transposase	transposase	transposase	NA	NA	NA	NA
VEC42614.1|1131630_1132497_+|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VEC42615.1|1132514_1133813_+	addiction module	NA	NA	NA	NA	NA
VEC42616.1|1133826_1134693_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.9e-50
VEC42617.1|1134689_1134989_-|transposase	transposase	transposase	NA	NA	NA	NA
VEC42618.1|1135089_1136247_+	addiction module	NA	NA	NA	NA	NA
VEC42619.1|1136246_1137341_+	addiction module	NA	NA	NA	NA	NA
VEC42620.1|1137479_1138721_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
1142008:1142024	attR	GATTTCCAGTGCCTGCT	NA	NA	NA	NA
>prophage 3
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	1644133	1653575	5008027		Enterobacteria_phage(85.71%)	10	NA	NA
VEC43067.1|1644133_1645060_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
VEC43068.1|1645064_1645796_+	ABC transporter permease	NA	NA	NA	NA	NA
VEC43069.1|1645776_1645884_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEC43070.1|1645943_1646675_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VEC43071.1|1646896_1648582_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VEC43072.1|1648578_1649298_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEC43073.1|1649344_1649815_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VEC43074.1|1649855_1650317_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VEC43075.1|1650441_1652442_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
VEC43076.1|1652438_1653575_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 4
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	1666140	1730972	5008027	capsid,lysis,tail,holin,terminase,protease,tRNA,plate,integrase	Escherichia_phage(45.45%)	73	1693390:1693417	1725889:1725916
VEC43083.1|1666140_1668174_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
VEC43084.1|1668305_1669415_+	ATPase	NA	NA	NA	NA	NA
VEC43085.1|1669677_1669959_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
VEC43086.1|1670295_1670793_+	fimbrial protein	NA	NA	NA	NA	NA
VEC43087.1|1670873_1671548_+	putative periplasmic pilin chaperone	NA	NA	NA	NA	NA
VEC43088.1|1671563_1674044_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEC43089.1|1674057_1675092_+	putative fimbrial adhesin	NA	NA	NA	NA	NA
VEC43090.1|1675173_1675512_-	periplasmic modulator of Ni and Co efflux	NA	NA	NA	NA	NA
VEC43091.1|1675730_1676555_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
VEC43092.1|1676675_1676948_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
VEC43093.1|1677170_1677959_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
VEC43094.1|1677955_1678756_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VEC43095.1|1678820_1679639_+	1,4-beta-N-acetylmuramidase	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
VEC43096.1|1679690_1680437_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEC43097.1|1680410_1681376_-	putative carbohydrate/pyrimidine kinase	NA	NA	NA	NA	NA
VEC43098.1|1681372_1682377_-	putative ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
VEC43099.1|1682373_1683651_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC43100.1|1683907_1684960_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
VEC43101.1|1685269_1686124_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
VEC43102.1|1686152_1687415_+	putative tagatose 6-phosphate kinase	NA	NA	NA	NA	NA
VEC43103.1|1687424_1687877_+	galactitol-specific PTS system EIIA component	NA	NA	NA	NA	NA
VEC43104.1|1687907_1688192_+	galactitol-specific PTS system EIIB component	NA	NA	NA	NA	NA
VEC43105.1|1688195_1689551_+	galactitol-specific PTS system EIIC component	NA	NA	NA	NA	NA
VEC43106.1|1689599_1690640_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
VEC43107.1|1690739_1691519_+	galactitol utilization operon repressor	NA	NA	NA	NA	NA
VEC43108.1|1691600_1692500_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
VEC43109.1|1692914_1693232_+	protein	NA	NA	NA	NA	NA
1693390:1693417	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VEC43110.1|1693496_1694510_-|integrase	phage integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
VEC43111.1|1694625_1694925_-	immunity repressor	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
VEC43112.1|1695039_1695315_+	regulatory protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
VEC43113.1|1695325_1695496_+	Uncharacterised protein	NA	S4TNZ7	Salmonella_phage	98.2	2.3e-24
VEC43114.1|1695492_1695993_+	Phage protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
VEC43115.1|1696056_1696281_+	Protein of uncharacterised function (DUF2732)	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
VEC43116.1|1696280_1696583_+	Uncharacterised protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	5.0e-46
VEC43117.1|1696582_1696807_+	C4-type zinc finger protein, DksA/TraR family	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
VEC43118.1|1696803_1697079_+	relication initiation protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
VEC43119.1|1697068_1699192_+	Replication gene A protein (GpA)	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
VEC43120.1|1699313_1700561_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC43121.1|1700547_1702380_+	nucleoside triphosphate hydrolase	NA	NA	NA	NA	NA
VEC43122.1|1702725_1703760_-|capsid	phage capsid protein	capsid	A0A0F7LDI7	Escherichia_phage	99.7	2.4e-201
VEC43123.1|1703759_1705532_-	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
VEC43124.1|1705705_1706560_+|capsid	phage capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
VEC43125.1|1706618_1707692_+|capsid	major capsid protein	capsid	Q94MC7	Enterobacteria_phage	99.4	1.9e-201
VEC43126.1|1707695_1708439_+|terminase	small terminase subunit	terminase	Q858W5	Yersinia_virus	98.8	4.6e-125
VEC43127.1|1708538_1709048_+|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
VEC43128.1|1709047_1709251_+|tail	phage tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
VEC43129.1|1709254_1709536_+|holin,lysis	phage lysis holin	holin,lysis	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
VEC43130.1|1709535_1710033_+	phage lysin	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
VEC43131.1|1710047_1710470_+	LysA protein	NA	Q858W1	Yersinia_virus	92.9	6.1e-58
VEC43132.1|1710457_1710883_+	LysB protein	NA	Q7Y4E2	Escherichia_virus	95.7	2.1e-66
VEC43133.1|1710869_1711028_+|lysis	phage lysis protein LysC	lysis	M1RZ27	Escherichia_phage	100.0	2.6e-22
VEC43134.1|1710990_1711458_+|tail	tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.5e-81
VEC43135.1|1711450_1711903_+|tail	tail protein	tail	A0A0F7LBV9	Escherichia_phage	96.7	5.0e-74
VEC43136.1|1711969_1712605_+|plate	Baseplate assembly protein V (GpV)	plate	A0A0F7LBP2	Escherichia_phage	97.6	1.6e-110
VEC43137.1|1712601_1712949_+|plate	phage baseplate protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	5.0e-58
VEC43138.1|1712953_1713862_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
VEC43139.1|1713854_1714385_+|tail	tail protein I (GpI)	tail	U5N0U8	Enterobacteria_phage	99.4	2.3e-102
VEC43140.1|1714395_1716549_+|tail	putative phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	71.3	2.2e-268
VEC43141.1|1716550_1717078_+|tail	tail fiber assembly protein GpG	tail	A0A0C4UR05	Shigella_phage	86.3	1.5e-85
VEC43142.1|1717372_1718674_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC43143.1|1719184_1720375_+|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
VEC43144.1|1720387_1720906_+|tail	phage major tail tube protein FII	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
VEC43145.1|1720962_1721238_+|tail	tail protein E (GpE)	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
VEC43146.1|1721382_1723830_+|tail	phage related tail protein	tail	M1T2S3	Escherichia_phage	95.8	0.0e+00
VEC43147.1|1723844_1724324_+	gpU phage protein	NA	Q7Y4C7	Escherichia_virus	98.7	7.3e-84
VEC43148.1|1724323_1725487_+	phage protein D	NA	A0A0F7LDZ2	Escherichia_phage	99.5	3.1e-205
VEC43149.1|1725568_1725787_+	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VEC43150.1|1726060_1727422_-|protease	putative protease	protease	Q6DW11	Phage_TP	100.0	1.1e-217
1725889:1725916	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VEC43151.1|1727524_1727821_-	plasmid stabilisation system protein	NA	NA	NA	NA	NA
VEC43152.1|1727822_1728074_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
VEC43153.1|1728326_1728659_-	protein	NA	NA	NA	NA	NA
VEC43154.1|1728849_1729572_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
VEC43155.1|1729568_1730972_-	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 5
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	1777656	1785107	5008027		Enterobacteria_phage(42.86%)	7	NA	NA
VEC43189.1|1777656_1779051_+	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	31.3	1.1e-18
VEC43190.1|1779225_1780119_+	UTP--glucose-1-phosphate uridylyltransferase subunit GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
VEC43191.1|1780511_1781636_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	30.6	2.4e-29
VEC43192.1|1781639_1782725_+	dTDP-D-glucose 4,6-dehydratase rmlB	NA	I7HTA3	Enterobacteria_phage	53.9	1.1e-100
VEC43193.1|1782724_1783624_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	3.3e-29
VEC43194.1|1783677_1784556_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	62.4	5.8e-103
VEC43195.1|1784552_1785107_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	1.2e-48
>prophage 6
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	2250397	2315639	5008027	capsid,lysis,transposase,tail,terminase,portal,head,coat,protease,integrase	Escherichia_phage(37.5%)	77	2280878:2280893	2284195:2284210
VEC43650.1|2250397_2251219_-|protease	putative protease	protease	NA	NA	NA	NA
VEC43651.1|2251494_2251803_-	acid shock protein	NA	NA	NA	NA	NA
VEC43652.1|2252226_2253480_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEC43653.1|2253586_2254480_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEC43654.1|2254614_2255835_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VEC43655.1|2255959_2256655_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VEC43656.1|2256607_2257864_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VEC43657.1|2258059_2258674_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VEC43658.1|2258716_2259571_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VEC43659.1|2259572_2260190_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VEC43660.1|2260200_2262597_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	4.8e-208
VEC43661.1|2262684_2265111_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
VEC43662.1|2265309_2265615_-	protein	NA	NA	NA	NA	NA
VEC43663.1|2265686_2266433_+	lipoprotein	NA	NA	NA	NA	NA
VEC43664.1|2266435_2266996_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VEC43665.1|2267030_2267372_-	protein	NA	NA	NA	NA	NA
VEC43666.1|2267506_2267833_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VEC43667.1|2268038_2269253_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
VEC43668.1|2269264_2269555_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	40.0	4.7e-09
VEC43669.1|2269593_2270283_+	dehydrogenase	NA	NA	NA	NA	NA
VEC43670.1|2270340_2270469_+	protein, truncated	NA	NA	NA	NA	NA
VEC43671.1|2270470_2271265_-|integrase	defective integrase; Qin prophage	integrase	Q859D2	Escherichia_coli_phage	63.3	3.0e-98
VEC43672.1|2271339_2271750_-|integrase	defective integrase; Qin prophage	integrase	Q9EY96	Enterobacteria_phage	61.1	2.8e-39
VEC43673.1|2271784_2272021_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VEC43674.1|2272108_2274580_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
VEC43675.1|2274673_2274865_-	putative prophage protein	NA	NA	NA	NA	NA
VEC43676.1|2274861_2275050_-	division inhibition protein	NA	NA	NA	NA	NA
VEC43677.1|2275449_2275614_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC43678.1|2275739_2275835_-	putative prophage protein	NA	NA	NA	NA	NA
VEC43679.1|2275864_2275993_-	putative prophage protein	NA	NA	NA	NA	NA
VEC43680.1|2275994_2276150_-	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
VEC43681.1|2276318_2276726_-	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
VEC43682.1|2276806_2277034_+	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VEC43683.1|2277017_2277539_+	YdfX	NA	NA	NA	NA	NA
VEC43684.1|2277519_2278485_+	ybl78	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
VEC43685.1|2278525_2278948_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
VEC43686.1|2278944_2279301_+	putative methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
VEC43687.1|2280453_2280633_+	membrane protein	NA	NA	NA	NA	NA
2280878:2280893	attL	AGGAGAAGCAGGCTAT	NA	NA	NA	NA
VEC43688.1|2280967_2281339_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VEC43689.1|2281376_2282309_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VEC43690.1|2282745_2283078_-	Qin prophage protein	NA	NA	NA	NA	NA
VEC43691.1|2283610_2283850_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VEC43692.1|2283849_2284137_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VEC43693.1|2284208_2284364_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
2284195:2284210	attR	AGGAGAAGCAGGCTAT	NA	NA	NA	NA
VEC43694.1|2284580_2284832_+	putative prophage protein	NA	NA	NA	NA	NA
VEC43695.1|2285178_2286228_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VEC43696.1|2286241_2286994_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VEC43697.1|2287415_2287628_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VEC43698.1|2288745_2288865_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC43699.1|2288906_2289113_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VEC43700.1|2289117_2289429_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VEC43701.1|2289425_2289959_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VEC43702.1|2289955_2290453_+	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
VEC43703.1|2291701_2291875_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VEC43704.1|2292026_2292437_-	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VEC43705.1|2293116_2293662_+	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
VEC43706.1|2293636_2295562_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
VEC43707.1|2295558_2295765_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VEC43708.1|2295761_2297363_+|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
VEC43709.1|2297343_2298663_+|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
VEC43710.1|2298672_2299005_+	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
VEC43711.1|2299060_2300086_+|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
VEC43712.1|2300127_2300523_+	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.5e-55
VEC43713.1|2300534_2300888_+|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	97.4	4.9e-61
VEC43714.1|2300899_2301478_+|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
VEC43715.1|2301474_2301870_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
VEC43716.1|2301877_2302618_+|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
VEC43717.1|2302633_2303056_+|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
VEC43718.1|2303037_2303472_+|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VEC43719.1|2303464_2306044_+|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
VEC43720.1|2306040_2306370_+|tail	Minor tail protein M	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
VEC43721.1|2306369_2307068_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
VEC43722.1|2307073_2307817_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
VEC43723.1|2307813_2308386_+|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
VEC43724.1|2308446_2311944_+	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	98.1	0.0e+00
VEC43725.1|2312014_2312614_+	outer membrane precursor Lom	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
VEC43726.1|2312678_2315639_+|tail	putative tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
>prophage 7
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	2525532	2587723	5008027	lysis,transposase,tail,terminase,coat,tRNA,integrase	Escherichia_phage(48.98%)	68	2549845:2549861	2593324:2593340
VEC43901.1|2525532_2525967_+	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
VEC43902.1|2526925_2527159_+	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
VEC43903.1|2527475_2528066_+	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
VEC43904.1|2528738_2530904_-|tail	phage tail domain-containing protein	tail	X2KTY7	Enterobacteria_phage	53.5	1.4e-203
VEC43905.1|2531034_2531772_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC43906.1|2532333_2532933_-	outer membrane precursor Lom	NA	A5LH44	Enterobacteria_phage	95.0	1.6e-107
VEC43907.1|2533000_2536480_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	90.8	0.0e+00
VEC43908.1|2536540_2537083_-|tail	putative phage tail component	tail	A0A291AWV5	Escherichia_phage	81.9	5.4e-75
VEC43909.1|2537079_2537679_-|tail	tail component	tail	A5LH41	Enterobacteria_phage	97.0	3.7e-117
VEC43910.1|2537828_2538527_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
VEC43911.1|2538526_2538823_-|tail	putative phage minor tail protein	tail	H6WZM2	Escherichia_phage	52.0	1.8e-24
VEC43912.1|2538857_2542091_-|tail	putative phage tail length tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.7	1.3e-112
VEC43913.1|2542564_2543014_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC43914.1|2543074_2544037_-	Uncharacterised protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
VEC43915.1|2544063_2544456_-	phage protein	NA	NA	NA	NA	NA
VEC43916.1|2544452_2544833_-	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
VEC43917.1|2544833_2545217_-	Uncharacterised protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
VEC43918.1|2545216_2545612_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC43919.1|2545615_2545792_-	Uncharacterised protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
VEC43920.1|2545834_2546974_-|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	74.7	1.7e-158
VEC43921.1|2547072_2547711_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	68.3	3.3e-71
VEC43922.1|2547769_2548792_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	9.2e-201
VEC43923.1|2548791_2549571_+	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
VEC43924.1|2549580_2549868_-	Uncharacterised protein	NA	M4QQ62	Salicola_phage	60.4	3.9e-08
2549845:2549861	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
VEC43925.1|2549900_2551016_-	phage protein	NA	I6PD76	Cronobacter_phage	54.6	2.7e-113
VEC43926.1|2550996_2552403_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
VEC43927.1|2552405_2553707_-|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
VEC43928.1|2553687_2554641_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	8.8e-113
VEC43929.1|2554786_2554996_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC43930.1|2554973_2555906_-	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
VEC43931.1|2555898_2556693_-	ParB-like nuclease	NA	R4TG31	Halovirus	40.7	7.5e-49
VEC43932.1|2556830_2557298_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VEC43933.1|2557240_2558254_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VEC43934.1|2558424_2558889_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	92.1	9.0e-71
VEC43935.1|2558885_2559383_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
VEC43936.1|2559382_2559598_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
VEC43937.1|2559849_2560245_-	tolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VEC43938.1|2560395_2560824_-	TolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VEC43939.1|2561867_2562410_-	antitermination protein	NA	A0A0U2S606	Escherichia_phage	75.7	4.9e-76
VEC43940.1|2562406_2562697_-	phage protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
VEC43941.1|2562696_2563296_-	phage protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
VEC43942.1|2564109_2564448_+	tellurite resistance protein	NA	NA	NA	NA	NA
VEC43943.1|2565171_2566371_+	inner membrane transport protein YdhP	NA	NA	NA	NA	NA
VEC43944.1|2566382_2567075_+	cation transport protein chaC	NA	NA	NA	NA	NA
VEC43945.1|2567071_2567953_+	transcriptional regulator	NA	NA	NA	NA	NA
VEC43946.1|2568083_2569361_-	Predicted membrane protein (DUF2254)	NA	NA	NA	NA	NA
VEC43947.1|2569424_2571422_-	secondary glycine betaine transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
VEC43948.1|2571762_2572185_-	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
VEC43949.1|2572225_2573296_-	replication protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
VEC43950.1|2573367_2573793_-	phage regulatory protein	NA	NA	NA	NA	NA
VEC43951.1|2573789_2574044_-	regulatory protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
VEC43952.1|2574123_2574543_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
VEC43953.1|2574829_2574964_+	Rac prophage protein	NA	NA	NA	NA	NA
VEC43954.1|2574974_2575130_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
VEC43955.1|2575126_2575738_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VEC43956.1|2576056_2576278_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
VEC43957.1|2576277_2576448_+	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	6.1e-17
VEC43958.1|2576522_2576798_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
VEC43959.1|2576899_2579500_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
VEC43960.1|2579492_2580302_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
VEC43961.1|2580545_2580755_+	gydaC	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
VEC43962.1|2580833_2581049_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VEC43963.1|2581050_2582286_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
VEC43964.1|2582337_2583273_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
VEC43965.1|2583401_2584775_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VEC43966.1|2584804_2584978_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC43967.1|2585252_2586236_-	zinc transport protein	NA	NA	NA	NA	NA
VEC43968.1|2586490_2587723_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2593324:2593340	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 8
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	3616621	3704700	5008027	capsid,tail,holin,terminase,portal,protease,head,plate,integrase	Shigella_phage(53.33%)	96	3659983:3660038	3700789:3700844
VEC44910.1|3616621_3618655_-|holin	high-affinity choline transport protein (BCCT-family transporter)	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
VEC44911.1|3618783_3619371_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
VEC44912.1|3619384_3620857_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
VEC44913.1|3620870_3622541_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
VEC44914.1|3622559_3622811_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC44915.1|3623615_3624179_+	Type 1 fimbriae regulatory protein fimB	NA	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
VEC44916.1|3624508_3625303_+	HTH DNA-binding domain-containing protein	NA	NA	NA	NA	NA
VEC44917.1|3625299_3625440_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC44918.1|3625456_3626218_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC44919.1|3626259_3628557_+	adhesin; outer membrane autotransporter barrel	NA	NA	NA	NA	NA
VEC44920.1|3628740_3629406_+	inner membrane protein	NA	NA	NA	NA	NA
VEC44921.1|3629651_3630347_-	transporter	NA	NA	NA	NA	NA
VEC44922.1|3630339_3631767_-	putative electron transport protein YkgF	NA	NA	NA	NA	NA
VEC44923.1|3631777_3632497_-	hydroxyacid oxidoreductase (Fe-S centre)	NA	NA	NA	NA	NA
VEC44924.1|3633025_3633880_-	transcriptional regulator YkgD	NA	NA	NA	NA	NA
VEC44925.1|3634105_3635431_+	putative pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
VEC44926.1|3635787_3636381_+	inner membrane protein	NA	NA	NA	NA	NA
VEC44927.1|3636540_3637410_-	putative aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
VEC44928.1|3637658_3638516_+	Putatve transcriptional regulator ykgA	NA	NA	NA	NA	NA
VEC44929.1|3638637_3642891_-	Ig domain-containing protein	NA	NA	NA	NA	NA
VEC44930.1|3643762_3643882_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC44931.1|3644006_3644108_+	small predicted membrane protein	NA	NA	NA	NA	NA
VEC44932.1|3644467_3644734_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEC44933.1|3644733_3644874_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
VEC44934.1|3645958_3646501_+	putative fimbrial transcriptional regulator	NA	NA	NA	NA	NA
VEC44935.1|3646575_3647163_+	fimbrillin	NA	NA	NA	NA	NA
VEC44936.1|3647220_3647889_+	putative fimbrial protein	NA	NA	NA	NA	NA
VEC44937.1|3647914_3650440_+	putative fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEC44938.1|3650429_3652073_+	putative fimbrial protein	NA	NA	NA	NA	NA
VEC44939.1|3652041_3652752_+	putative fimbrial protein	NA	NA	NA	NA	NA
VEC44940.1|3653641_3654256_-	integral membrane protein	NA	NA	NA	NA	NA
VEC44941.1|3654673_3655363_+	putative xanthine dehydrogenase, iron-sulfur binding subunit	NA	NA	NA	NA	NA
VEC44942.1|3655359_3656316_+	putative xanthine dehydrogenase, FAD-binding subunit	NA	NA	NA	NA	NA
VEC44943.1|3656312_3658511_+	putative xanthine dehydrogenase, molybdenum-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
VEC44944.1|3658520_3659477_+	xanthine dehydrogenase accessory factor	NA	NA	NA	NA	NA
VEC44945.1|3659455_3659866_+	transcriptional regulator	NA	NA	NA	NA	NA
3659983:3660038	attL	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
VEC44946.1|3660103_3660256_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC44947.1|3660490_3661423_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC44948.1|3661839_3662613_+	Uncharacterised protein	NA	G9IA57	Pseudomonas_phage	38.9	1.1e-36
VEC44949.1|3663164_3664232_+	putative O-acyltransferase, transmembrane	NA	NA	NA	NA	NA
VEC44950.1|3664492_3664909_-|tail	putative phage tail fiber assembly protein	tail	U5P0S4	Shigella_phage	71.6	2.2e-20
VEC44951.1|3664908_3665835_-|tail	putative phage tail protein	tail	U5P0I1	Shigella_phage	85.0	7.1e-51
VEC44952.1|3665838_3666423_-|tail	putative phage tail protein	tail	O22003	Shigella_phage	99.5	1.4e-113
VEC44953.1|3666413_3667472_-|plate	putative phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	97.4	2.0e-198
VEC44954.1|3667458_3667884_-|tail	bacteriophage V tail protein	tail	U5P0R9	Shigella_phage	98.6	2.0e-80
VEC44955.1|3667883_3668432_-|plate	putative phage baseplate protein	plate	Q8SBG6	Shigella_phage	99.5	8.7e-97
VEC44956.1|3668431_3669511_-|tail	putative phage tail protein	tail	U5P0H6	Shigella_phage	99.7	2.6e-206
VEC44957.1|3669507_3670836_-	Tail/DNA circulation protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
VEC44958.1|3670896_3672732_-|tail	bacteriophage V tail protein	tail	S5FM63	Shigella_phage	99.3	2.9e-306
VEC44959.1|3672873_3673143_-	phage protein	NA	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
VEC44960.1|3673142_3673499_-	phage protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
VEC44961.1|3673498_3674995_-|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.4	5.4e-274
VEC44962.1|3674978_3675149_-	phage protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
VEC44963.1|3675157_3675718_-	phage protein	NA	Q8SBH4	Shigella_phage	98.9	3.0e-105
VEC44964.1|3675714_3676221_-	prophage protein	NA	M1FPE2	Enterobacteria_phage	98.8	9.5e-90
VEC44965.1|3676195_3676606_-	prophage protein	NA	M1FJ87	Enterobacteria_phage	95.6	2.7e-71
VEC44966.1|3676602_3676926_-	phage protein	NA	U5P072	Shigella_phage	99.1	1.1e-56
VEC44967.1|3676928_3677129_-	phage protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
VEC44968.1|3677178_3678384_-|capsid	major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	100.0	1.8e-224
VEC44969.1|3678398_3679049_-|head,protease	pro-head protease	head,protease	U5P4H2	Shigella_phage	99.1	1.6e-118
VEC44970.1|3679026_3680268_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	2.9e-241
VEC44971.1|3680267_3680450_-	prophage protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
VEC44972.1|3680461_3682195_-|terminase	phage terminase, large subunit	terminase	U5P0Q5	Shigella_phage	99.7	0.0e+00
VEC44973.1|3682191_3682686_-|terminase	phage terminase small subunit	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
VEC44974.1|3682811_3683162_-	putative phage endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	8.9e-63
VEC44975.1|3683289_3683724_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC44976.1|3684249_3684642_-	Rz lytic protein from phage origin, coiled-coil	NA	Q8SBD9	Shigella_phage	86.2	1.4e-53
VEC44977.1|3684625_3685102_-	phage lysozyme	NA	U5P0A9	Shigella_phage	99.4	2.9e-88
VEC44978.1|3685105_3685441_-	Holin	NA	Q8SBE1	Shigella_phage	100.0	5.2e-60
VEC44979.1|3685517_3686570_-	DNA methylase	NA	A5LH81	Enterobacteria_phage	98.0	4.1e-204
VEC44980.1|3686720_3686924_-	Uncharacterised protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
VEC44981.1|3687193_3688135_+	Uncharacterised protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
VEC44982.1|3688156_3688606_+	Uncharacterised protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
VEC44983.1|3688641_3689007_-	putative phage antitermination protein q	NA	A5LH77	Enterobacteria_phage	87.5	7.1e-55
VEC44984.1|3689024_3690014_-	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
VEC44985.1|3690021_3690819_-	putative KilA-N phage protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	1.9e-148
VEC44986.1|3690838_3691228_-	putative Crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	100.0	3.2e-69
VEC44987.1|3691224_3691551_-	putative LexA repressor	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
VEC44988.1|3691547_3692201_-	putative phage AdoMet-dependent methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
VEC44989.1|3692200_3692689_-	CPS-53 (KpLE1) prophage protein	NA	U5P0U0	Shigella_phage	96.9	4.7e-86
VEC44990.1|3692691_3693633_-	phage O protein family	NA	S5FM81	Shigella_phage	98.4	9.8e-141
VEC44991.1|3693642_3693981_-	Uncharacterised protein	NA	S5FNS9	Shigella_phage	98.2	1.0e-55
VEC44992.1|3693977_3694529_-	nucleic acid-binding protein; e14 prophage	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
VEC44993.1|3694566_3694767_-	repressor protein dicC	NA	NA	NA	NA	NA
VEC44994.1|3694864_3695491_+	Repressor protein C2	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
VEC44995.1|3695738_3695945_+	putative prophage protein	NA	NA	NA	NA	NA
VEC44996.1|3695916_3696351_-	Uncharacterised protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
VEC44997.1|3696819_3697182_+	CPS-53 (KpLE1) prophage protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
VEC44998.1|3697247_3698072_+	CPS-53 (KpLE1) prophage protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
VEC44999.1|3698199_3698736_+	CPS-53 (KpLE1) prophage protein	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
VEC45000.1|3698726_3699089_+	CPS-53 (KpLE1) prophage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
VEC45001.1|3699088_3699394_+	CPS-53 (KpLE1) prophage protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
VEC45002.1|3699620_3700784_+|integrase	prophage integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
VEC45003.1|3700988_3702242_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3700789:3700844	attR	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
VEC45004.1|3702253_3703357_-	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
VEC45005.1|3703644_3704700_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
>prophage 9
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	4112586	4185097	5008027	transposase,tRNA,protease,integrase	Shigella_phage(20.0%)	76	4121884:4121901	4174619:4174636
VEC45364.1|4112586_4114671_+|protease	putative ATP-dependent Lon protease	protease	NA	NA	NA	NA
VEC45365.1|4114704_4115793_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45366.1|4116060_4116603_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45367.1|4116624_4117647_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45368.1|4118119_4118302_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45369.1|4118895_4120377_-	putative type I methylase	NA	A0A2H4PQP4	Staphylococcus_phage	31.5	2.5e-58
VEC45370.1|4120369_4120972_-	EcoKI restriction-modification system protein HsdS	NA	NA	NA	NA	NA
VEC45371.1|4120988_4121174_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45372.1|4121404_4121677_-|integrase	phage integrase	integrase	Q7M297	Enterobacteria_phage	47.4	1.6e-14
VEC45373.1|4121690_4121903_-	Uncharacterised protein	NA	NA	NA	NA	NA
4121884:4121901	attL	CGAAGGCCGGACTCGAAC	NA	NA	NA	NA
VEC45374.1|4122141_4122288_-	putative restriction methylase	NA	NA	NA	NA	NA
VEC45375.1|4122372_4122570_-	Aec78	NA	NA	NA	NA	NA
VEC45376.1|4122589_4123078_-	aec77	NA	NA	NA	NA	NA
VEC45377.1|4123074_4123452_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VEC45378.1|4123498_4123873_-	intergenic-region protein	NA	NA	NA	NA	NA
VEC45379.1|4123952_4124174_-	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
VEC45380.1|4124260_4124737_-	putative DNA repair protein	NA	NA	NA	NA	NA
VEC45381.1|4124751_4125231_-	putative antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
VEC45382.1|4125496_4126315_-	CP4-57 prophage protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
VEC45383.1|4126404_4126638_-	CP4-6 prophage protein	NA	NA	NA	NA	NA
VEC45384.1|4126643_4127321_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45385.1|4127468_4128149_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VEC45386.1|4128246_4128384_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45387.1|4128351_4129236_-	putative ATP/GTP-binding protein	NA	NA	NA	NA	NA
VEC45388.1|4129341_4130304_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45389.1|4130300_4131155_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45390.1|4133188_4133920_+	malate transporter	NA	NA	NA	NA	NA
VEC45391.1|4134429_4134882_+	putative transferase	NA	NA	NA	NA	NA
VEC45392.1|4135375_4136116_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VEC45393.1|4137533_4138100_+	Protein of uncharacterised function (DUF3296)	NA	NA	NA	NA	NA
VEC45394.1|4138346_4138922_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45395.1|4138990_4139227_+	putative regulatory protein	NA	NA	NA	NA	NA
VEC45396.1|4139223_4139382_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45397.1|4139469_4140018_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45398.1|4140036_4140165_-	putative proP effector	NA	NA	NA	NA	NA
VEC45399.1|4140164_4140533_-	IS3 element protein InsF	NA	NA	NA	NA	NA
VEC45400.1|4140529_4140835_-|transposase	putative transposase-related protein	transposase	NA	NA	NA	NA
VEC45401.1|4140976_4141186_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
VEC45402.1|4141186_4141480_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	87.9	2.1e-41
VEC45403.1|4141965_4142487_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VEC45404.1|4142483_4143437_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VEC45405.1|4143523_4145848_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
VEC45406.1|4145892_4146795_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VEC45407.1|4146791_4147790_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VEC45408.1|4147786_4148743_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VEC45409.1|4148743_4149511_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VEC45410.1|4150068_4150326_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VEC45411.1|4150408_4151062_-|transposase	putative transposase subunit	transposase	Q716C2	Shigella_phage	97.2	9.6e-127
VEC45412.1|4151323_4152475_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	4.4e-42
VEC45413.1|4152698_4153445_+|transposase	IS911 transposase orfB	transposase	Q716C2	Shigella_phage	59.4	8.8e-84
VEC45414.1|4153437_4154442_-|transposase	IS66 family transposase orfB	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.8	7.4e-86
VEC45415.1|4154461_4154809_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	75.7	4.4e-46
VEC45416.1|4154808_4155459_-|transposase	putative transposase subunit	transposase	A0A0P0ZCV4	Stx2-converting_phage	43.6	4.0e-16
VEC45417.1|4155750_4157115_-	transporter protein	NA	NA	NA	NA	NA
VEC45418.1|4157648_4158731_+	regulatory protein	NA	NA	NA	NA	NA
VEC45419.1|4158727_4160737_+	regulatory protein	NA	NA	NA	NA	NA
VEC45420.1|4160726_4161974_+	transport activator	NA	NA	NA	NA	NA
VEC45421.1|4162297_4162792_+|transposase	transposase	transposase	NA	NA	NA	NA
VEC45422.1|4163913_4164426_+	PixA protein	NA	NA	NA	NA	NA
VEC45423.1|4164512_4164854_+	PixH protein	NA	NA	NA	NA	NA
VEC45424.1|4164850_4165099_+	PixH protein	NA	NA	NA	NA	NA
VEC45425.1|4165219_4167211_+	fimbrial usher protein PixC	NA	NA	NA	NA	NA
VEC45426.1|4167207_4167729_+	fimbrial usher protein PixC	NA	NA	NA	NA	NA
VEC45427.1|4167797_4168529_+	PixD protein	NA	NA	NA	NA	NA
VEC45428.1|4168565_4169129_+	PixJ protein	NA	NA	NA	NA	NA
VEC45429.1|4169212_4169563_+	PixF protein	NA	NA	NA	NA	NA
VEC45430.1|4169751_4170744_+	PixG protein	NA	NA	NA	NA	NA
VEC45431.1|4170800_4171583_+	inner membrane protein	NA	NA	NA	NA	NA
VEC45432.1|4173160_4174426_-|integrase	phage integrase family site specific recombinase	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
VEC45433.1|4174892_4175912_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
4174619:4174636	attR	CGAAGGCCGGACTCGAAC	NA	NA	NA	NA
VEC45434.1|4176041_4177544_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.4e-83
VEC45435.1|4177704_4178787_-	putative permease	NA	NA	NA	NA	NA
VEC45436.1|4178786_4179887_-	putative permease	NA	NA	NA	NA	NA
VEC45437.1|4180153_4181665_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
VEC45438.1|4181759_4182242_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VEC45439.1|4182241_4185097_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 10
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	4402430	4446034	5008027	tail,terminase,portal,head,tRNA,protease,integrase	Enterobacteria_phage(46.51%)	52	4395723:4395737	4409057:4409071
4395723:4395737	attL	GTATGTTGAAACTTT	NA	NA	NA	NA
VEC45642.1|4402430_4403468_-|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
VEC45643.1|4403556_4404654_+|integrase	phage integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.8e-210
VEC45644.1|4404714_4404963_+	DNA damage-inducible protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
VEC45645.1|4404891_4405059_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45646.1|4405185_4405737_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45647.1|4405714_4407085_+	putative retron-type reverse transcriptase	NA	NA	NA	NA	NA
VEC45648.1|4407192_4407327_-	putative prophage protein	NA	NA	NA	NA	NA
VEC45649.1|4407522_4410864_-|tail	L-shaped tail fiber protein	tail	K7PGT9	Enterobacteria_phage	57.9	5.2e-285
4409057:4409071	attR	AAAGTTTCAACATAC	NA	NA	NA	NA
VEC45650.1|4410928_4411528_-	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	97.0	1.1e-108
VEC45651.1|4411596_4414992_-	Host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.7	0.0e+00
VEC45652.1|4415469_4416012_-|tail	putative tail component of prophage	tail	A0A291AWV5	Escherichia_phage	85.2	8.0e-79
VEC45653.1|4416008_4416608_-|tail	tail component	tail	C6ZCZ3	Enterobacteria_phage	98.5	2.7e-120
VEC45654.1|4416756_4417455_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
VEC45655.1|4417454_4417784_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	4.0e-57
VEC45656.1|4417780_4420855_-|tail	putative tail length tape measure protein from putative prophage	tail	A0A291AWX1	Escherichia_phage	94.7	0.0e+00
VEC45657.1|4420826_4421144_-|tail	minor tail protein T of prophage	tail	A5LH37	Enterobacteria_phage	99.0	2.6e-53
VEC45658.1|4421164_4421551_-|tail	minor tail component of prophage	tail	A0A291AWW5	Escherichia_phage	96.9	1.3e-62
VEC45659.1|4421611_4422355_-|tail	Major tail protein V	tail	A0A291AWU6	Escherichia_phage	97.2	1.4e-129
VEC45660.1|4422365_4422767_-|tail	Minor tail protein U	tail	K7PJP5	Enterobacteria_phage	100.0	1.1e-72
VEC45661.1|4422763_4423342_-|tail	Minor tail protein Z (GPZ) of prophage	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
VEC45662.1|4423353_4423629_-	prophage protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
VEC45663.1|4423621_4423945_-	prophage protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
VEC45664.1|4424031_4426059_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
VEC45665.1|4426003_4427512_-|head,tail,portal	portal protein (head-tail preconnector protein) from prophage	head,tail,portal	A5LH29	Enterobacteria_phage	99.8	1.2e-289
VEC45666.1|4427511_4427724_-	prophage protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
VEC45667.1|4427720_4429823_-|terminase	DNA packaging protein of prophage (terminase large subunit)	terminase	A0A291AWY5	Escherichia_phage	97.4	0.0e+00
VEC45668.1|4429822_4430314_-|terminase	bacteriophage DNA packaging protein; terminase, small subunit	terminase	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
VEC45669.1|4430671_4430848_+|tRNA	arginyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC45670.1|4430989_4431142_-	bacteriophage protein (Gene 65)	NA	K7PKL2	Enterobacteria_phage	98.0	3.6e-21
VEC45671.1|4431129_4431591_-	Putative endopeptidase	NA	K7P6Y5	Enterobacteria_phage	90.8	2.6e-70
VEC45672.1|4431587_4432202_-	phage endolysin	NA	A0A192Y6G4	Salmonella_phage	99.0	3.7e-112
VEC45673.1|4432201_4432483_-	phage membrane protein	NA	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
VEC45674.1|4432469_4432856_-	phage membrane protein	NA	A0A192Y8P2	Salmonella_phage	89.1	2.7e-52
VEC45675.1|4432949_4433735_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45676.1|4433928_4434618_-	phage antitermination protein Q	NA	NA	NA	NA	NA
VEC45677.1|4434639_4435635_-	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	98.8	2.8e-194
VEC45678.1|4435642_4436452_-	putative KilA-N domain protein	NA	A5LH75	Enterobacteria_phage	99.6	2.4e-151
VEC45679.1|4436471_4436861_-	putative Crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
VEC45680.1|4436857_4437184_-	putative LexA repressor	NA	A5LH73	Enterobacteria_phage	98.1	6.6e-52
VEC45681.1|4437180_4437834_-	putative phage AdoMet-dependent methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
VEC45682.1|4437833_4438322_-	CPS-53 (KpLE1) prophage protein	NA	K7PJR0	Enterobacteria_phage	98.1	3.6e-86
VEC45683.1|4438324_4439143_-	replication protein from phage	NA	Q8SBF1	Shigella_phage	99.6	8.9e-122
VEC45684.1|4439139_4439376_-	Uncharacterised protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
VEC45685.1|4440201_4440753_-	phage regulatory protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
VEC45686.1|4440796_4440997_-	DNA-binding transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
VEC45687.1|4441087_4441762_+	phage repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
VEC45688.1|4442428_4442791_+	CPS-53 (KpLE1) prophage protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
VEC45689.1|4442856_4443681_+	CPS-53 (KpLE1) prophage protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
VEC45690.1|4443897_4444650_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45691.1|4444686_4444956_+	phage protein	NA	S5MQM5	Escherichia_phage	97.8	2.5e-41
VEC45692.1|4444989_4445538_-	Uncharacterised protein	NA	S5M7T3	Escherichia_phage	89.6	2.7e-82
VEC45693.1|4445560_4446034_-	phage protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
>prophage 11
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	4586139	4673686	5008027	transposase	Escherichia_phage(42.86%)	97	NA	NA
VEC45803.1|4586139_4586454_+|transposase	iso-IS1 InsB protein, transposase	transposase	A0A0U2RK18	Escherichia_phage	87.9	7.0e-27
VEC45804.1|4586423_4586747_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45805.1|4586748_4590933_-	rhsB element core protein RshB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
VEC45806.1|4591092_4591305_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEC45807.1|4591507_4593706_+	primosome assembly protein PriA	NA	NA	NA	NA	NA
VEC45808.1|4594233_4595133_-|transposase	IS5 transposase and trans-activator	transposase	A0A077SK28	Escherichia_phage	99.3	6.7e-171
VEC45809.1|4595403_4595613_+	C1 inactivator protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
VEC45810.1|4595723_4596575_+	primary repressor of lytic functions	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
VEC45811.1|4596599_4598084_-	DNA packaging protein	NA	Q71T61	Escherichia_phage	100.0	1.5e-292
VEC45812.1|4598083_4599277_-	DNA packaging protein	NA	Q5QBP3	Enterobacteria_phage	93.5	4.4e-194
VEC45813.1|4599362_4599785_-	late promoter activating protein	NA	Q71T63	Escherichia_phage	100.0	3.3e-72
VEC45814.1|4600283_4600577_+	IS1 protein InsB	NA	U5P0U6	Shigella_phage	92.8	8.3e-46
VEC45815.1|4600704_4601109_+	Transcriptional regulator, effector-binding domain/component	NA	NA	NA	NA	NA
VEC45816.1|4601349_4601859_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45817.1|4602058_4602313_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45818.1|4602368_4602578_+	DNA binding domain, excisionase family	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.0	1.0e-13
VEC45819.1|4602668_4602962_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	92.8	8.3e-46
VEC45820.1|4603090_4603366_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	95.6	2.9e-45
VEC45821.1|4603509_4604553_-	putative prophage protein	NA	A0A077SLM1	Escherichia_phage	98.3	3.1e-204
VEC45822.1|4604580_4604760_-	Uncharacterised protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
VEC45823.1|4604764_4605145_-	toxin of P1 addiction system	NA	Q71T66	Escherichia_phage	99.2	5.7e-63
VEC45824.1|4605144_4605366_-	antitoxin of P1 addiction system	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
VEC45825.1|4605548_4607105_+	type I restriction-modification system, M subunit	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.1e-104
VEC45826.1|4607101_4608313_+	type I restriction-modification enzyme S subunit	NA	NA	NA	NA	NA
VEC45827.1|4608435_4611552_+	type I restriction-modification enzyme R subunit	NA	NA	NA	NA	NA
VEC45828.1|4611816_4612002_-	putative morphogenetic protein	NA	Q71T77	Escherichia_phage	98.4	4.6e-26
VEC45829.1|4612376_4612760_+|transposase	putative transposase	transposase	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
VEC45830.1|4612756_4613104_+	prophage CP-933O IS protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
VEC45831.1|4613153_4614689_+|transposase	transposase ORF 1, IS66 family	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
VEC45832.1|4614840_4615200_-	putative morphogenetic protein	NA	Q1MVG4	Enterobacteria_phage	100.0	6.3e-64
VEC45833.1|4615222_4616083_-	putative morphogenetic protein	NA	Q1MVG4	Enterobacteria_phage	100.0	1.5e-151
VEC45834.1|4616084_4616303_-	Uncharacterised protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
VEC45835.1|4616384_4617086_-	Uncharacterised protein	NA	A0A077SLK3	Escherichia_phage	100.0	7.1e-144
VEC45836.1|4617082_4617760_-	putative serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
VEC45837.1|4617756_4618383_-	putative norphogenetic protein	NA	Q71T82	Escherichia_phage	99.0	6.8e-122
VEC45838.1|4618884_4619040_-	putative norphogenetic protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
VEC45839.1|4619106_4619388_-	putative norphogenetic protein	NA	Q71T85	Escherichia_phage	100.0	2.2e-48
VEC45840.1|4619492_4619843_+|transposase	transposase ORF A, IS3 family	transposase	Q716C1	Shigella_phage	97.7	5.2e-39
VEC45841.1|4619762_4620914_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.3	7.5e-42
VEC45842.1|4620870_4621227_-|transposase	transposase IS3/IS911 family protein	transposase	U5P4I9	Shigella_phage	92.5	5.7e-33
VEC45843.1|4621818_4622097_+|transposase	ISEhe3, transposase orfA	transposase	U5P4I9	Shigella_phage	92.5	4.5e-33
VEC45844.1|4622351_4622966_+|transposase	transposase insF for insertion sequence IS3A/B/C/D/E/fA	transposase	U5P429	Shigella_phage	93.1	2.7e-107
VEC45845.1|4623027_4623822_-	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	87.8	1.2e-51
VEC45846.1|4624057_4624579_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45847.1|4624798_4627246_-|transposase	transposase	transposase	Q1MVP5	Enterobacteria_phage	64.8	1.3e-304
VEC45848.1|4627358_4628063_-|transposase	transposase, IS26	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
VEC45849.1|4628469_4629237_-	thiosulfate reductase cytochrome b subunit	NA	NA	NA	NA	NA
VEC45850.1|4629233_4629812_-	thiosulfate reductase iron-sulfur subunit	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-21
VEC45851.1|4629826_4632100_-	thiosulfate reductase subunit A	NA	NA	NA	NA	NA
VEC45852.1|4632247_4632952_-|transposase	transposase, IS26	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
VEC45853.1|4633266_4633671_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
VEC45854.1|4633701_4634127_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.8e-50
VEC45855.1|4634139_4635429_-	arsenical pump membrane protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	3.3e-171
VEC45856.1|4635477_4637229_-	Arsenical pump-driving ATPase	NA	NA	NA	NA	NA
VEC45857.1|4637246_4637609_-	arsenical resistance operon trans-acting repressor	NA	NA	NA	NA	NA
VEC45858.1|4637656_4638010_-	DNA-binding transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
VEC45859.1|4638248_4638521_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45860.1|4638729_4639035_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
VEC45861.1|4639036_4639255_-	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
VEC45862.1|4639854_4640085_+	Virulence-associated protein vagC	NA	NA	NA	NA	NA
VEC45863.1|4640081_4640498_+	PilT domain-containing protein	NA	NA	NA	NA	NA
VEC45864.1|4640533_4640785_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45865.1|4640865_4641966_-	putative salicylyl-CoA 5-hydroxylase	NA	NA	NA	NA	NA
VEC45866.1|4643287_4644631_-	putative amino acid permease	NA	NA	NA	NA	NA
VEC45867.1|4644627_4645539_-	Formamidase	NA	NA	NA	NA	NA
VEC45868.1|4645802_4646726_-|transposase	transposase, IS903.B	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.1e-165
VEC45869.1|4646844_4646976_+|transposase	transposase, IS26	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-16
VEC45870.1|4647162_4647438_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	95.6	2.9e-45
VEC45871.1|4647479_4648007_+	L-cystine-binding protein tcyJ precursor	NA	NA	NA	NA	NA
VEC45872.1|4648030_4648555_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45873.1|4648551_4648755_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45874.1|4648764_4649304_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45875.1|4649404_4650169_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEC45876.1|4650395_4651181_+	lysine-arginine-ornithine-binding periplasmic protein	NA	NA	NA	NA	NA
VEC45877.1|4651185_4652160_+	fructoselysine-6-P-deglycase	NA	NA	NA	NA	NA
VEC45878.1|4652172_4652985_+	fructoselysine kinase	NA	NA	NA	NA	NA
VEC45879.1|4653780_4654074_+	IS1 protein InsB	NA	U5P0U6	Shigella_phage	90.7	7.0e-45
VEC45880.1|4654126_4655050_-|transposase	transposase, IS903.B	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
VEC45881.1|4655112_4655241_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45882.1|4655629_4656703_+	Predicted membrane protein	NA	NA	NA	NA	NA
VEC45883.1|4656810_4657122_-	SNF2 family helicase	NA	NA	NA	NA	NA
VEC45884.1|4657346_4657739_-|transposase	ISEhe3, transposase orfB	transposase	U5P429	Shigella_phage	96.2	5.6e-66
VEC45885.1|4657903_4659427_-	reverse transcriptase-like protein from prophage or plasmid	NA	A0A0U4J920	Pseudomonas_phage	31.3	2.4e-43
VEC45886.1|4660018_4660258_-	IS911 orfA	NA	Q716C2	Shigella_phage	100.0	1.5e-29
VEC45887.1|4660574_4661726_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VEC45888.1|4662017_4662632_+|transposase	transposase insF for insertion sequence IS3A/B/C/D/E/fA	transposase	U5P429	Shigella_phage	93.6	1.2e-107
VEC45889.1|4664380_4665304_-|transposase	transposase, IS903.B	transposase	Q1MVF0	Enterobacteria_phage	96.7	3.6e-172
VEC45890.1|4665658_4665883_-|transposase	IS1353 transposase family protein	transposase	A0A1B1P773	Bacillus_phage	49.3	1.0e-08
VEC45891.1|4665854_4666385_-|transposase	putative transposase protein	transposase	A0A1B1P773	Bacillus_phage	39.6	2.2e-25
VEC45892.1|4666381_4666687_-|transposase	transposase	transposase	NA	NA	NA	NA
VEC45893.1|4667001_4667964_-	Peptidase M48, Ste24p precursor	NA	NA	NA	NA	NA
VEC45894.1|4667950_4668700_-	diguanylate cyclase	NA	NA	NA	NA	NA
VEC45895.1|4668937_4669135_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45896.1|4669134_4671930_-	chaperone ATPase	NA	K4FB40	Cronobacter_phage	40.8	1.2e-128
VEC45897.1|4672035_4672605_-	molecular chaperone	NA	NA	NA	NA	NA
VEC45898.1|4672639_4673002_-	Putative excisionase	NA	NA	NA	NA	NA
VEC45899.1|4673422_4673686_+|transposase	putative transposase	transposase	NA	NA	NA	NA
>prophage 12
LR134222	Escherichia coli strain NCTC11129 genome assembly, chromosome: 1	5008027	4685336	4760185	5008027	capsid,transposase,tail,plate,protease	Escherichia_phage(50.98%)	88	NA	NA
VEC45909.1|4685336_4685840_+|transposase	transposase	transposase	NA	NA	NA	NA
VEC45910.1|4685746_4686094_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	89.6	6.5e-58
VEC45911.1|4686090_4686768_-|transposase	transposase, IS903.B	transposase	Q9MCT5	Escherichia_phage	91.9	2.7e-116
VEC45912.1|4687086_4688091_+|transposase	IS5075 transposase	transposase	NA	NA	NA	NA
VEC45913.1|4688272_4688839_-	Protein of uncharacterised function (DUF2913)	NA	NA	NA	NA	NA
VEC45914.1|4689296_4689551_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45915.1|4690079_4691813_-	glutathione transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.1e-15
VEC45916.1|4691820_4692768_-	Formamidase	NA	NA	NA	NA	NA
VEC45917.1|4692812_4694420_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEC45918.1|4694429_4695350_-	ABC transporter permease	NA	NA	NA	NA	NA
VEC45919.1|4695349_4696198_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
VEC45920.1|4696194_4696788_-	Response regulator of citrate/malate metabolism	NA	NA	NA	NA	NA
VEC45921.1|4696784_4697912_-	Aliphatic amidase expression-regulating protein	NA	NA	NA	NA	NA
VEC45922.1|4698277_4698505_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45923.1|4699364_4700210_+|transposase	IS621, transposase	transposase	A0A1S7J231	Thermus_phage	28.9	1.4e-16
VEC45924.1|4700212_4701364_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VEC45925.1|4701320_4701677_-|transposase	transposase IS3/IS911 family protein	transposase	U5P4I9	Shigella_phage	92.5	5.7e-33
VEC45926.1|4702009_4702750_+	putative recombinase	NA	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
VEC45927.1|4703447_4704458_-	putative RepFIB replication protein A	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
VEC45928.1|4705208_4705307_+	plasmid partition protein SopA	NA	NA	NA	NA	NA
VEC45929.1|4705340_4705616_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	1.3e-45
VEC45930.1|4705660_4706038_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEC45931.1|4706039_4707152_+	plasmid partition protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	98.1	7.4e-212
VEC45932.1|4707151_4708123_+	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	1.0e-148
VEC45933.1|4709371_4709749_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEC45934.1|4709793_4710069_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VEC45935.1|4710269_4710782_-	plasmid transfer protein	NA	NA	NA	NA	NA
VEC45936.1|4710784_4711315_-	plasmid transfer protein	NA	NA	NA	NA	NA
VEC45937.1|4712341_4712827_+	plasmid transfer protein	NA	NA	NA	NA	NA
VEC45938.1|4712823_4713546_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45939.1|4713556_4713994_+	conjugative transfer system protein	NA	NA	NA	NA	NA
VEC45940.1|4714027_4714303_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
VEC45941.1|4714347_4714725_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEC45942.1|4714824_4715346_+	putative antirepressor	NA	A0A077SLI1	Escherichia_phage	97.7	1.7e-86
VEC45943.1|4715509_4716310_+	putative host killing protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
VEC45944.1|4716375_4717185_+	putative lytic replication protein	NA	Q1MVK3	Enterobacteria_phage	97.0	2.6e-142
VEC45945.1|4717752_4718865_+|transposase	IS186, transposase	transposase	NA	NA	NA	NA
VEC45946.1|4718887_4719028_+|transposase	transposase	transposase	NA	NA	NA	NA
VEC45947.1|4719140_4719650_-|plate	putative baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
VEC45948.1|4719661_4720126_-	putative morphogenetic protein	NA	Q1MVJ8	Enterobacteria_phage	94.2	1.1e-76
VEC45949.1|4720278_4721094_-|tail	tail tube protein	tail	A0A1B0V835	Salmonella_phage	98.9	2.4e-111
VEC45950.1|4721103_4722693_-|tail	tail sheath protein	tail	A0A1B0V7E4	Salmonella_phage	98.3	2.2e-302
VEC45951.1|4722752_4724459_-|capsid	major capsid protein	capsid	Q71TM1	Escherichia_phage	99.6	0.0e+00
VEC45952.1|4724723_4725689_-	partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	100.0	3.3e-168
VEC45953.1|4725685_4726891_-	putative partitioning protein A	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
VEC45954.1|4727290_4728151_-	putative RepFIB replication protein A	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
VEC45955.1|4728848_4729124_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
VEC45956.1|4729168_4729546_+	IS1 protein InsB	NA	Q71TF0	Escherichia_phage	95.2	3.9e-64
VEC45957.1|4729624_4729900_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	1.3e-45
VEC45958.1|4729944_4730322_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.4	1.1e-66
VEC45959.1|4730426_4730651_+	component of RNA polymerase	NA	A0A248SJA5	Salicola_phage	61.1	5.2e-08
VEC45960.1|4730702_4731509_-	Linocin-M18	NA	NA	NA	NA	NA
VEC45961.1|4731510_4732566_-	putative peroxidase	NA	NA	NA	NA	NA
VEC45962.1|4732659_4733436_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	29.3	2.0e-14
VEC45963.1|4733575_4733851_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	1.3e-45
VEC45964.1|4733895_4734273_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEC45965.1|4734299_4734668_+	putative binding protein	NA	NA	NA	NA	NA
VEC45966.1|4734762_4737828_-	putative molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	26.0	3.6e-06
VEC45967.1|4737820_4738843_-	polysulfide reductase-like protein	NA	NA	NA	NA	NA
VEC45968.1|4738843_4739578_-	putative molybdopterin oxidoreductase family protein	NA	A0A077SL61	Escherichia_phage	40.0	8.5e-23
VEC45969.1|4739757_4741539_+	putative sensor protein	NA	NA	NA	NA	NA
VEC45970.1|4741513_4742098_+	putative response regulator protein	NA	NA	NA	NA	NA
VEC45971.1|4742190_4742394_+	protein	NA	NA	NA	NA	NA
VEC45972.1|4742502_4743483_-|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	100.0	5.5e-187
VEC45973.1|4743566_4744085_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45974.1|4744219_4744597_-	IS1 protein InsB	NA	Q71TF0	Escherichia_phage	94.4	1.1e-63
VEC45975.1|4744641_4744917_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
VEC45976.1|4745041_4746142_+	cellulose synthase regulator protein	NA	NA	NA	NA	NA
VEC45977.1|4746146_4746803_+|transposase	IS2 insertion element transposase InsAB'	transposase	Q9ZXG3	Shigella_phage	95.9	9.3e-122
VEC45978.1|4747456_4747672_-	Insertion element protein	NA	NA	NA	NA	NA
VEC45979.1|4748055_4748553_-|transposase	IS30 transposase	transposase	NA	NA	NA	NA
VEC45980.1|4748509_4748878_-	CP4-6 prophage; partial regulator of insertion element IS911A	NA	Q716C1	Shigella_phage	96.6	8.0e-38
VEC45981.1|4749003_4749168_+	defense against restriction protein	NA	A0A077SK04	Escherichia_phage	98.1	1.3e-24
VEC45982.1|4749201_4749642_+	Uncharacterised protein	NA	A0A077SLF0	Escherichia_phage	98.6	1.1e-78
VEC45983.1|4749638_4749887_+	regulatory protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
VEC45984.1|4749925_4750717_-	HTH-type transcriptional regulator YdeO	NA	NA	NA	NA	NA
VEC45985.1|4750718_4751699_+|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	100.0	5.5e-187
VEC45986.1|4751881_4752034_+	EAL domain-containing protein	NA	NA	NA	NA	NA
VEC45987.1|4752023_4752572_+	EAL domain-containing protein	NA	NA	NA	NA	NA
VEC45988.1|4752625_4753270_-	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	85.8	6.6e-96
VEC45989.1|4753561_4754065_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC45990.1|4754257_4754533_-	putative lysogeny establishment protein	NA	Q5XLQ4	Enterobacteria_phage	94.5	1.0e-37
VEC45991.1|4754619_4755651_-	cyclization recombinase	NA	Q71TG5	Escherichia_phage	99.1	1.1e-193
VEC45992.1|4755658_4755880_-	putative cre associated regulatory protein	NA	Q5QBN7	Enterobacteria_phage	98.6	1.3e-35
VEC45993.1|4756144_4757170_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
VEC45994.1|4757366_4758221_+	cell division protein	NA	NA	NA	NA	NA
VEC45995.1|4758313_4758844_+|protease	ATP-dependent hslVU protease peptidase subunit HslV	protease	NA	NA	NA	NA
VEC45996.1|4758853_4760185_+|protease	ATP-dependent hslVU protease ATP-binding subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
