The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134214	Escherichia coli strain NCTC11104 genome assembly, chromosome: 1	4694654	626534	698505	4694654	tail,plate,capsid,terminase,tRNA	Erwinia_phage(25.53%)	83	NA	NA
VEC15288.1|626534_626867_+|tRNA	putative tRNA-binding protein	tRNA	NA	NA	NA	NA
VEC15289.1|626944_628420_-	putrescine--2-oxoglutarate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	3.7e-33
VEC15290.1|628754_630275_+	aerotaxis receptor protein	NA	A0A1B0V854	Salmonella_phage	49.3	1.1e-32
VEC15291.1|630328_631006_-	transcriptional regulator	NA	NA	NA	NA	NA
VEC15292.1|631242_631593_+	siderophore-interacting protein	NA	NA	NA	NA	NA
VEC15293.1|631582_632014_+	siderophore-interacting protein	NA	NA	NA	NA	NA
VEC15294.1|632014_632131_-	DNA gyrase inhibitor	NA	NA	NA	NA	NA
VEC15295.1|632130_632538_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC15296.1|632626_632860_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC15297.1|632987_634082_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.3	1.7e-83
VEC15298.1|634307_635966_-	dihydroxyacetone kinase	NA	NA	NA	NA	NA
VEC15299.1|636279_636498_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC15300.1|636527_637625_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
VEC15301.1|637715_639641_+	putative glycerol operon regulatory protein DhaR	NA	NA	NA	NA	NA
VEC15302.1|639618_640149_-	putative B12 related propanediol dehydrogenase protein	NA	NA	NA	NA	NA
VEC15303.1|640149_640503_-	putative diol/glycerol dehydratase reactivating factor	NA	NA	NA	NA	NA
VEC15304.1|640519_641683_-	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
VEC15305.1|641705_642134_-	putative protein GlcG	NA	NA	NA	NA	NA
VEC15306.1|642526_644194_+	glycerol dehydratase	NA	NA	NA	NA	NA
VEC15307.1|644205_644790_+	glycerol dehydratase beta subunit	NA	NA	NA	NA	NA
VEC15308.1|644792_645221_+	glycerol dehydratase small subunit	NA	NA	NA	NA	NA
VEC15309.1|645231_647046_+	diol/glycerol dehydratase reactivating factor	NA	NA	NA	NA	NA
VEC15310.1|647179_647479_+	protein	NA	NA	NA	NA	NA
VEC15311.1|647857_648901_-	Integrase from bacteriophage origin	NA	A0A218M4I3	Erwinia_phage	96.8	6.3e-197
VEC15312.1|648900_649488_-	repressor protein from bacteriophage origin	NA	A0A218M4J1	Erwinia_phage	58.5	2.2e-61
VEC15313.1|649622_649886_+	putative phage regulatory protein	NA	A0A218M4I5	Erwinia_phage	72.4	7.4e-30
VEC15314.1|649916_650426_+	phage regulatory protein CII	NA	Q6K1F8	Salmonella_virus	86.4	9.9e-79
VEC15315.1|650433_650661_+	Protein of uncharacterised function (DUF2724)	NA	A0A0M4RTI3	Salmonella_phage	93.3	1.7e-35
VEC15316.1|650647_650848_+	Uncharacterised protein	NA	A0A0M5M7U3	Salmonella_phage	90.9	1.4e-28
VEC15317.1|650917_651145_+	Protein of uncharacterised function (DUF2732)	NA	A0A218M4I9	Erwinia_phage	77.3	1.7e-22
VEC15318.1|651144_651366_+	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	83.6	3.4e-28
VEC15319.1|651460_653584_+	replication gene A protein from bacteriophage origin	NA	A0A218M4H2	Erwinia_phage	94.1	0.0e+00
VEC15320.1|653702_653894_+	Uncharacterised protein	NA	A0A218M4I0	Erwinia_phage	81.5	2.3e-17
VEC15321.1|654033_654972_+	HsdRM	NA	Q7Y4B5	Escherichia_virus	85.2	2.2e-161
VEC15322.1|654968_655898_-	Uncharacterised protein	NA	Q7Y4B4	Escherichia_virus	48.2	1.3e-89
VEC15323.1|655897_656977_-	ParB/RepB/Spo0J family partition protein	NA	Q7Y4B3	Escherichia_virus	64.2	3.8e-128
VEC15324.1|657380_658418_-|capsid	phage capsid protein	capsid	Q6K1J0	Salmonella_virus	79.3	1.2e-163
VEC15325.1|658417_660187_-	Terminase, ATPase subunit (GpP)	NA	A0A0M4RE51	Salmonella_phage	80.6	2.9e-287
VEC15326.1|660351_661215_+|capsid	phage capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	65.9	2.4e-101
VEC15327.1|661246_662407_+|capsid	major capsid protein	capsid	A0A0M4R4W2	Salmonella_phage	62.5	3.7e-129
VEC15328.1|662410_663169_+|terminase	small terminase subunit	terminase	Q94MJ2	Enterobacteria_phage	66.7	1.3e-79
VEC15329.1|663266_663767_+|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
VEC15330.1|663766_663970_+|tail	phage tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
VEC15331.1|663960_664182_+	Uncharacterised protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
VEC15332.1|664165_664675_+	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	83.2	1.6e-76
VEC15333.1|664671_665085_+	LysB protein	NA	O80310	Escherichia_phage	59.9	1.9e-35
VEC15334.1|665192_665660_+|tail	tail protein	tail	U5N0S7	Enterobacteria_phage	70.3	9.7e-57
VEC15335.1|665652_666102_+|tail	tail protein	tail	O80313	Escherichia_phage	69.4	1.7e-50
VEC15336.1|666170_666812_+|plate	Baseplate assembly protein V (GpV)	plate	A0A0M4S6F6	Salmonella_phage	80.8	2.0e-92
VEC15337.1|666808_667156_+|plate	phage baseplate protein	plate	A0A0F7LDQ1	Escherichia_phage	70.4	2.8e-40
VEC15338.1|667160_668069_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	80.8	9.5e-133
VEC15339.1|668061_668673_+|tail	phage P2-related tail formation protein	tail	A0A218M4J3	Erwinia_phage	83.6	6.3e-96
VEC15340.1|668669_670127_+|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	75.6	3.8e-107
VEC15341.1|670126_670462_+|tail	tail fiber assembly protein	tail	E7EKV7	Edwardsiella_phage	37.4	2.3e-07
VEC15342.1|670569_670992_-|tail	putative tail fiber assembly protein from bacteriophage origin	tail	A0A1B0V844	Salmonella_phage	49.3	1.5e-27
VEC15343.1|670994_671912_-|tail	Putative phage tail fiber protein	tail	A0A1B0V7G4	Salmonella_phage	66.7	4.2e-120
VEC15344.1|672037_672616_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	80.8	3.5e-80
VEC15345.1|672680_673868_+|tail	tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.5	2.5e-189
VEC15346.1|673880_674399_+|tail	tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	1.0e-70
VEC15347.1|674461_674743_+|tail	tail protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
VEC15348.1|674887_677317_+|tail	tail length tape measure protein	tail	Q858U7	Yersinia_virus	68.3	2.1e-272
VEC15349.1|677328_677793_+|tail	tail fiber protein	tail	A0A0F7LBX3	Escherichia_phage	75.5	5.9e-62
VEC15350.1|677795_678989_+	late gene regulator	NA	Q6K1G4	Salmonella_virus	78.6	2.7e-167
VEC15351.1|679605_680112_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
VEC15352.1|680157_682005_-	RNA polymerase	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
VEC15353.1|682364_684110_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
VEC15354.1|684347_684563_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
VEC15355.1|684799_685813_+	O-sialoglycoprotein endopeptidase	NA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
VEC15356.1|685900_686518_-	urease accessory protein UreG	NA	NA	NA	NA	NA
VEC15357.1|686527_687199_-	urease accessory protein UreF	NA	NA	NA	NA	NA
VEC15358.1|687198_687657_-	urease accessory protein UreE	NA	NA	NA	NA	NA
VEC15359.1|687666_689370_-	urease alpha subunit UreC	NA	NA	NA	NA	NA
VEC15360.1|689362_689683_-	urease beta subunit UreB	NA	NA	NA	NA	NA
VEC15361.1|689692_689995_-	urease gamma subunit UreA	NA	NA	NA	NA	NA
VEC15362.1|690005_690746_-	urease-associated protein	NA	NA	NA	NA	NA
VEC15363.1|690953_692417_-	putative tartrate carrier protein	NA	NA	NA	NA	NA
VEC15364.1|692465_693071_-	L-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
VEC15365.1|693067_693976_-	L-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
VEC15366.1|694189_695131_+	transcriptional activator TtdR	NA	NA	NA	NA	NA
VEC15367.1|695162_695780_-	glycerol-3-phosphate acyltransferase PlsY	NA	NA	NA	NA	NA
VEC15368.1|695886_696255_+	bifunctional dihydroneopterin aldolase/dihydroneopterin triphosphate 2'-epimerase	NA	NA	NA	NA	NA
VEC15369.1|696341_697160_+	undecaprenyl pyrophosphate phosphatase	NA	NA	NA	NA	NA
VEC15370.1|697269_698505_-|tRNA	multifunctional Cca protein [includes: tRNA nucleotidyltransferase; 2'-nucleotidase; 2',3'-cyclic phosphodiesterase; phosphatase]	tRNA	A0A0F6YPT7	Sinorhizobium_phage	48.0	1.7e-92
>prophage 2
LR134214	Escherichia coli strain NCTC11104 genome assembly, chromosome: 1	4694654	1075611	1099163	4694654	integrase,transposase	Stx2-converting_phage(37.5%)	20	1090737:1090749	1100898:1100910
VEC15725.1|1075611_1075887_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEC15726.1|1075931_1076309_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEC15727.1|1076319_1077039_-	SNF2 family helicase	NA	NA	NA	NA	NA
VEC15728.1|1077134_1077515_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	88.9	3.6e-57
VEC15729.1|1077511_1077859_+	prophage CP-933O IS protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	5.3e-60
VEC15730.1|1077908_1079447_+|transposase	putative transposase ORF 1, IS66 family	transposase	A0A0P0ZBS5	Stx2-converting_phage	90.2	9.1e-269
VEC15731.1|1079878_1081525_-	glucosephosphate isomerase	NA	NA	NA	NA	NA
VEC15732.1|1081789_1084462_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
VEC15733.1|1084709_1085867_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.3	8.9e-51
VEC15734.1|1085924_1087253_-	D-galactonate transporter	NA	NA	NA	NA	NA
VEC15735.1|1087377_1088883_-	xylulose kinase	NA	NA	NA	NA	NA
VEC15736.1|1088904_1089945_-	threonine 3-dehydrogenase NAD(P)-binding protein	NA	NA	NA	NA	NA
VEC15737.1|1089975_1090785_-	putative aldolase	NA	NA	NA	NA	NA
1090737:1090749	attL	ATTTTTTATTTAA	NA	NA	NA	NA
VEC15738.1|1090816_1091782_-	Phosphoglycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.6	3.5e-32
VEC15739.1|1093098_1094307_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	51.3	1.9e-51
VEC15740.1|1094399_1095020_-	CP4-6 prophage protein	NA	NA	NA	NA	NA
VEC15741.1|1095261_1096659_-	CP4-57 prophage protein	NA	NA	NA	NA	NA
VEC15742.1|1096781_1096994_-	CP4-57 prophage; DNA-binding transcriptional activator	NA	NA	NA	NA	NA
VEC15743.1|1097119_1097998_+	CP4-57 prophage protein	NA	NA	NA	NA	NA
VEC15744.1|1098056_1099163_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	42.2	3.4e-84
1100898:1100910	attR	ATTTTTTATTTAA	NA	NA	NA	NA
>prophage 3
LR134214	Escherichia coli strain NCTC11104 genome assembly, chromosome: 1	4694654	1396650	1405408	4694654	transposase	Enterobacteria_phage(28.57%)	11	NA	NA
VEC16006.1|1396650_1398549_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.1e-13
VEC16007.1|1398735_1399368_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VEC16008.1|1399502_1399703_-	response regulator inhibitor for tor operon	NA	K7P7V0	Enterobacteria_phage	83.3	3.4e-27
VEC16009.1|1400039_1400279_-	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	43.6	3.3e-08
VEC16010.1|1400241_1400604_-	putative protein ninx	NA	G8C7S4	Escherichia_phage	90.3	1.3e-53
VEC16011.1|1400803_1401214_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16012.1|1401210_1401510_+	Uncharacterised protein	NA	E7EKU6	Edwardsiella_phage	44.9	1.3e-09
VEC16013.1|1401506_1401674_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16014.1|1401737_1402286_-|transposase	IS1400 transposase B	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	2.4e-06
VEC16015.1|1403004_1404492_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16016.1|1404478_1405408_-	bactoprenol glucosyl transferase; CPS-53 (KpLE1) prophage	NA	I1TED8	Salmonella_phage	89.4	6.3e-156
>prophage 4
LR134214	Escherichia coli strain NCTC11104 genome assembly, chromosome: 1	4694654	1620345	1628972	4694654	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
VEC16210.1|1620345_1621293_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.3	1.3e-07
VEC16211.1|1621276_1622008_+	ABC transporter permease	NA	NA	NA	NA	NA
VEC16212.1|1621988_1622096_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEC16213.1|1622355_1623087_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
VEC16214.1|1623312_1624998_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
VEC16215.1|1624994_1625714_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEC16216.1|1625760_1626231_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	77.4	1.8e-63
VEC16217.1|1626274_1626733_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	69.3	2.1e-51
VEC16218.1|1626938_1628972_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	5.2e-54
>prophage 5
LR134214	Escherichia coli strain NCTC11104 genome assembly, chromosome: 1	4694654	1667366	1676935	4694654	protease	Bacillus_phage(28.57%)	8	NA	NA
VEC16256.1|1667366_1669313_+	macrolide export ATP-binding/permease protein	NA	G9BWD6	Planktothrix_phage	41.8	1.4e-40
VEC16257.1|1669387_1669612_-	stationary phase/starvation inducible regulatory protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
VEC16258.1|1669935_1670256_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
VEC16259.1|1670286_1672563_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
VEC16260.1|1672831_1674193_-|protease	putative protease	protease	Q6DW11	Phage_TP	92.9	1.8e-204
VEC16261.1|1674352_1674685_-	protein	NA	NA	NA	NA	NA
VEC16262.1|1674812_1675535_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
VEC16263.1|1675531_1676935_-	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	29.2	2.3e-32
>prophage 6
LR134214	Escherichia coli strain NCTC11104 genome assembly, chromosome: 1	4694654	1796384	1837230	4694654	protease,tail,plate,head,integrase,terminase	Escherichia_phage(17.65%)	49	1789617:1789634	1801949:1801966
1789617:1789634	attL	GGCTGCCAATATGACGCG	NA	NA	NA	NA
VEC16375.1|1796384_1797680_-|integrase	integrase from prophage	integrase	A0A192Y7M7	Salmonella_phage	55.8	1.3e-98
VEC16376.1|1797715_1800187_-	exonuclease family protein	NA	K7P6V4	Enterobacteria_phage	38.3	8.1e-110
VEC16377.1|1800328_1800655_-	FeS cluster assembly transcription factor IscR	NA	NA	NA	NA	NA
VEC16378.1|1801147_1801528_-	regulator	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
VEC16379.1|1801633_1801846_+	putative repressor protein from phage	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
VEC16380.1|1801849_1802404_+	regulatory protein CII	NA	NA	NA	NA	NA
1801949:1801966	attR	CGCGTCATATTGGCAGCC	NA	NA	NA	NA
VEC16381.1|1802452_1803568_+	replication protein	NA	A0A0U2RT81	Escherichia_phage	54.5	4.0e-48
VEC16382.1|1804148_1804502_+	DNA-binding transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
VEC16383.1|1804549_1804912_+	arsenical resistance operon trans-acting repressor	NA	NA	NA	NA	NA
VEC16384.1|1804929_1806681_+	Arsenical pump-driving ATPase	NA	NA	NA	NA	NA
VEC16385.1|1806727_1808017_+	arsenical pump membrane protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.5	7.8e-173
VEC16386.1|1808029_1808455_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
VEC16387.1|1808521_1808818_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
VEC16388.1|1808918_1810010_+	putative permease	NA	NA	NA	NA	NA
VEC16389.1|1810292_1810526_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	81.8	1.0e-30
VEC16390.1|1810571_1810817_+	Uncharacterised protein	NA	H6WRY6	Salmonella_phage	60.8	2.9e-20
VEC16391.1|1810946_1811147_+	putative prophage protein	NA	H6WRY8	Salmonella_phage	61.5	1.9e-17
VEC16392.1|1811149_1811509_+	Holliday junction resolvase	NA	G8C7V6	Escherichia_phage	64.4	4.0e-42
VEC16393.1|1811505_1812546_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	50.6	7.4e-97
VEC16394.1|1812559_1813165_+	Uncharacterised protein	NA	H9C175	Pectobacterium_phage	72.6	1.1e-81
VEC16395.1|1813476_1813851_-	Qin prophage protein	NA	NA	NA	NA	NA
VEC16396.1|1814615_1814894_+	Uncharacterised protein	NA	K7P6H9	Enterobacteria_phage	97.8	2.5e-44
VEC16397.1|1814865_1815414_+	membrane-associated lysozyme; Qin prophage	NA	K7PM52	Enterobacteria_phage	96.2	2.2e-100
VEC16398.1|1815410_1815926_+	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	38.8	2.4e-08
VEC16399.1|1816024_1816453_+	inhibitor of vertebrate lysozyme precursor	NA	NA	NA	NA	NA
VEC16400.1|1816784_1817216_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16401.1|1817611_1818118_+|terminase	bacteriophage DNA packaging protein; terminase, small subunit	terminase	K7PJY2	Enterobacterial_phage	64.3	1.4e-48
VEC16402.1|1818121_1820239_+|terminase	DNA packaging protein of prophage (terminase large subunit)	terminase	A0A291AWY5	Escherichia_phage	70.6	6.8e-307
VEC16403.1|1820235_1820451_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16404.1|1820459_1821971_+|head,tail	head-tail preconnector protein from phage origin	head,tail	K7PHM5	Enterobacterial_phage	55.7	1.7e-155
VEC16405.1|1821927_1822137_+|protease	ATP-dependent Clp protease proteolytic subunit (Endopeptidase Clp) of prophage	protease	NA	NA	NA	NA
VEC16406.1|1822242_1824027_+|protease	ATP-dependent Clp protease proteolytic subunit (Endopeptidase Clp) of prophage	protease	S5M7Q8	Escherichia_phage	53.2	2.3e-175
VEC16407.1|1824099_1824435_+	hypothetical membrane protein from phage origin	NA	Q9EYD5	Enterobacteria_phage	46.4	1.2e-13
VEC16408.1|1824434_1824791_+	Phage Head-Tail Attachment	NA	NA	NA	NA	NA
VEC16409.1|1824792_1825449_+	Uncharacterised protein	NA	R9TR34	Vibrio_phage	34.0	5.1e-19
VEC16410.1|1825460_1826015_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16411.1|1826007_1826625_+|plate	Baseplate assembly protein V (GpV)	plate	Q9JML8	Wolbachia_phage	36.2	3.0e-13
VEC16412.1|1826663_1828133_+|tail	major tail sheath protein	tail	R9TMQ0	Vibrio_phage	37.3	5.0e-75
VEC16413.1|1828129_1828636_+|tail	major tail tube protein	tail	NA	NA	NA	NA
VEC16414.1|1828694_1828994_+	Uncharacterised protein	NA	Q75QK8	Wolbachia_phage	31.6	7.2e-05
VEC16415.1|1829096_1831022_+	Uncharacterised protein	NA	A0A2I7R3J9	Vibrio_phage	35.4	9.3e-29
VEC16416.1|1831018_1831489_+|tail	Phage-related tail protein	tail	V5YTC2	Pseudomonas_phage	40.6	1.6e-19
VEC16417.1|1831463_1831679_+|tail	tail protein X	tail	NA	NA	NA	NA
VEC16418.1|1831680_1832799_+	Phage late control gene D protein	NA	R9TNM7	Vibrio_phage	33.1	9.6e-34
VEC16419.1|1832838_1833192_+|plate	baseplate assembly protein W	plate	R9TRM1	Vibrio_phage	54.1	6.5e-21
VEC16420.1|1833175_1834096_+|plate	Baseplate assembly protein J (GpJ)	plate	A0A088FQL4	Escherichia_phage	48.8	5.0e-65
VEC16421.1|1834085_1834649_+|tail	tail protein I	tail	Q7Y4D5	Escherichia_virus	37.3	1.1e-25
VEC16422.1|1834641_1836687_+|tail	tail fiber protein (fragment)	tail	J9Q6E3	Salmonella_phage	46.4	5.9e-82
VEC16423.1|1836690_1837230_+|tail	tail assembly chaperone gp38	tail	S4TUB9	Salmonella_phage	49.4	9.9e-37
>prophage 7
LR134214	Escherichia coli strain NCTC11104 genome assembly, chromosome: 1	4694654	1946082	2031357	4694654	protease,tail,head,integrase,portal,transposase,terminase	Enterobacteria_phage(46.3%)	94	1951818:1951848	1997848:1997878
VEC16542.1|1946082_1948161_+|protease	protease II	protease	F2Y2Z7	Organic_Lake_phycodnavirus	36.3	6.3e-31
VEC16543.1|1948151_1948814_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
VEC16544.1|1948837_1949494_-	putative carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
VEC16545.1|1949600_1949831_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	3.5e-15
VEC16546.1|1949974_1950349_+	putative copper resistance protein	NA	NA	NA	NA	NA
VEC16547.1|1950352_1951225_+	putative copper resistance protein	NA	NA	NA	NA	NA
VEC16548.1|1951245_1951584_+	protein	NA	NA	NA	NA	NA
1951818:1951848	attL	ACAGGAATCGTATTCGGTCTCTTTTTATGTG	NA	NA	NA	NA
VEC16549.1|1951920_1953006_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	69.0	7.3e-148
VEC16550.1|1952974_1953247_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	5.5e-28
VEC16551.1|1953311_1953554_-	Uncharacterised protein	NA	K7PHF4	Enterobacteria_phage	88.6	1.1e-32
VEC16552.1|1953593_1954634_-	enterohemolysin 1	NA	K7PKR8	Enterobacteria_phage	76.2	2.7e-155
VEC16553.1|1954648_1957969_-	putative phage exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	76.2	0.0e+00
VEC16554.1|1958108_1958270_-	Uncharacterised protein	NA	K7PGY4	Enterobacteria_phage	96.2	1.8e-23
VEC16555.1|1958281_1958578_-	prophage Kil protein	NA	K7PM31	Enterobacteria_phage	98.5	8.1e-33
VEC16556.1|1958864_1959059_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16557.1|1959087_1959906_-	Protein of uncharacterised function (DUF3037)	NA	NA	NA	NA	NA
VEC16558.1|1959902_1960640_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16559.1|1960884_1961271_-	regulator	NA	A0A0M4R5D1	Salmonella_phage	87.3	9.8e-55
VEC16560.1|1961374_1961608_+	antirepressor protein Cro	NA	A0A0M4QX15	Salmonella_phage	90.9	1.2e-34
VEC16561.1|1961610_1962150_+	bacteriophage regulatory protein CII	NA	K7PJT7	Enterobacteria_phage	95.5	2.4e-91
VEC16562.1|1962317_1963265_+	putative phage replication protein	NA	G9L6A8	Escherichia_phage	30.3	1.1e-22
VEC16563.1|1963267_1964017_+	putative DNA replication factor encoded within prophage	NA	S4TNF5	Salmonella_phage	87.1	4.8e-122
VEC16564.1|1964035_1964347_+	ren protein from phage origin	NA	NA	NA	NA	NA
VEC16565.1|1964343_1964691_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16566.1|1964729_1965710_+|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	81.8	1.3e-156
VEC16567.1|1966112_1966484_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16568.1|1966485_1967241_+	Uncharacterised protein	NA	H6WRY1	Salmonella_phage	96.4	9.6e-147
VEC16569.1|1967251_1968100_+	Eaa protein	NA	K7P7E4	Enterobacteria_phage	56.5	4.4e-39
VEC16570.1|1968328_1968586_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16571.1|1968582_1968876_+	C-5 cytosine-specific DNA methylase	NA	K7PJT8	Enterobacteria_phage	94.5	8.6e-35
VEC16572.1|1969021_1969255_+	DNA-damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	98.7	6.6e-38
VEC16573.1|1969372_1969621_+	Uncharacterised protein	NA	K7PHG9	Enterobacteria_phage	98.8	8.0e-42
VEC16574.1|1969655_1970255_+	phage protein	NA	K7PKS6	Enterobacteria_phage	96.0	1.9e-105
VEC16575.1|1970254_1970998_+	NinG prophage family protein	NA	A0A0M4RU10	Salmonella_phage	63.4	3.8e-47
VEC16576.1|1970994_1971135_+	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	95.7	1.2e-18
VEC16577.1|1971131_1971962_+	phage antitermination protein	NA	K7PKS8	Enterobacteria_phage	98.9	1.6e-155
VEC16578.1|1972381_1972660_+	Uncharacterised protein	NA	K7P6H9	Enterobacteria_phage	98.9	1.1e-44
VEC16579.1|1972631_1973180_+	membrane-associated lysozyme; Qin prophage	NA	K7PM52	Enterobacteria_phage	96.2	8.4e-100
VEC16580.1|1973378_1973633_+	putative Rz1-like lipoprotein, Qin prophage	NA	NA	NA	NA	NA
VEC16581.1|1973769_1973898_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16582.1|1974165_1974369_+	Uncharacterised protein	NA	A0A1W6JPG4	Morganella_phage	62.9	2.6e-06
VEC16583.1|1974619_1975111_+|terminase	bacteriophage DNA packaging protein; terminase, small subunit	terminase	K7PJY2	Enterobacterial_phage	85.3	1.7e-67
VEC16584.1|1975110_1977213_+|terminase	DNA packaging protein of prophage (terminase large subunit)	terminase	K7PH52	Enterobacterial_phage	81.9	0.0e+00
VEC16585.1|1977203_1977425_+	prophage protein	NA	A5LH28	Enterobacteria_phage	80.0	1.8e-24
VEC16586.1|1977421_1978930_+|head,tail,portal	portal protein (head-tail preconnector protein) from prophage	head,tail,portal	K7PHM5	Enterobacterial_phage	86.3	6.0e-257
VEC16587.1|1978874_1980887_+|portal	phage portal protein, lambda family	portal	K7PKX4	Enterobacterial_phage	85.9	0.0e+00
VEC16588.1|1980978_1981305_+	hypothetical membrane protein from phage origin	NA	K7PJY3	Enterobacterial_phage	60.2	1.1e-30
VEC16589.1|1981297_1981573_+	prophage protein	NA	K7PH43	Enterobacteria_phage	61.5	1.5e-25
VEC16590.1|1981585_1982140_+|tail	minor tail protein	tail	K7P7A8	Enterobacteria_phage	77.9	4.8e-63
VEC16591.1|1982136_1982535_+|tail	Minor tail protein U	tail	K7PHM6	Enterobacterial_phage	62.0	3.4e-42
VEC16592.1|1982542_1983280_+|tail	Major tail protein V	tail	O64327	Escherichia_phage	67.3	8.1e-90
VEC16593.1|1983316_1983724_+|tail	phage minor tail protein	tail	K7PM17	Enterobacteria_phage	58.6	1.7e-25
VEC16594.1|1983774_1984053_+|tail	minor tail protein T	tail	K7PHE1	Enterobacteria_phage	66.3	1.8e-26
VEC16595.1|1984030_1986547_+|tail	tail component of prophage	tail	K7PKR0	Enterobacteria_phage	70.8	0.0e+00
VEC16596.1|1986550_1986898_+|tail	minor tail protein M	tail	K7PJT2	Enterobacteria_phage	69.6	4.0e-39
VEC16597.1|1986894_1987650_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	85.3	1.8e-129
VEC16598.1|1987651_1988362_+|tail	tail assembly protein K	tail	K7PGR2	Enterobacteria_phage	91.1	7.2e-136
VEC16599.1|1988856_1989447_+|tail	bacteriophage tail assembly protein I	tail	K7PH91	Enterobacterial_phage	87.2	1.2e-91
VEC16600.1|1989502_1992676_+	host specificity protein J	NA	K7P7G9	Enterobacteria_phage	86.8	0.0e+00
VEC16601.1|1993189_1993828_+	Uncharacterised protein	NA	A0A1X7QGJ8	Escherichia_phage	31.3	1.7e-11
VEC16602.1|1993900_1995226_+	Uncharacterised protein	NA	A0A1V0E5M2	Salmonella_phage	59.7	5.3e-140
VEC16603.1|1995867_1997334_+	putative signal transduction protein	NA	NA	NA	NA	NA
VEC16604.1|1997320_1997542_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC16605.1|1998026_1998668_+	serine/threonine protein phosphatase 1	NA	Q71TJ1	Escherichia_phage	50.2	2.3e-56
1997848:1997878	attR	ACAGGAATCGTATTCGGTCTCTTTTTATGTG	NA	NA	NA	NA
VEC16606.1|1998668_1998860_-	protein	NA	NA	NA	NA	NA
VEC16607.1|1998962_1999202_-	protein	NA	NA	NA	NA	NA
VEC16608.1|1999299_2000721_-	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
VEC16609.1|2000803_2003437_-	mce-like protein	NA	NA	NA	NA	NA
VEC16610.1|2003405_2004689_-	inner membrane protein	NA	NA	NA	NA	NA
VEC16611.1|2004817_2005315_+	putative signal transduction protein	NA	NA	NA	NA	NA
VEC16612.1|2005411_2006098_+	ProP effector protein	NA	NA	NA	NA	NA
VEC16613.1|2006117_2008166_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.7	6.1e-87
VEC16614.1|2008358_2009240_+	M48B family peptidase	NA	NA	NA	NA	NA
VEC16615.1|2009286_2010660_-	transporter	NA	NA	NA	NA	NA
VEC16616.1|2010834_2011626_+	IclR-family transcriptional regulator	NA	NA	NA	NA	NA
VEC16617.1|2011740_2011980_-	protein	NA	NA	NA	NA	NA
VEC16618.1|2012144_2012288_+	Protein mgrB-like protein precursor	NA	NA	NA	NA	NA
VEC16619.1|2012362_2012572_+	protein	NA	NA	NA	NA	NA
VEC16620.1|2013868_2015614_+	penicillin-binding protein dimerization domain protein	NA	NA	NA	NA	NA
VEC16621.1|2015677_2016487_+	ribosomal RNA large subunit methyltransferase A	NA	NA	NA	NA	NA
VEC16622.1|2016483_2017050_-	inner membrane protein	NA	NA	NA	NA	NA
VEC16623.1|2017483_2017942_-	inner membrane protein	NA	NA	NA	NA	NA
VEC16624.1|2018002_2018854_-	mannose-specific PTS system EIID component	NA	NA	NA	NA	NA
VEC16625.1|2018866_2019667_-	mannose-specific PTS system transporter subunit IIC	NA	NA	NA	NA	NA
VEC16626.1|2019725_2020688_-	mannose-specific PTS system EIIAB component	NA	NA	NA	NA	NA
VEC16627.1|2021147_2022707_+	membrane protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
VEC16628.1|2022713_2024315_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
VEC16629.1|2024445_2025810_-	L-serine deaminase 1	NA	NA	NA	NA	NA
VEC16630.1|2025993_2026572_-	NUDIX-family hydrolase	NA	NA	NA	NA	NA
VEC16631.1|2026575_2027937_-	para-aminobenzoate synthase component I	NA	S4VT78	Pandoravirus	32.3	8.9e-42
VEC16632.1|2028020_2028200_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEC16633.1|2028206_2028551_-	putative translation initiation inhibitor	NA	NA	NA	NA	NA
VEC16634.1|2028692_2030603_+	putative ATP-binding protein	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
VEC16635.1|2030661_2031357_+|protease	protease YeaZ	protease	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
>prophage 8
LR134214	Escherichia coli strain NCTC11104 genome assembly, chromosome: 1	4694654	2958092	3034396	4694654	protease,tail,head,portal,terminase,tRNA	Klebsiella_phage(33.33%)	76	NA	NA
VEC17538.1|2958092_2959853_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
VEC17539.1|2959813_2960440_+	3-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
VEC17540.1|2960547_2960715_-	ribosome modulation factor	NA	NA	NA	NA	NA
VEC17541.1|2960970_2961534_-	putative lipoprotein	NA	NA	NA	NA	NA
VEC17542.1|2961530_2963171_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
VEC17543.1|2963175_2964429_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
VEC17544.1|2964444_2966352_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	6.0e-52
VEC17545.1|2966364_2968473_-	putative RNA methylase	NA	NA	NA	NA	NA
VEC17546.1|2968571_2969678_+	putative 2Fe-2S iron-sulfur cluster binding protein	NA	NA	NA	NA	NA
VEC17547.1|2969674_2970217_-	protein	NA	NA	NA	NA	NA
VEC17548.1|2970382_2971393_-	dihydroorotate dehydrogenase 2	NA	NA	NA	NA	NA
VEC17549.1|2971636_2972212_+	FMN reductase (sulfate starvation-induced protein	NA	NA	NA	NA	NA
VEC17550.1|2972204_2973179_+	alkanesulfonate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VEC17551.1|2973175_2974321_+	alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
VEC17552.1|2974331_2975123_+	putative aliphatic sulfonates ABC transporter permease	NA	NA	NA	NA	NA
VEC17553.1|2975119_2975887_+	putative aliphatic sulfonates ABC transporter, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	2.0e-30
VEC17554.1|2975958_2978571_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.9	2.4e-19
VEC17555.1|2978996_2979245_+	virulence protein msgA	NA	K7P797	Enterobacteria_phage	94.7	6.8e-33
VEC17556.1|2979293_2979464_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17557.1|2979426_2979699_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17558.1|2980105_2980342_+	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	56.6	6.5e-17
VEC17559.1|2980361_2988944_-	Cellobiose phosphorylase	NA	NA	NA	NA	NA
VEC17560.1|2990148_2990376_+	Qin prophage protein	NA	NA	NA	NA	NA
VEC17561.1|2991112_2991229_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17562.1|2991694_2991916_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17563.1|2991915_2992500_-|tail	putative phage tail fiber protein	tail	Q7BQC6	Enterobacteria_phage	46.6	8.8e-47
VEC17564.1|2992511_2994479_-|tail	tail fiber protein (modular protein)	tail	Q687E6	Enterobacteria_phage	55.3	4.2e-24
VEC17565.1|2994643_2995243_-	putative prophage-encoded outer membrane protein	NA	A0A291AWV3	Escherichia_phage	67.8	2.7e-75
VEC17566.1|2995307_2998688_-	host specificity protein	NA	A0A0K2FI38	Escherichia_phage	71.9	0.0e+00
VEC17567.1|2998760_2999303_-|tail	putative tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	73.2	3.6e-55
VEC17568.1|2999335_3000070_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	78.3	5.5e-115
VEC17569.1|3000081_3000777_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	70.6	3.9e-94
VEC17570.1|3000785_3001118_-|tail	phage minor tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	5.3e-41
VEC17571.1|3001118_3001808_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	50.0	6.7e-38
VEC17572.1|3001855_3004150_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	64.4	6.6e-239
VEC17573.1|3004843_3005068_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17574.1|3005130_3005268_-	Uncharacterised protein	NA	Q6UAX0	Klebsiella_phage	91.9	6.2e-12
VEC17575.1|3005264_3005612_-	Uncharacterised protein	NA	Q7Y403	Yersinia_phage	76.5	2.9e-37
VEC17576.1|3005645_3006047_-	phage protein, HK97 gp10 family	NA	Q6UAX1	Klebsiella_phage	88.0	2.6e-58
VEC17577.1|3006043_3006433_-	Uncharacterised protein	NA	Q6UAX2	Klebsiella_phage	65.3	6.7e-43
VEC17578.1|3006401_3006752_-	Uncharacterised protein	NA	Q6UAX3	Klebsiella_phage	75.7	2.4e-44
VEC17579.1|3006748_3007066_-|head,tail	Phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.8e-39
VEC17580.1|3007176_3007425_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17581.1|3007522_3008809_-|head,protease	putative major head protein/prohead protease	head,protease	Q6UAX6	Klebsiella_phage	86.9	2.6e-208
VEC17582.1|3008882_3009803_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	80.7	7.1e-136
VEC17583.1|3009839_3011099_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.0	8.3e-220
VEC17584.1|3011098_3011278_-	prophage protein	NA	Q6UAX9	Klebsiella_phage	63.2	3.6e-12
VEC17585.1|3011271_3012993_-|terminase	phage terminase, large subunit	terminase	Q7Y413	Yersinia_phage	58.4	2.6e-192
VEC17586.1|3012992_3013307_-|terminase	phage terminase small subunit	terminase	A0A1J0GV10	Halomonas_phage	60.4	3.2e-27
VEC17587.1|3013677_3014040_-	putative phage endonuclease	NA	Q6UAS2	Klebsiella_phage	85.8	1.3e-56
VEC17588.1|3014317_3014857_+	cytochrome	NA	A0A0U2QLA7	Escherichia_phage	81.0	7.6e-45
VEC17589.1|3015209_3015383_-	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VEC17590.1|3016679_3017207_-	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	46.5	5.3e-11
VEC17591.1|3017203_3017752_-	membrane-associated lysozyme; Qin prophage	NA	K7PM52	Enterobacteria_phage	94.5	1.9e-99
VEC17592.1|3017723_3018002_-	Uncharacterised protein	NA	K7P6H9	Enterobacteria_phage	98.9	1.5e-44
VEC17593.1|3019195_3019366_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17594.1|3020544_3020757_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17595.1|3021067_3021904_-	prophage antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	76.8	1.1e-122
VEC17596.1|3021900_3022872_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	78.3	1.7e-148
VEC17597.1|3022868_3024056_-	helicase	NA	F1C598	Cronobacter_phage	84.8	6.5e-198
VEC17598.1|3024003_3024489_-	helicase	NA	F1C598	Cronobacter_phage	93.0	2.9e-64
VEC17599.1|3024915_3025209_-	Uncharacterised protein	NA	A0A286S2B5	Klebsiella_phage	78.8	4.1e-29
VEC17600.1|3025210_3025438_-	Cro	NA	A0A0N7C1T6	Escherichia_phage	54.3	7.9e-12
VEC17601.1|3025562_3026264_+	regulatory protein cI	NA	G8C7U1	Escherichia_phage	48.5	3.2e-51
VEC17602.1|3026455_3026677_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17603.1|3026737_3027022_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17604.1|3027118_3027466_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17605.1|3027455_3027695_+	Uncharacterised protein	NA	A0A286SGR4	Klebsiella_phage	81.7	1.8e-27
VEC17606.1|3027684_3028191_+	Uncharacterised protein	NA	F1C5A2	Cronobacter_phage	55.4	2.3e-51
VEC17607.1|3028209_3029073_+	antirepressor protein	NA	F1C5A3	Cronobacter_phage	78.0	1.1e-130
VEC17608.1|3029065_3029482_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17609.1|3029481_3029853_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC17610.1|3029836_3030094_+	putative excisionase	NA	S4TND0	Salmonella_phage	82.3	2.2e-34
VEC17611.1|3030138_3031431_+	Int protein	NA	S4TSP2	Salmonella_phage	95.8	1.7e-244
VEC17612.1|3031625_3032828_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
VEC17613.1|3032995_3034396_+|tRNA	asparaginyl-tRNA synthetase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
>prophage 9
LR134214	Escherichia coli strain NCTC11104 genome assembly, chromosome: 1	4694654	3076305	3087098	4694654	tRNA	Escherichia_phage(50.0%)	7	NA	NA
VEC17648.1|3076305_3076923_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	6.1e-75
VEC17649.1|3076933_3077368_-	anaerobic dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	55.0	8.0e-37
VEC17650.1|3077364_3079377_-	anaerobic dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	49.8	2.5e-173
VEC17651.1|3079613_3080906_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	4.3e-94
VEC17652.1|3080998_3082342_-	putative ATPase	NA	G3MBE0	Bacillus_virus	41.7	5.6e-81
VEC17653.1|3082352_3082964_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VEC17654.1|3083075_3087098_-	DNA-binding membrane protein	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
>prophage 10
LR134214	Escherichia coli strain NCTC11104 genome assembly, chromosome: 1	4694654	3647774	3684659	4694654	transposase	Escherichia_phage(25.0%)	34	NA	NA
VEC18167.1|3647774_3648050_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEC18168.1|3648094_3648472_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEC18169.1|3648557_3649004_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC18170.1|3649018_3649864_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC18171.1|3650236_3650713_-	putative cold-shock protein	NA	NA	NA	NA	NA
VEC18172.1|3650799_3651045_-	protein	NA	NA	NA	NA	NA
VEC18173.1|3651420_3652197_+	beta-lactamase fold protein	NA	NA	NA	NA	NA
VEC18174.1|3652215_3653166_+	arac-family transcriptional regulator	NA	NA	NA	NA	NA
VEC18175.1|3653162_3653825_-	trans-aconitate methyltransferase	NA	NA	NA	NA	NA
VEC18176.1|3653936_3655019_+	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	81.5	2.7e-158
VEC18177.1|3655140_3658218_+	beta-D-galactosidase	NA	L0N6M2	Herpes_simplex_virus	82.0	0.0e+00
VEC18178.1|3658275_3659529_+	lactose permease	NA	NA	NA	NA	NA
VEC18179.1|3659557_3660169_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
VEC18180.1|3660261_3662148_-	propionate--coA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.6	1.6e-52
VEC18181.1|3662188_3663640_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
VEC18182.1|3663679_3664849_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
VEC18183.1|3664928_3665810_-	methylisocitrate lyase	NA	NA	NA	NA	NA
VEC18184.1|3666065_3667676_+	propionate catabolism operon regulatory protein	NA	NA	NA	NA	NA
VEC18185.1|3667708_3667984_-	protein	NA	NA	NA	NA	NA
VEC18186.1|3668250_3668883_+	neutral amino-acid efflux system	NA	NA	NA	NA	NA
VEC18187.1|3668962_3670351_+	diguanylate cyclase YddV	NA	NA	NA	NA	NA
VEC18188.1|3670570_3671668_+	putative electron transport protein	NA	NA	NA	NA	NA
VEC18189.1|3671812_3672361_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC18190.1|3672921_3675012_-	ferrichrome outer membrane transporter	NA	NA	NA	NA	NA
VEC18191.1|3675151_3676135_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VEC18192.1|3676259_3677165_-	putative transcriptional regulator of glycine cleavage system	NA	Q6JIH3	Burkholderia_virus	26.3	1.4e-14
VEC18193.1|3677274_3677904_+	homoserine/homoserine lactone efflux protein	NA	NA	NA	NA	NA
VEC18194.1|3678005_3678242_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC18195.1|3678340_3678823_-	Protein of uncharacterised function (DUF2913)	NA	NA	NA	NA	NA
VEC18196.1|3678882_3679158_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEC18197.1|3679202_3679580_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEC18198.1|3680319_3682530_+	phosphoglycerol transferase I	NA	NA	NA	NA	NA
VEC18199.1|3683155_3683473_+|transposase	transposase	transposase	F6MIM4	Haemophilus_phage	70.6	1.0e-09
VEC18200.1|3684110_3684659_+|transposase	IS1400 transposase B	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	2.4e-06
