The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134210	Klebsiella aerogenes strain NCTC418 genome assembly, chromosome: 1	23197	2684	21922	23197	integrase	Escherichia_phage(30.43%)	25	5504:5519	20977:20992
VEC05125.1|2684_3776_+	Uncharacterised protein	NA	B5TAB2	Burkholderia_phage	43.3	7.5e-76
VEC05126.1|3788_4523_+	Uncharacterised protein	NA	NA	NA	NA	NA
5504:5519	attL	GCCTGATCGATAGCTG	NA	NA	NA	NA
VEC05127.1|5783_6155_+	DNA repair protein	NA	K7PGV5	Enterobacterial_phage	50.0	9.2e-26
VEC05128.1|6466_6793_+|integrase	integrase family protein	integrase	A0A2R2Z2Y0	Escherichia_phage	80.4	3.1e-41
VEC05129.1|6845_7187_+|integrase	integrase family protein	integrase	A0A2R2Z2Y0	Escherichia_phage	83.8	1.5e-46
VEC05130.1|7260_7638_+|integrase	integrase family protein	integrase	A0A2R2Z2Y0	Escherichia_phage	90.3	2.5e-63
VEC05131.1|8880_9402_-	Eaa prophage protein	NA	S4TSR6	Salmonella_phage	79.6	2.6e-42
VEC05132.1|9394_9595_-	Uncharacterised protein	NA	A0A1U8QWK2	Salmonella_phage	58.8	5.1e-07
VEC05133.1|9591_9831_-	Uncharacterised protein	NA	A0A2R2Z309	Escherichia_phage	83.5	2.3e-30
VEC05134.1|9823_10027_-	Uncharacterised protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.5e-30
VEC05135.1|10023_10809_-	PRTRC system ParB family protein	NA	A4JX52	Burkholderia_virus	50.6	7.6e-62
VEC05136.1|10808_11108_-	Uncharacterised protein	NA	K7PJS4	Enterobacterial_phage	45.7	1.0e-11
VEC05137.1|11195_12119_-	DNA recombinase	NA	S4TWL4	Salmonella_phage	63.5	7.7e-106
VEC05138.1|12399_12660_-	phage repressor	NA	A0A1I9KG86	Aeromonas_phage	54.7	4.8e-21
VEC05139.1|13374_13836_+	Uncharacterised protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
VEC05140.1|14242_14563_+	Uncharacterised protein	NA	H2DE83	Erwinia_phage	61.2	4.1e-30
VEC05141.1|15153_15819_+	DMT family permease	NA	A0A1C9II58	Salmonella_phage	69.1	1.6e-89
VEC05142.1|16161_16350_+	crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	75.8	1.7e-20
VEC05143.1|16464_17343_+	Putative cytoplasmic protein	NA	K7PJS6	Enterobacterial_phage	64.2	2.2e-102
VEC05144.1|17601_17811_+	Protein of uncharacterised function (DUF1133)	NA	NA	NA	NA	NA
VEC05145.1|19203_19437_+	Uncharacterised protein	NA	A0A1B2I9V6	Erwinia_phage	57.3	1.0e-14
VEC05146.1|20208_20430_+	putative prophage membrane protein	NA	G8C7V8	Escherichia_phage	75.3	4.3e-23
VEC05147.1|21148_21502_+	Phage endolysin	NA	Q858F0	Salmonella_phage	82.1	1.1e-52
20977:20992	attR	CAGCTATCGATCAGGC	NA	NA	NA	NA
VEC05148.1|21504_21780_+	Uncharacterised protein	NA	G8C7W1	Escherichia_phage	37.1	6.0e-06
VEC05149.1|21724_21922_+	Uncharacterised protein	NA	A0A286SGR9	Klebsiella_phage	94.8	2.7e-24
>prophage 1
LR134211	Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2	205331	17274	66067	205331	protease,tRNA,transposase	Shigella_phage(23.53%)	51	NA	NA
VEC05169.1|17274_18198_-|transposase	transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
VEC05170.1|18388_18667_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05171.1|18720_19494_-	Nuclease-related domain	NA	A0A2R2ZH57	Clostridioides_phage	49.3	5.1e-10
VEC05172.1|19496_20633_-|protease	Periplasmic serine proteases (ClpP class)	protease	G0YPK2	Erwinia_phage	32.2	5.7e-10
VEC05173.1|20641_21280_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05174.1|21545_22049_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	97.6	2.2e-91
VEC05175.1|23434_24085_-	Protein of uncharacterised function (DUF1173)	NA	NA	NA	NA	NA
VEC05176.1|24561_25056_+	ParB	NA	A0A0R6PHV6	Moraxella_phage	38.6	5.9e-20
VEC05177.1|25392_25791_+	global DNA-binding transcriptional dual regulator H-NS	NA	NA	NA	NA	NA
VEC05178.1|26108_26948_-	Methylglyoxal reductase, acetol producing / 2,5-diketo-D-gluconate reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	35.7	3.7e-46
VEC05179.1|26944_27424_-	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VEC05180.1|28424_30200_-	binding-protein-dependent transport system inner membrane protein	NA	NA	NA	NA	NA
VEC05181.1|30218_31745_-	Dipeptide-binding ABC transporter, periplasmic substrate-binding component (TC 3.A.1.5.2); Putative hemin-binding lipoprotein	NA	NA	NA	NA	NA
VEC05182.1|31755_33000_-	membrane protein	NA	NA	NA	NA	NA
VEC05183.1|33026_33860_-	nickel ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	1.1e-10
VEC05184.1|33856_34666_-	oligopeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	2.8e-11
VEC05185.1|34894_35569_-	hydantoinase/carbamoylase family amidase	NA	NA	NA	NA	NA
VEC05186.1|35970_36117_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05187.1|36150_36276_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05188.1|36279_36765_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05189.1|36861_37431_+	Transposase and inactivated derivatives	NA	NA	NA	NA	NA
VEC05190.1|38223_38724_-	transcriptional regulator	NA	NA	NA	NA	NA
VEC05191.1|38868_39270_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
VEC05192.1|39306_40527_+	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	NA	NA	NA	NA	NA
VEC05193.1|40586_40793_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05194.1|40795_42445_-	Ferrous iron transport protein B	NA	NA	NA	NA	NA
VEC05195.1|42455_43586_-	Thioredoxin reductase	NA	NA	NA	NA	NA
VEC05196.1|43656_43929_-|tRNA	Cysteinyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC05197.1|43980_44967_-|tRNA	Cysteinyl-tRNA synthetase	tRNA	F1C979	Terra1_virus	34.8	1.4e-44
VEC05198.1|44948_45038_-|tRNA	Cysteinyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC05199.1|45117_45570_-	Peroxide operon regulator	NA	NA	NA	NA	NA
VEC05200.1|45667_46867_+	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	NA	NA	NA	NA	NA
VEC05201.1|46937_47360_+	C4-type zinc finger protein, DksA/TraR family	NA	NA	NA	NA	NA
VEC05202.1|47423_48359_+	GTP cyclohydrolase I type 2	NA	NA	NA	NA	NA
VEC05203.1|48348_48909_+	Carbonic anhydrase, gamma class	NA	NA	NA	NA	NA
VEC05204.1|49038_49905_+	NADPH dependent preQ0 reductase	NA	A0A140B3P3	Vibrio_phage	25.2	1.4e-11
VEC05205.1|49921_50746_-	Protein of uncharacterised function (DUF1460)	NA	NA	NA	NA	NA
VEC05206.1|51175_52177_+|tRNA	Threonyl-tRNA synthetase	tRNA	A0A2K9L6B6	Tupanvirus	41.5	9.7e-54
VEC05207.1|52169_53021_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05208.1|53017_54364_+	Dihydroorotase	NA	NA	NA	NA	NA
VEC05209.1|54427_55450_+	Porphobilinogen synthase	NA	NA	NA	NA	NA
VEC05210.1|56015_56282_-|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	86.4	3.0e-39
VEC05211.1|56275_56830_-|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	81.4	8.5e-76
VEC05212.1|56877_57243_-|transposase	IS2 transposase orfA	transposase	Q76S41	Shigella_phage	95.0	2.9e-56
VEC05213.1|57663_58146_-	acetyltransferase	NA	NA	NA	NA	NA
VEC05214.1|58133_58400_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEC05215.1|58570_58888_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05216.1|58929_61899_-|transposase	TnpA transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
VEC05217.1|61901_62459_-	Resolvase for Tn21	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
VEC05218.1|62588_63665_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
VEC05219.1|63661_66067_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
>prophage 2
LR134211	Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2	205331	121487	170454	205331	transposase	Bacillus_phage(27.27%)	46	NA	NA
VEC05269.1|121487_122201_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
VEC05270.1|122214_122658_-	PilT protein domain-containing protein	NA	NA	NA	NA	NA
VEC05271.1|122654_122885_-	Virulence-associated protein vagC	NA	NA	NA	NA	NA
VEC05272.1|123492_124626_+	Protein of uncharacterised function (DUF3800)	NA	NA	NA	NA	NA
VEC05273.1|124641_124935_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05274.1|124924_125131_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05275.1|125482_125773_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05276.1|125762_126662_+	ABC-type sugar transport system, periplasmic component	NA	NA	NA	NA	NA
VEC05277.1|126710_128795_-	Predicted P-loop ATPase	NA	NA	NA	NA	NA
VEC05278.1|128937_129840_-	Transcriptional repressor pifC	NA	NA	NA	NA	NA
VEC05279.1|129923_130106_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05280.1|130124_130586_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
VEC05281.1|130701_131649_+	membrane protein	NA	NA	NA	NA	NA
VEC05282.1|131984_132980_+	Transposase	NA	A0A1S7J231	Thermus_phage	28.7	3.1e-20
VEC05283.1|133185_134199_-	alcohol dehydrogenase protein	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
VEC05284.1|134311_134839_+	Cupin	NA	NA	NA	NA	NA
VEC05285.1|134870_137084_+|transposase	transposase Tn3 family protein	transposase	A0A125RQ78	Bacillus_phage	21.9	1.5e-25
VEC05286.1|137146_138070_+|transposase	transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
VEC05287.1|138288_138447_-	Hok/gef cell toxic protein	NA	NA	NA	NA	NA
VEC05288.1|140270_140531_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05289.1|141787_142258_-	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VEC05290.1|142254_142698_-	TIGR02293 family toxin-antitoxin system antitoxin component	NA	NA	NA	NA	NA
VEC05291.1|143995_146122_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
VEC05292.1|146640_147162_-	FecR anti-FecI sigma factor	NA	NA	NA	NA	NA
VEC05293.1|147158_147680_-	ECF subfamily RNA polymerase sigma-24 subunit	NA	NA	NA	NA	NA
VEC05294.1|147921_148113_+|transposase	IS911 transposase orfB	transposase	NA	NA	NA	NA
VEC05295.1|148220_148580_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05296.1|148569_149802_+	PP-loop domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	34.0	6.3e-63
VEC05297.1|149786_150431_+	Predicted transcriptional regulators	NA	A0A0F7L444	uncultured_marine_virus	53.7	5.6e-55
VEC05298.1|150780_151896_+	Glycosyltransferase IroB	NA	NA	NA	NA	NA
VEC05299.1|152038_155683_+	putative ABC transporter	NA	W8CYL7	Bacillus_phage	29.7	3.2e-46
VEC05300.1|155787_157017_+	Enterochelin esterase and related enzymes	NA	NA	NA	NA	NA
VEC05301.1|157476_159651_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	30.6	2.8e-05
VEC05302.1|159712_159934_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05303.1|160076_160979_-	Permease of the drug/metabolite transporter (DMT) superfamily	NA	NA	NA	NA	NA
VEC05304.1|161983_162571_-	Bacterial regulatory proteins, luxR family	NA	NA	NA	NA	NA
VEC05305.1|163158_163812_+	putative SAM-dependent methyltransferases	NA	NA	NA	NA	NA
VEC05306.1|164574_164847_-|transposase	IS1 transposase orfA	transposase	A0A0U2RK18	Escherichia_phage	83.3	1.0e-34
VEC05307.1|164995_165319_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05308.1|165462_166425_-	helicase c2	NA	A0A127AW80	Bacillus_phage	27.1	5.9e-08
VEC05309.1|166427_166994_-	CRISPR associated protein	NA	NA	NA	NA	NA
VEC05310.1|166996_167788_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05311.1|167850_168264_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05312.1|168348_168837_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05313.1|168888_169299_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05314.1|169530_170454_-|transposase	transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
>prophage 3
LR134211	Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2	205331	183132	194696	205331	transposase,integrase	Macacine_betaherpesvirus(25.0%)	12	182072:182087	194572:194587
182072:182087	attL	TGTTCGAAGGCCTCCG	NA	NA	NA	NA
VEC05327.1|183132_183420_+|integrase	integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	56.0	1.3e-19
VEC05328.1|184241_185252_-	initiator RepB protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
VEC05329.1|185981_187148_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
VEC05330.1|187147_188119_+	plasmid-partitioning protein SopB	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
VEC05331.1|189367_189514_-	DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	60.0	2.6e-08
VEC05332.1|189746_190187_+	Transposase	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
VEC05333.1|190183_190534_+	Transposase and inactivated derivatives	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
VEC05334.1|190564_192157_+	Transposase and inactivated derivatives	NA	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
VEC05335.1|192301_192475_+|transposase	IS2 transposase orfA	transposase	Q76S41	Shigella_phage	94.5	1.4e-21
VEC05336.1|192484_193453_-|transposase	transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
VEC05337.1|193695_193833_+|transposase	IS2 transposase orfA	transposase	Q76S41	Shigella_phage	91.1	4.6e-15
VEC05338.1|194039_194696_+|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	84.9	3.4e-108
194572:194587	attR	CGGAGGCCTTCGAACA	NA	NA	NA	NA
>prophage 1
LR134212	Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3	25090	355	24682	25090	integrase	Salmonella_phage(22.58%)	37	10383:10395	16894:16906
VEC05351.1|355_829_+	Uncharacterised protein	NA	G0ZNE7	Cronobacter_phage	48.1	1.6e-30
VEC05352.1|767_1052_+	Uncharacterised protein	NA	G0ZNE7	Cronobacter_phage	66.2	1.9e-23
VEC05353.1|1246_1609_-	Arc-like DNA binding domain	NA	H6WRU6	Salmonella_phage	65.6	3.3e-12
VEC05354.1|1721_1895_+	Arc-like DNA binding domain	NA	I6R9A8	Salmonella_phage	85.7	5.1e-19
VEC05355.1|1884_2328_+	Uncharacterised protein	NA	Q7Y5X0	Haemophilus_phage	47.1	3.4e-11
VEC05356.1|2659_3412_+	Uncharacterised protein	NA	A0A0P0ZD96	Stx2-converting_phage	53.9	1.2e-59
VEC05357.1|3855_3972_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05358.1|4685_6107_+	Uncharacterised protein	NA	F1C5E9	Cronobacter_phage	38.8	3.3e-63
VEC05359.1|6213_7260_+	phage tape measure protein	NA	Q5G8W8	Enterobacteria_phage	43.7	1.6e-38
VEC05360.1|7301_7778_+	Uncharacterised protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	8.7e-37
VEC05361.1|7777_8248_+	Uncharacterised protein	NA	R9TPR6	Aeromonas_phage	38.7	8.1e-27
VEC05362.1|8244_8640_+	NlpC/P60 family.	NA	F1C5F2	Cronobacter_phage	53.6	1.4e-35
VEC05363.1|8626_11098_+	Uncharacterised protein	NA	F1C5A7	Cronobacter_phage	45.2	6.3e-203
10383:10395	attL	ACCCAGATGCGGT	NA	NA	NA	NA
VEC05364.1|11184_12393_+	Uncharacterised protein	NA	A0A286S1P0	Klebsiella_phage	51.4	5.3e-22
VEC05365.1|12410_13367_+	Uncharacterised protein	NA	B5TAB2	Burkholderia_phage	43.9	1.2e-69
VEC05366.1|13379_14114_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05367.1|14132_14339_+	Uncharacterised protein	NA	K7PGV5	Enterobacterial_phage	46.2	9.6e-09
VEC05368.1|14566_15730_-|integrase	phage integrase family protein	integrase	G8C7S0	Escherichia_phage	87.1	5.0e-203
VEC05369.1|15943_16162_-	phage/conjugal plasmid C-4 type zinc finger protein, TraR family	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
VEC05370.1|16532_17018_-	Uncharacterised protein	NA	A0A077SLQ8	Escherichia_phage	47.2	9.5e-31
16894:16906	attR	ACCCAGATGCGGT	NA	NA	NA	NA
VEC05371.1|17074_17317_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05372.1|17313_17970_-	adenine-specific DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.6	1.0e-112
VEC05373.1|17966_18395_-	Uncharacterised protein	NA	M9NYX4	Enterobacteria_phage	81.0	4.4e-64
VEC05374.1|18437_18917_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	96.2	1.1e-84
VEC05375.1|18945_19074_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	83.8	8.3e-11
VEC05376.1|19252_19918_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	65.3	5.4e-69
VEC05377.1|19933_20218_-	Uncharacterised protein	NA	G8C7T1	Escherichia_phage	60.6	3.1e-29
VEC05378.1|20225_20321_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05379.1|20906_21113_-	putative prophage Kil protein	NA	A0A0M4S6W3	Salmonella_phage	92.6	1.5e-30
VEC05380.1|21105_21294_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05381.1|21608_21743_+	Uncharacterised protein	NA	A0A192Y6Q5	Salmonella_phage	75.0	1.8e-08
VEC05382.1|21778_22183_-	Uncharacterised protein	NA	A0A0P0ZDD3	Stx2-converting_phage	84.3	1.9e-56
VEC05383.1|22529_22850_-	XRE family transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	97.1	2.3e-49
VEC05384.1|23253_23373_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC05385.1|23395_23881_-	putative phage repressor protein CI	NA	Q76H56	Enterobacteria_phage	80.7	5.5e-71
VEC05386.1|24187_24421_+	antirepressor protein Cro	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
VEC05387.1|24460_24682_+	bacteriophage CII family protein	NA	A2SY75	Escherichia_phage	52.0	1.1e-05
>prophage 1
LR134213	Klebsiella aerogenes strain NCTC418 genome assembly, chromosome: 4	5306679	1424905	1483448	5306679	capsid,head,integrase,terminase,tRNA,protease,tail,portal	Klebsiella_phage(30.43%)	65	1447908:1447927	1485919:1485938
VEC06714.1|1424905_1426324_+|tRNA	glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEC06715.1|1426375_1426768_-	Putative transcription regulator (DUF1323)	NA	NA	NA	NA	NA
VEC06716.1|1426771_1427125_-	Putative negative regulator	NA	NA	NA	NA	NA
VEC06717.1|1427746_1429918_+	Cyclic di-GMP phosphodiesterase YfgF	NA	NA	NA	NA	NA
VEC06718.1|1429966_1431169_-	Nucleoside permease NupC	NA	NA	NA	NA	NA
VEC06719.1|1431515_1432757_+	manganese transport protein MntH	NA	NA	NA	NA	NA
VEC06720.1|1432814_1433168_-	Protein of uncharacterised function (DUF2502)	NA	NA	NA	NA	NA
VEC06721.1|1433298_1434291_-	Putative ion-channel protein	NA	NA	NA	NA	NA
VEC06722.1|1434471_1436133_+	Pyruvate decarboxylase; Alpha-keto-acid decarboxylase	NA	NA	NA	NA	NA
VEC06723.1|1436129_1437365_-	Chloride channel protein	NA	NA	NA	NA	NA
VEC06724.1|1437628_1438594_+	glucokinase	NA	NA	NA	NA	NA
VEC06725.1|1438647_1439385_-	Hypothetical response regulatory protein ypdB	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
VEC06726.1|1439396_1441094_-	putative sensor protein	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
VEC06727.1|1441476_1442691_+	aspartate aminotransferase	NA	NA	NA	NA	NA
VEC06728.1|1443171_1444368_-	cyanate transporter	NA	NA	NA	NA	NA
VEC06729.1|1444364_1444823_-	Probable deaminase	NA	A0A0B5J096	Pandoravirus	32.3	9.4e-12
VEC06730.1|1444955_1445864_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
VEC06731.1|1445873_1446755_-	Uncharacterised protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
VEC06732.1|1447123_1447606_-	Tryptophan synthase beta chain like	NA	NA	NA	NA	NA
1447908:1447927	attL	ATATCCATTTAACTAAGGGG	NA	NA	NA	NA
VEC06733.1|1448124_1449294_+|integrase	integrase family protein	integrase	A0A2R2Z2Y0	Escherichia_phage	86.3	8.6e-203
VEC06734.1|1449398_1450229_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC06735.1|1450535_1451057_-	Eaa prophage protein	NA	S4TSR6	Salmonella_phage	79.6	2.6e-42
VEC06736.1|1451049_1451250_-	Uncharacterised protein	NA	A0A1U8QWK2	Salmonella_phage	58.8	5.1e-07
VEC06737.1|1451246_1451486_-	Uncharacterised protein	NA	A0A2R2Z309	Escherichia_phage	83.5	2.3e-30
VEC06738.1|1451679_1452465_-	PRTRC system ParB family protein	NA	A4JX52	Burkholderia_virus	50.6	7.6e-62
VEC06739.1|1452464_1452764_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC06740.1|1452851_1453775_-	DNA recombinase	NA	S4TWL4	Salmonella_phage	63.5	7.7e-106
VEC06741.1|1454056_1454317_-	phage repressor	NA	A0A1I9KG86	Aeromonas_phage	54.7	4.8e-21
VEC06742.1|1455030_1455492_+	Uncharacterised protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
VEC06743.1|1455898_1456813_+	PaaX family transcriptional regulator	NA	H2DE83	Erwinia_phage	57.3	2.4e-30
VEC06744.1|1456809_1457619_+	DMT family permease	NA	A0A1C9II58	Salmonella_phage	69.3	1.6e-110
VEC06745.1|1457628_1458006_+	crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
VEC06746.1|1458090_1458999_+	Putative cytoplasmic protein	NA	Q8SBE5	Shigella_phage	65.6	6.8e-123
VEC06747.1|1459012_1459591_+	Protein of uncharacterised function (DUF1133)	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
VEC06748.1|1460246_1461092_+	TRAP transporter solute receptor, TAXI family	NA	A0A1B2IGT1	Erwinia_phage	72.4	2.3e-109
VEC06749.1|1461855_1462251_+	putative prophage membrane protein	NA	G8C7V8	Escherichia_phage	73.1	1.5e-45
VEC06750.1|1462237_1462519_+	putative prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	72.0	2.9e-32
VEC06751.1|1462518_1463148_+	Phage endolysin	NA	G9L6E8	Escherichia_phage	77.5	3.1e-90
VEC06752.1|1463150_1463426_+	Uncharacterised protein	NA	G8C7W1	Escherichia_phage	37.1	6.0e-06
VEC06753.1|1463370_1463568_+	Uncharacterised protein	NA	A0A286SGR9	Klebsiella_phage	94.8	2.7e-24
VEC06754.1|1463656_1463902_+	Protein of uncharacterised function (DUF2560)	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
VEC06755.1|1463973_1464177_+	Protein of uncharacterised function (DUF551)	NA	NA	NA	NA	NA
VEC06756.1|1464259_1464493_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC06757.1|1464480_1464831_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	3.2e-52
VEC06758.1|1464961_1465456_+|terminase	P27 family phage terminase small subunit	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
VEC06759.1|1465452_1467183_+|terminase	terminase	terminase	Q8HAD6	Salmonella_phage	83.2	4.6e-301
VEC06760.1|1467192_1467378_+	Uncharacterised protein	NA	A0A1B5FP99	Escherichia_phage	63.9	5.2e-14
VEC06761.1|1467377_1468607_+|portal	phage portal protein, HK97 family	portal	U5P411	Shigella_phage	81.5	1.7e-201
VEC06762.1|1468590_1469247_+|head,protease	phage prohead protease, HK97 family	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
VEC06763.1|1469261_1470470_+|capsid	phage major capsid protein, HK97 family	capsid	A0A192Y5T6	Salmonella_phage	81.0	8.4e-185
VEC06764.1|1470708_1471029_+	phage protein DNA packaging protein	NA	K7PKT4	Enterobacteria_phage	38.6	1.3e-15
VEC06765.1|1471098_1471296_+	Uncharacterised protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
VEC06766.1|1471297_1471630_+|head,tail	phage head-tail adaptor	head,tail	A0A286S2A2	Klebsiella_phage	98.2	2.9e-55
VEC06767.1|1471622_1472162_+	phage protein, HK97 gp10 family	NA	A0A286S249	Klebsiella_phage	98.9	8.8e-94
VEC06768.1|1472158_1472524_+	Protein of uncharacterised function (DUF3168)	NA	A0A286S1R1	Klebsiella_phage	91.7	3.3e-60
VEC06769.1|1472580_1473072_+	Uncharacterised protein	NA	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
VEC06770.1|1473115_1473499_+	Uncharacterised protein	NA	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
VEC06771.1|1473501_1473765_+	Uncharacterised protein	NA	A0A286S1P2	Klebsiella_phage	90.8	7.9e-40
VEC06772.1|1473828_1474206_+	SmpA / OmlA family	NA	NA	NA	NA	NA
VEC06773.1|1474267_1476814_+|tail	prophage tail length tape measure	tail	A0A286S1S3	Klebsiella_phage	74.5	0.0e+00
VEC06774.1|1476813_1477293_+	alkanesulfonate ABC transporter permease	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
VEC06775.1|1477279_1477762_+	Domain of uncharacterised function (DUF1833)	NA	A0A286S2B1	Klebsiella_phage	98.1	1.1e-84
VEC06776.1|1477771_1478152_+	COG2116: Formate/nitrite family of transporters	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
VEC06777.1|1478148_1481217_+	Uncharacterised protein	NA	A0A286S259	Klebsiella_phage	94.7	0.0e+00
VEC06778.1|1481294_1483448_+	Uncharacterised protein	NA	B5TAB2	Burkholderia_phage	42.2	6.2e-90
1485919:1485938	attR	ATATCCATTTAACTAAGGGG	NA	NA	NA	NA
>prophage 2
LR134213	Klebsiella aerogenes strain NCTC418 genome assembly, chromosome: 4	5306679	1716304	1723211	5306679		Planktothrix_phage(33.33%)	6	NA	NA
VEC07190.1|1716304_1717168_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
VEC07192.1|1717178_1717952_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
VEC07194.1|1718194_1719091_-	Transcription regulator [contains diacylglycerol kinase catalytic domain]	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
VEC07196.1|1719333_1720695_-	peptidase U32	NA	Q6DW11	Phage_TP	94.8	1.8e-207
VEC07198.1|1721013_1721736_-	DNA-binding transcriptional regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
VEC07200.1|1721732_1723211_-	Sensory histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
LR134213	Klebsiella aerogenes strain NCTC418 genome assembly, chromosome: 4	5306679	2709088	2719976	5306679		Escherichia_phage(87.5%)	9	NA	NA
VEC08804.1|2709088_2712196_+	Beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
VEC08805.1|2712250_2713516_+	Lactose permease	NA	NA	NA	NA	NA
VEC08806.1|2713546_2714635_-	putative RecF protein	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
VEC08807.1|2714721_2714982_-	Uncharacterised protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
VEC08809.1|2715279_2716140_+	Beta-lactamase	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
VEC08810.1|2716160_2716922_-	DeoR-family trancriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
VEC08811.1|2717183_2718086_+	2-hydroxy-3-oxopropionate reductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
VEC08812.1|2718097_2719363_+	Predicted pyridoxine biosynthesis protein (probably from glycolaldehide)	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
VEC08814.1|2719355_2719976_+	Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
LR134213	Klebsiella aerogenes strain NCTC418 genome assembly, chromosome: 4	5306679	3130662	3138072	5306679	tail	Klebsiella_phage(66.67%)	7	NA	NA
VEC09585.1|3130662_3131721_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	2.1e-14
VEC09587.1|3132143_3133571_-|tail	putative tail fiber	tail	A0A0P0IDN1	Klebsiella_phage	55.5	4.0e-101
VEC09589.1|3133632_3134478_-|tail	Phage-related protein, tail component	tail	K9L8R5	Klebsiella_phage	53.3	6.0e-73
VEC09591.1|3134428_3134848_-|tail	Phage tail fiber protein	tail	NA	NA	NA	NA
VEC09593.1|3134844_3135828_-|tail	Phage tail fiber protein	tail	Q6UAW1	Klebsiella_phage	71.9	4.9e-42
VEC09595.1|3135876_3136224_-|tail	Phage tail fiber protein	tail	Q6UAW1	Klebsiella_phage	57.0	2.1e-32
VEC09597.1|3136821_3138072_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	7.4e-19
>prophage 5
LR134213	Klebsiella aerogenes strain NCTC418 genome assembly, chromosome: 4	5306679	3376687	3464898	5306679	capsid,integrase,terminase,holin,tRNA,plate,protease,tail,portal	Salmonella_phage(57.41%)	89	3432399:3432419	3465636:3465656
VEC09991.1|3376687_3377980_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
VEC09993.1|3378070_3379414_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	40.8	5.6e-81
VEC09996.1|3379422_3380034_-	Outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
VEC09997.1|3380156_3384482_-	cell division protein	NA	S5VNE3	Mycobacterium_phage	49.2	5.3e-88
VEC09999.1|3384617_3385112_-	Leucine-responsive regulatory protein	NA	NA	NA	NA	NA
VEC10001.1|3385617_3386613_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
VEC10003.1|3386727_3388494_+	Transport ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.6	1.9e-20
VEC10005.1|3388494_3390216_+	Transport ATP-binding protein CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
VEC10007.1|3390260_3390962_+|tRNA	Leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
VEC10009.1|3391315_3391534_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VEC10011.1|3391653_3393933_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
VEC10013.1|3393963_3394281_-|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
VEC10015.1|3394606_3394828_+	cold-shock DNA-binding protein family protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
VEC10017.1|3394904_3396845_-	Macrolide export ATP-binding/permease protein MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
VEC10019.1|3396841_3397957_-	Macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
VEC10021.1|3398103_3399762_-	Predicted ATP-dependent endonuclease of the OLD family	NA	NA	NA	NA	NA
VEC10023.1|3400181_3400877_+	MIP family channel proteins	NA	NA	NA	NA	NA
VEC10025.1|3400992_3401892_+	protein YbjE	NA	NA	NA	NA	NA
VEC10026.1|3402035_3403688_+	hydroxylamine reductase	NA	NA	NA	NA	NA
VEC10028.1|3403698_3404667_+	NADH oxidoreductase hcr	NA	NA	NA	NA	NA
VEC10030.1|3404878_3405313_-	DoxX family protein	NA	NA	NA	NA	NA
VEC10032.1|3405464_3407183_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
VEC10034.1|3407221_3408223_+	L-threonine aldolase	NA	NA	NA	NA	NA
VEC10036.1|3408233_3409676_+	short chain dehydrogenase	NA	NA	NA	NA	NA
VEC10038.1|3409763_3410777_+	Putative nucleotide di-P-sugar epimerase or dehydratase	NA	NA	NA	NA	NA
VEC10040.1|3410773_3411604_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
VEC10042.1|3411635_3412775_-	Bacteriophytochrome cph2	NA	NA	NA	NA	NA
VEC10044.1|3413168_3413333_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10046.1|3413652_3414168_+	probable lipoprotein	NA	NA	NA	NA	NA
VEC10048.1|3414394_3415123_+	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	36.7	7.9e-29
VEC10050.1|3415122_3415875_+	ABC transporter arginine-binding protein 2	NA	NA	NA	NA	NA
VEC10052.1|3415881_3416598_+	arginine transporter permease subunit ArtQ	NA	NA	NA	NA	NA
VEC10054.1|3416597_3417266_+	arginine transporter permease subunit ArtM	NA	NA	NA	NA	NA
VEC10056.1|3417449_3418181_+	cationic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEC10058.1|3418267_3419740_-	alkaline phosphatase synthesis sensor protein phoR	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
VEC10060.1|3419736_3420453_-	Putative response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
VEC10062.1|3420531_3421659_-	23S rRNA methyluridine methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	25.6	2.3e-19
VEC10064.1|3421700_3422189_-	Putative inner membrane protein	NA	NA	NA	NA	NA
VEC10066.1|3422246_3423092_-	putrescine transport system permease protein potI	NA	NA	NA	NA	NA
VEC10068.1|3423088_3424042_-	binding-protein-dependent transport system inner membrane protein	NA	NA	NA	NA	NA
VEC10070.1|3424052_3425186_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
VEC10072.1|3425350_3426463_-	putrescine ABC transporter periplasmic-binding protein	NA	NA	NA	NA	NA
VEC10074.1|3426811_3427291_-	putative sensory transduction regulator	NA	NA	NA	NA	NA
VEC10076.1|3427380_3428283_-	Ribosomal protein S6 glutaminyl transferase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
VEC10078.1|3428397_3429120_-	Oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
VEC10080.1|3429103_3429391_-	Protein of uncharacterised function (DUF1418)	NA	NA	NA	NA	NA
VEC10082.1|3429593_3429857_+	Glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
VEC10084.1|3429863_3430247_-	Inner membrane protein	NA	NA	NA	NA	NA
VEC10086.1|3430513_3432199_+	putative transporter	NA	NA	NA	NA	NA
3432399:3432419	attL	TGGCGACAAAGTGGCGACAGC	NA	NA	NA	NA
VEC10088.1|3432725_3433823_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	82.2	4.5e-169
VEC10090.1|3433819_3434305_-	phage P2 GpU family protein	NA	E5G6Q2	Salmonella_phage	77.6	5.0e-64
VEC10092.1|3434301_3436932_-|tail	phage tail-like protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.9	6.8e-115
VEC10094.1|3437058_3437358_-|tail	putative phage tail protein E	tail	E5G6P9	Salmonella_phage	77.0	1.4e-32
VEC10096.1|3437410_3437926_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
VEC10098.1|3437935_3439108_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	5.4e-205
VEC10100.1|3439246_3440107_-|tail	Phage tail fiber protein	tail	S4TP62	Salmonella_phage	50.5	6.2e-17
VEC10102.1|3440217_3440406_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10104.1|3440483_3440759_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10106.1|3440772_3442998_-|tail	T7 tail fiber protein	tail	K4I5E8	Salmonella_phage	41.3	3.0e-10
VEC10108.1|3443003_3443600_-|tail	putative phage tail protein	tail	A0A1S6L000	Salmonella_phage	56.0	1.8e-55
VEC10110.1|3443592_3444501_-|plate	baseplate assembly protein J (GpJ)	plate	E5G6N8	Salmonella_phage	66.9	3.4e-106
VEC10112.1|3444487_3444850_-|plate	Phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
VEC10114.1|3444846_3445419_-|plate	phage baseplate assembly-like protein	plate	E5G6N6	Salmonella_phage	72.3	2.1e-77
VEC10116.1|3445631_3446222_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10118.1|3446196_3446649_-|tail	phage tail-like protein	tail	A0A1S6L001	Salmonella_phage	71.4	6.5e-50
VEC10120.1|3446641_3447073_-|tail	tail fiber protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
VEC10122.1|3447168_3447597_-	putative regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	77.9	5.6e-51
VEC10124.1|3447601_3448111_-	phage lysozyme	NA	E5G6N1	Salmonella_phage	83.4	9.5e-82
VEC10126.1|3448091_3448307_-|holin	phage-holin-like protein	holin	E5G6N0	Salmonella_phage	85.9	1.5e-28
VEC10128.1|3448310_3448514_-|tail	putative phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
VEC10130.1|3448513_3448978_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	84.4	6.7e-74
VEC10132.1|3449074_3449725_-|terminase	small terminase subunit	terminase	E5G6M7	Salmonella_phage	86.6	9.6e-103
VEC10134.1|3449728_3450781_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	89.1	2.1e-171
VEC10136.1|3450797_3451631_-|capsid	capsid scaffold-like protein	capsid	A0A1S6KZW9	Salmonella_phage	74.4	2.2e-99
VEC10138.1|3451779_3453534_+|terminase	terminase, ATPase subunit	terminase	A0A1S6KZW3	Salmonella_phage	92.6	0.0e+00
VEC10139.1|3453533_3454562_+|portal	putative phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.3	6.2e-173
VEC10140.1|3454608_3456273_-	Uncharacterised protein	NA	X2KLG0	Campylobacter_phage	24.9	4.5e-11
VEC10141.1|3456568_3456754_-	levan regulatory protein RlsC	NA	E5G6M0	Salmonella_phage	50.0	5.6e-08
VEC10143.1|3456868_3457129_-	bacteriophage replication gene A	NA	A0A1S6L028	Salmonella_phage	77.9	3.9e-31
VEC10145.1|3457121_3459251_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	93.6	0.0e+00
VEC10147.1|3459270_3459498_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	80.0	7.8e-28
VEC10149.1|3459497_3459734_-	corresponds to STY3665 from Accession AL513382: Salmonella typhi CT18	NA	A0A0M3UL87	Salmonella_phage	55.4	8.2e-12
VEC10150.1|3459801_3460143_-	putative prophage protein	NA	E5G6L5	Salmonella_phage	80.5	1.3e-45
VEC10152.1|3460314_3460824_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	82.1	1.4e-72
VEC10154.1|3460856_3461078_-	regulator for prophage	NA	NA	NA	NA	NA
VEC10156.1|3461203_3461764_+	bacteriophage CI repressor	NA	A0A1S6KZZ7	Salmonella_phage	44.8	2.0e-40
VEC10158.1|3461775_3462360_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10160.1|3462370_3463444_+	Uncharacterised protein	NA	Q6SE88	Lactobacillus_prophage	40.0	1.1e-68
VEC10162.1|3463872_3464898_+|integrase	phage integrase family protein	integrase	A0A218M4I3	Erwinia_phage	55.8	5.2e-103
3465636:3465656	attR	TGGCGACAAAGTGGCGACAGC	NA	NA	NA	NA
>prophage 6
LR134213	Klebsiella aerogenes strain NCTC418 genome assembly, chromosome: 4	5306679	3914244	3963298	5306679	tRNA,integrase	Cronobacter_phage(20.69%)	74	3913059:3913105	3960370:3960416
3913059:3913105	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
VEC10894.1|3914244_3916428_-	Uncharacterised protein	NA	B5TAB2	Burkholderia_phage	42.4	2.8e-82
VEC10896.1|3916514_3918986_-	Uncharacterised protein	NA	F1C5A7	Cronobacter_phage	45.2	6.3e-203
VEC10898.1|3918972_3919368_-	NlpC/P60 family.	NA	F1C5F2	Cronobacter_phage	53.6	1.4e-35
VEC10900.1|3919364_3919835_-	Uncharacterised protein	NA	F1C5F1	Cronobacter_phage	37.0	9.9e-25
VEC10902.1|3919834_3920311_-	Uncharacterised protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	8.7e-37
VEC10904.1|3920352_3922926_-	phage tape measure protein	NA	F1C5E9	Cronobacter_phage	35.9	3.4e-95
VEC10906.1|3923484_3923817_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10908.1|3924197_3924950_-	Uncharacterised protein	NA	A0A0P0ZD96	Stx2-converting_phage	53.9	1.2e-59
VEC10910.1|3925019_3925724_-	P22AR C-terminal domain	NA	H6WRU8	Salmonella_phage	39.8	2.4e-38
VEC10912.1|3925713_3925887_-	Arc-like DNA binding domain	NA	I6R9A8	Salmonella_phage	85.7	5.1e-19
VEC10914.1|3925999_3926362_+	Arc-like DNA binding domain	NA	H6WRU6	Salmonella_phage	65.6	3.3e-12
VEC10916.1|3926556_3927252_-	Uncharacterised protein	NA	G0ZNE7	Cronobacter_phage	54.2	6.1e-63
VEC10918.1|3927320_3928085_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.0	1.2e-40
VEC10919.1|3928143_3928527_-	Uncharacterised protein	NA	F1C5E4	Cronobacter_phage	48.8	1.6e-28
VEC10920.1|3928523_3928892_-	Uncharacterised protein	NA	F1C5E3	Cronobacter_phage	82.0	1.9e-47
VEC10922.1|3928943_3929576_-	AP2 domain.	NA	A0A2I7S0H7	Vibrio_phage	46.8	8.0e-38
VEC10924.1|3929585_3929948_-	Uncharacterised protein	NA	A0A0M3LSC9	Mannheimia_phage	46.7	4.8e-19
VEC10926.1|3929944_3930328_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10928.1|3930331_3930502_-	gp12	NA	Q5G8X7	Enterobacteria_phage	50.0	3.4e-12
VEC10930.1|3930501_3930903_-	gp11	NA	G0ZNE1	Cronobacter_phage	74.6	4.7e-52
VEC10931.1|3930969_3931263_-	gp10	NA	A0A1V0E5P8	Salmonella_phage	87.6	3.6e-41
VEC10933.1|3931272_3932349_-	gp9	NA	Q5G8Y0	Enterobacteria_phage	91.0	2.9e-189
VEC10935.1|3932366_3932816_-	gp8	NA	I6S1Q2	Salmonella_phage	85.2	7.1e-65
VEC10937.1|3932828_3934094_-	gp7	NA	Q5G8Y2	Enterobacteria_phage	90.7	4.2e-219
VEC10939.1|3934096_3935023_-	gp6	NA	Q5G8Y3	Enterobacteria_phage	92.2	1.5e-162
VEC10941.1|3934982_3936332_-	gp5	NA	Q5G8Y4	Enterobacteria_phage	82.4	1.7e-215
VEC10942.1|3936885_3938364_-	Uncharacterized conserved protein	NA	G0ZND4	Cronobacter_phage	86.4	2.7e-254
VEC10944.1|3938350_3938830_-	phage protein	NA	F1C5D6	Cronobacter_phage	74.8	1.4e-63
VEC10945.1|3938860_3939373_-	Uncharacterised protein	NA	H9C189	Pectobacterium_phage	81.1	5.6e-82
VEC10946.1|3939639_3939876_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10947.1|3940228_3940579_-	Uncharacterised protein	NA	R9TPM9	Aeromonas_phage	38.7	2.3e-10
VEC10949.1|3940575_3941079_-	lysozyme from lambdoid prophage DLP12	NA	M1FJA0	Enterobacteria_phage	82.0	2.9e-75
VEC10950.1|3941075_3941396_-	Uncharacterised protein	NA	H6WRZ3	Salmonella_phage	86.1	6.5e-44
VEC10951.1|3942475_3943165_-	phage Antitermination protein Q	NA	I6PDF8	Cronobacter_phage	53.2	2.0e-58
VEC10952.1|3943161_3943302_-	Gifsy-1 Prophage protein	NA	NA	NA	NA	NA
VEC10953.1|3943298_3943529_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10955.1|3943525_3944107_-	bacteriophage lambda NinG family protein	NA	E7C9S3	Salmonella_phage	47.3	9.3e-41
VEC10957.1|3944099_3944276_-	prophage protein NinE	NA	G8C7V4	Escherichia_phage	71.4	2.9e-14
VEC10959.1|3944275_3944872_-	Protein of uncharacterised function (DUF1367)	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
VEC10961.1|3945029_3945233_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10963.1|3945232_3946231_-	Protein of uncharacterised function (DUF551)	NA	R9TQX3	Aeromonas_phage	76.2	5.9e-35
VEC10965.1|3946227_3946608_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	95.2	6.0e-65
VEC10967.1|3946611_3946740_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10969.1|3946739_3946964_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10971.1|3946963_3947452_-	Phage EaD protein	NA	A0A2H4N7C3	Pectobacterium_phage	34.9	1.9e-07
VEC10973.1|3947680_3948094_-	Uncharacterised protein	NA	R9TME7	Aeromonas_phage	37.8	1.1e-11
VEC10975.1|3948090_3948315_-	Uncharacterised protein	NA	H9C169	Pectobacterium_phage	52.9	5.7e-15
VEC10977.1|3948311_3948614_-	Uncharacterized protein conserved in archaea	NA	NA	NA	NA	NA
VEC10979.1|3948613_3949390_-	replication P family protein	NA	A0A193GYX1	Enterobacter_phage	65.0	1.1e-94
VEC10981.1|3949386_3950115_-	PaaX family transcriptional regulator	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
VEC10983.1|3950248_3950470_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
VEC10985.1|3950509_3950743_-	antirepressor protein Cro	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
VEC10987.1|3951051_3951537_+	putative phage repressor protein CI	NA	Q76H56	Enterobacteria_phage	80.7	5.5e-71
VEC10989.1|3951559_3951679_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10991.1|3952082_3952751_+	XRE family transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	87.8	1.7e-99
VEC10993.1|3952747_3953152_+	Uncharacterised protein	NA	A0A0P0ZDD3	Stx2-converting_phage	84.3	1.9e-56
VEC10995.1|3953187_3953391_-	Uncharacterised protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	2.3e-18
VEC10997.1|3953535_3953625_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEC10999.1|3953636_3953825_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC11001.1|3953817_3954024_+	putative prophage Kil protein	NA	A0A0M4S6W3	Salmonella_phage	92.6	1.5e-30
VEC11003.1|3954087_3954618_+	AP2 domain.	NA	A0A173GC65	Salmonella_phage	45.3	2.9e-33
VEC11005.1|3954605_3954701_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC11007.1|3954708_3954993_+	Uncharacterised protein	NA	G8C7T1	Escherichia_phage	60.6	3.1e-29
VEC11009.1|3955008_3955854_+	RecT protein	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
VEC11011.1|3955850_3956531_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.9	2.3e-123
VEC11013.1|3956527_3956956_+	Uncharacterised protein	NA	M9NYX4	Enterobacteria_phage	81.0	4.4e-64
VEC11015.1|3956952_3957609_+	adenine-specific DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.6	1.0e-112
VEC11017.1|3957605_3957827_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEC11019.1|3957823_3958390_+	Uncharacterised protein	NA	A0A077SLQ8	Escherichia_phage	48.3	9.1e-41
VEC11021.1|3958760_3958979_+	phage/conjugal plasmid C-4 type zinc finger protein, TraR family	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
VEC11023.1|3959192_3960356_+|integrase	phage integrase family protein	integrase	G8C7S0	Escherichia_phage	87.1	5.0e-203
VEC11025.1|3960786_3961653_+	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3960370:3960416	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
VEC11027.1|3961654_3961867_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEC11029.1|3961912_3963298_-|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
