The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134196	Klebsiella pneumoniae strain NCTC11357 genome assembly, chromosome: 1	5124551	1614353	1621280	5124551	protease	Planktothrix_phage(33.33%)	6	NA	NA
VEB71923.1|1614353_1615217_+	putative dipeptide ABC transport system ATP-binding component	NA	G9BWD6	Planktothrix_phage	34.5	9.7e-10
VEB71925.1|1615227_1616001_+	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
VEB71929.1|1616241_1617138_-	transcription regulator	NA	A0A1V0SBJ0	Catovirus	29.3	1.8e-14
VEB71932.1|1617380_1618898_-|protease	protease	protease	Q6DW11	Phage_TP	94.0	4.8e-206
VEB71935.1|1619064_1619787_-	Response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
VEB71938.1|1619783_1621280_-	signal transduction histidine-protein kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 2
LR134196	Klebsiella pneumoniae strain NCTC11357 genome assembly, chromosome: 1	5124551	1664239	1682960	5124551		Enterobacteria_phage(28.57%)	16	NA	NA
VEB72040.1|1664239_1665646_+	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
VEB72045.1|1665872_1667288_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.2	6.2e-54
VEB72048.1|1667310_1668681_+	Phosphomannomutase dehydrogenase	NA	A0A127AWJ1	Bacillus_phage	25.9	8.4e-32
VEB72052.1|1668839_1669904_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	8.3e-104
VEB72054.1|1669917_1670787_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.4	1.2e-111
VEB72058.1|1670818_1671709_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	5.3e-27
VEB72061.1|1671723_1672278_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.0	1.9e-51
VEB72064.1|1672457_1673624_+	UDP-glucose dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
VEB72067.1|1674571_1675576_-	dTDP-glucose 4,6-dehydratase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
VEB72071.1|1676423_1677488_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	2.2e-104
VEB72074.1|1677502_1678372_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.4	6.8e-112
VEB72078.1|1678403_1679294_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	4.8e-28
VEB72080.1|1679308_1679863_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.0	1.9e-51
VEB72083.1|1679954_1680785_+	glycosyltransferase	NA	NA	NA	NA	NA
VEB72086.1|1680814_1681648_+	O-antigen export - TMD component	NA	NA	NA	NA	NA
VEB72089.1|1681637_1682960_+	O-antigen export - NBD component	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	1.4e-12
>prophage 3
LR134196	Klebsiella pneumoniae strain NCTC11357 genome assembly, chromosome: 1	5124551	2564018	2574904	5124551		Escherichia_phage(87.5%)	10	NA	NA
VEB74185.1|2564018_2567126_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
VEB74188.1|2567180_2568446_+	putative proton/sugar symporter, LacY	NA	NA	NA	NA	NA
VEB74191.1|2568476_2569565_-	RecF/RecN/SMC domain protein	NA	A0A077SLJ9	Escherichia_phage	96.7	1.9e-204
VEB74194.1|2569651_2569912_-	putative K+ transporting ATPase, KdpC subunit	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
VEB74196.1|2569895_2570027_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB74199.1|2570208_2571069_+	beta-lactamase	NA	A0A077SL40	Escherichia_phage	88.8	2.8e-142
VEB74202.1|2571089_2571851_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.4	2.0e-131
VEB74205.1|2572111_2573014_+	YgbJ	NA	A0A077SLF7	Escherichia_phage	97.7	1.8e-155
VEB74208.1|2573025_2574291_+	YgbK domain protein	NA	A0A077SLJ7	Escherichia_phage	92.6	2.7e-218
VEB74210.1|2574283_2574904_+	ribulose-5-phosphate 4-epimerase	NA	A0A077SK32	Escherichia_phage	95.6	3.1e-111
>prophage 4
LR134196	Klebsiella pneumoniae strain NCTC11357 genome assembly, chromosome: 1	5124551	2950128	3029100	5124551	tail,capsid,integrase,protease,terminase,tRNA,plate,portal	Enterobacteria_phage(40.48%)	84	2988659:2988675	3025366:3025382
VEB75270.1|2950128_2951982_+|protease	protease	protease	NA	NA	NA	NA
VEB75273.1|2952120_2953140_+	L-asparaginase	NA	NA	NA	NA	NA
VEB75276.1|2953149_2953791_+	nicotinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	1.9e-18
VEB75279.1|2953961_2955215_+	putative chitinase II	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	26.3	7.0e-25
VEB75282.1|2955378_2955723_+	cytoplasmic protein	NA	NA	NA	NA	NA
VEB75285.1|2955816_2956095_-	Protein of uncharacterised function (DUF1315)	NA	NA	NA	NA	NA
VEB75288.1|2956138_2956552_-	Peptide methionine sulfoxide reductase MsrB	NA	NA	NA	NA	NA
VEB75292.1|2956890_2957886_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VEB75295.1|2957960_2958845_+	aldose 1-epimerase family protein YeaD	NA	NA	NA	NA	NA
VEB75296.1|2958905_2959757_-	putative an aldehyde reductase	NA	A0A1V0SDE7	Indivirus	24.9	1.5e-15
VEB75299.1|2959851_2960598_-	MltA-interacting protein MipA	NA	NA	NA	NA	NA
VEB75302.1|2961014_2962949_+	Serine protein kinase (prkA protein)	NA	NA	NA	NA	NA
VEB75305.1|2963034_2964321_+	YeaH	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
VEB75308.1|2964572_2965055_+	putative glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	38.4	7.8e-17
VEB75311.1|2965202_2965763_-	Lactoylglutathione lyase related lyase	NA	NA	NA	NA	NA
VEB75315.1|2965889_2966201_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
VEB75318.1|2966459_2967341_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB75319.1|2967516_2968707_+	putative integral membrane transport protein	NA	NA	NA	NA	NA
VEB75322.1|2968703_2969720_-	acyl-coenzyme A:6-aminopenicillanic acid acyl-transferase	NA	NA	NA	NA	NA
VEB75325.1|2969741_2970470_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	44.6	1.6e-37
VEB75329.1|2970466_2971123_-	glutamine ABC transporter permease	NA	NA	NA	NA	NA
VEB75332.1|2971174_2971927_-	glutamine ABC transporter periplasmic glutamine-binding protein	NA	NA	NA	NA	NA
VEB75336.1|2972054_2972609_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75339.1|2972605_2973934_-	class III aminotransferase	NA	NA	NA	NA	NA
VEB75342.1|2974062_2974920_-	transcriptional regulator RpiR family	NA	NA	NA	NA	NA
VEB75345.1|2975044_2975953_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB75348.1|2976053_2977163_+	FAD/FMN-binding oxidoreductase	NA	NA	NA	NA	NA
VEB75352.1|2977165_2977759_+	Predicted ester cyclase	NA	NA	NA	NA	NA
VEB75355.1|2977847_2978597_-	3-oxoacyl-ACP reductase	NA	A0A0M4JSW6	Mollivirus	29.8	1.1e-14
VEB75358.1|2979675_2980941_-	Error-prone, lesion bypass DNA polymerase V (UmuC)	NA	I6RSM4	Salmonella_phage	79.4	4.5e-197
VEB75361.1|2980943_2981363_-	Error-prone repair protein UmuD	NA	A0A1W6JNS2	Morganella_phage	56.7	1.6e-34
VEB75364.1|2981633_2981876_+	virulence protein	NA	Q6UAW0	Klebsiella_phage	73.4	1.1e-27
VEB75366.1|2982046_2983183_-	heptosyltransferase family protein	NA	NA	NA	NA	NA
VEB75369.1|2983429_2983930_+|tRNA	YbaK/prolyl-tRNA synthetase-associated domain protein	tRNA	NA	NA	NA	NA
VEB75371.1|2984047_2984494_+	inner membrane protein	NA	NA	NA	NA	NA
VEB75374.1|2984477_2985269_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VEB75377.1|2985370_2986555_+	cyanate transporter CynX family	NA	NA	NA	NA	NA
VEB75380.1|2986586_2987279_-	CTP synthase	NA	NA	NA	NA	NA
VEB75383.1|2987424_2987934_+	Purine nucleoside phosphorylase	NA	NA	NA	NA	NA
VEB75386.1|2987920_2988277_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
VEB75389.1|2988266_2988506_-	lipoprotein	NA	NA	NA	NA	NA
2988659:2988675	attL	CCCGACGGGGCTTTTTT	NA	NA	NA	NA
VEB75392.1|2989066_2990206_-	late control gene D protein	NA	B9A7A9	Serratia_phage	70.7	2.7e-145
VEB75395.1|2990360_2991533_+|tail	phage tail sheath protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	2.9e-158
VEB75398.1|2991532_2992048_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	60.6	4.8e-57
VEB75402.1|2992093_2992411_+	Tail protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
VEB75405.1|2992714_2995531_+	phage protein	NA	A0A0A7NRZ9	Enterobacteria_phage	46.3	3.4e-205
VEB75408.1|2995546_2996038_+|tail	putative bacteriophage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
VEB75411.1|2996282_2997641_+	Uncharacterised protein	NA	A0A1W6JNS5	Morganella_phage	28.9	4.4e-49
VEB75414.1|2997794_2998892_-	Tail fiber protein	NA	G4KKN6	Yersinia_phage	71.1	4.0e-08
VEB75417.1|2998891_2999104_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75420.1|2999100_3002127_-|tail	putative prophage tail protein	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
VEB75422.1|3002116_3003040_-|plate	baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
VEB75425.1|3003041_3003392_-|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
VEB75428.1|3003388_3003976_-|plate	baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.0	2.8e-61
VEB75431.1|3003972_3004608_-|tail	putative prophage, tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	52.4	7.8e-57
VEB75434.1|3004604_3005072_-|tail	P2 phage tail completion protein R	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	4.1e-47
VEB75437.1|3005072_3005393_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75440.1|3005594_3006140_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	1.3e-31
VEB75443.1|3006136_3006415_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75446.1|3006411_3006612_-|tail	phage tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	61.5	3.5e-16
VEB75449.1|3006611_3007127_-|capsid	capsid completion protein	capsid	A0A0A7NPU2	Enterobacteria_phage	48.8	5.4e-40
VEB75452.1|3007231_3008098_-|terminase	phage terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.1	2.9e-70
VEB75456.1|3008147_3009182_-|capsid	phage capsid protein	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
VEB75459.1|3009191_3010031_-|capsid	Presumed capsid scaffolding protein (GpO)	capsid	A0A0A7NRY7	Enterobacteria_phage	66.7	6.6e-96
VEB75462.1|3010187_3011915_+|terminase	terminase, ATPase subunit	terminase	A0A0A7NV54	Enterobacteria_phage	68.1	4.1e-233
VEB75465.1|3011917_3012970_+|portal	phage portal protein, PBSX family	portal	A0A0A7NPT9	Enterobacteria_phage	69.3	1.8e-143
VEB75468.1|3013447_3014194_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75473.1|3015120_3016137_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75476.1|3016120_3017551_-	Uncharacterized conserved protein	NA	Q2P9X8	Enterobacteria_phage	39.6	2.5e-18
VEB75479.1|3018323_3020471_-	replication protein A	NA	A0A1S6L028	Salmonella_phage	63.7	9.8e-245
VEB75482.1|3020508_3021444_-	methyl-directed repair DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.7	8.4e-84
VEB75485.1|3021440_3021668_-	Uncharacterised protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
VEB75488.1|3021676_3022243_-	exodeoxyribonuclease VIII	NA	D4HTX2	Vibrio_phage	32.6	2.8e-13
VEB75491.1|3022239_3022464_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75495.1|3022532_3022805_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75498.1|3022820_3023198_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75501.1|3023213_3023432_-	Uncharacterised protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
VEB75505.1|3023452_3023731_-	Regulatory phage protein cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
VEB75508.1|3024266_3025280_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.4	3.8e-154
VEB75511.1|3025513_3026527_+	GAF domain/diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.1	9.3e-12
3025366:3025382	attR	CCCGACGGGGCTTTTTT	NA	NA	NA	NA
VEB75515.1|3026584_3026686_+	membrane protein	NA	NA	NA	NA	NA
VEB75518.1|3027063_3027327_-	inner membrane protein	NA	NA	NA	NA	NA
VEB75521.1|3027457_3028096_-	transport protein	NA	NA	NA	NA	NA
VEB75524.1|3028185_3029100_-	putative lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	49.6	1.2e-71
>prophage 5
LR134196	Klebsiella pneumoniae strain NCTC11357 genome assembly, chromosome: 1	5124551	3053101	3116707	5124551	tail,capsid,terminase,holin,head,transposase,portal	Klebsiella_phage(51.52%)	58	NA	NA
VEB75602.1|3053101_3054166_-	MASE2 domain/diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	4.7e-14
VEB75605.1|3054590_3055706_-	phage protein	NA	A0A0P0IDN1	Klebsiella_phage	54.5	6.5e-99
VEB75608.1|3055785_3056028_-	phage protein	NA	NA	NA	NA	NA
VEB75611.1|3056089_3064906_-	gp24	NA	Q6UAW1	Klebsiella_phage	44.9	0.0e+00
VEB75614.1|3064968_3065562_-|tail	bacteriophage lambda tail assembly I	tail	K7PHE5	Enterobacteria_phage	75.6	2.2e-77
VEB75617.1|3065993_3066704_-	gp19	NA	Q6UAW4	Klebsiella_phage	90.7	1.7e-137
VEB75620.1|3066705_3067461_-	gp18	NA	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
VEB75623.1|3067457_3067796_-|tail	minor tail family protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
VEB75626.1|3067795_3071131_-	phage tape measure protein	NA	Q6UAW7	Klebsiella_phage	87.7	0.0e+00
VEB75629.1|3071363_3071729_-|tail	phage tail assembly	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
VEB75632.1|3071786_3072248_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
VEB75635.1|3072279_3072681_-	phage protein, HK97 gp10 family	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
VEB75639.1|3072677_3073067_-	Uncharacterised protein	NA	Q6UAX2	Klebsiella_phage	85.3	2.1e-57
VEB75641.1|3073047_3073386_-	Uncharacterised protein	NA	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
VEB75644.1|3073382_3073700_-|head,tail	Phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
VEB75647.1|3073680_3073968_-	Gp7	NA	Q6UAX5	Klebsiella_phage	79.6	2.5e-18
VEB75650.1|3074026_3075313_-|capsid	putative major capsid protein	capsid	Q6UAX6	Klebsiella_phage	85.7	9.1e-206
VEB75653.1|3075390_3076311_-	serine peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	4.8e-148
VEB75656.1|3076347_3077607_-|portal	phage portal protein, HK97 family	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
VEB75658.1|3077779_3079501_-|terminase	putative phage terminase, large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
VEB75661.1|3079500_3079935_-|terminase	putative phage terminase, small subunit, P27 family protein	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
VEB75664.1|3080183_3080615_-	Uncharacterised protein	NA	Q6UAS0	Klebsiella_phage	62.7	1.1e-41
VEB75667.1|3081410_3081635_-	DNA gyrase subunit beta	NA	NA	NA	NA	NA
VEB75670.1|3083008_3083359_-	Uncharacterised protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
VEB75673.1|3083355_3083859_-	phage lysozyme	NA	K7P7Q3	Enterobacteria_phage	82.0	7.0e-77
VEB75676.1|3083830_3084100_-|holin	holin domain protein	holin	K7P6H9	Enterobacteria_phage	85.9	4.2e-36
VEB75678.1|3085036_3085558_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75681.1|3085574_3086429_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75685.1|3086457_3086802_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	1.8e-55
VEB75688.1|3086814_3087846_-	Protein of uncharacterised function (DUF968)	NA	S5MW46	Escherichia_phage	49.3	2.1e-96
VEB75691.1|3088045_3088438_-	LexA DNA binding domain-containing protein	NA	K7PHB4	Enterobacterial_phage	36.6	2.7e-12
VEB75694.1|3088780_3089014_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	68.4	1.0e-22
VEB75697.1|3089481_3090528_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
VEB75700.1|3090876_3092367_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75703.1|3092366_3094019_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75706.1|3094197_3094824_+|transposase	transposase	transposase	NA	NA	NA	NA
VEB75708.1|3095614_3096055_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75710.1|3096525_3097509_-	primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	53.4	2.2e-42
VEB75713.1|3097560_3098115_-	Protein of uncharacterised function (DUF1019)	NA	NA	NA	NA	NA
VEB75716.1|3098434_3098824_+	DNA-binding protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
VEB75719.1|3099123_3099246_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75723.1|3099547_3099670_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB75726.1|3099666_3099861_+	secreted protein	NA	NA	NA	NA	NA
VEB75729.1|3099876_3100248_+	transcriptional regulator	NA	NA	NA	NA	NA
VEB75733.1|3100389_3102525_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.6	1.1e-99
VEB75736.1|3104048_3105299_-	Isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
VEB75739.1|3105539_3106190_+	ribosomal large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
VEB75743.1|3106206_3106665_+	nudix-like NDP and NTP phosphohydrolase YmfB	NA	NA	NA	NA	NA
VEB75746.1|3106661_3107828_+	thiouridylase	NA	NA	NA	NA	NA
VEB75749.1|3107882_3108524_+	putative lysogenization regulator	NA	NA	NA	NA	NA
VEB75753.1|3108527_3109898_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.6e-107
VEB75756.1|3109952_3110315_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
VEB75759.1|3110398_3111205_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VEB75762.1|3111487_3112159_+	DNA-binding transcriptional regulator PhoP	NA	NA	NA	NA	NA
VEB75765.1|3112158_3113625_+	sensor protein PhoQ	NA	NA	NA	NA	NA
VEB75767.1|3113710_3114832_+	putative enzyme	NA	NA	NA	NA	NA
VEB75770.1|3115087_3115579_-|transposase	transposase-like protein	transposase	NA	NA	NA	NA
VEB75773.1|3116215_3116707_-|transposase	transposase-like protein	transposase	NA	NA	NA	NA
>prophage 6
LR134196	Klebsiella pneumoniae strain NCTC11357 genome assembly, chromosome: 1	5124551	3345040	3354503	5124551	protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
VEB76384.1|3345040_3346762_+	transport ATP-binding protein CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	1.7e-13
VEB76387.1|3346801_3347506_+	leucyltransferase	NA	NA	NA	NA	NA
VEB76389.1|3347856_3348075_+	translation initiation factor 1	NA	NA	NA	NA	NA
VEB76392.1|3348199_3350479_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.8e-165
VEB76395.1|3350509_3350827_-|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	9.0e-14
VEB76399.1|3351152_3351374_+	Cold shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
VEB76401.1|3351450_3353391_-	macrolide export ATP-binding/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
VEB76405.1|3353387_3354503_-	macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
LR134196	Klebsiella pneumoniae strain NCTC11357 genome assembly, chromosome: 1	5124551	4460633	4526271	5124551	integrase,transposase,tRNA	Enterobacteria_phage(15.79%)	58	4513470:4513503	4530963:4530996
VEB78442.1|4460633_4461641_+|tRNA	tryptophanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEB78443.1|4461947_4463039_+	membrane fusion protein family auxiliary transport protein	NA	NA	NA	NA	NA
VEB78444.1|4463052_4465590_+	multidrug ABC transporter permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	4.7e-20
VEB78445.1|4465589_4466714_+	antibiotic transport system permease component	NA	NA	NA	NA	NA
VEB78446.1|4466755_4467073_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78447.1|4473693_4474815_+	cupin family protein	NA	NA	NA	NA	NA
VEB78448.1|4474872_4476312_-	sensor kinase CusS	NA	A0A1V0SGX0	Hokovirus	27.6	9.2e-13
VEB78449.1|4476301_4476985_-	DNA-binding transcriptional activator CusR	NA	W8CYM9	Bacillus_phage	36.0	1.0e-30
VEB78450.1|4477049_4478543_+	copper/silver efflux system outer membrane protein CusC	NA	NA	NA	NA	NA
VEB78451.1|4478560_4478905_+	copper-binding protein	NA	NA	NA	NA	NA
VEB78452.1|4478949_4480221_+	cobalt/zinc/cadmium efflux RND transporter, membrane fusion protein, CzcB family	NA	NA	NA	NA	NA
VEB78453.1|4480232_4483382_+	cobalt-zinc-cadmium resistance protein CzcA	NA	S5VTK5	Leptospira_phage	22.1	8.9e-61
VEB78454.1|4483454_4483802_+	cyanate transport	NA	NA	NA	NA	NA
VEB78455.1|4483811_4484345_-	outer membrane lipoprotein blc	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
VEB78456.1|4484462_4485191_+	MerR family regulatory protein	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
VEB78457.1|4485422_4485857_+	transcriptional regulator	NA	NA	NA	NA	NA
VEB78458.1|4485853_4486573_+	oxidoreductase	NA	NA	NA	NA	NA
VEB78459.1|4486569_4487829_+	amine oxidase, flavin-containing	NA	NA	NA	NA	NA
VEB78460.1|4487830_4488553_+	plasmid partition ParA protein	NA	NA	NA	NA	NA
VEB78461.1|4488549_4489770_+	S-adenosyl-L-methionine dependent methyltransferase	NA	NA	NA	NA	NA
VEB78462.1|4489766_4490252_+	Protein of uncharacterised function (DUF2878)	NA	NA	NA	NA	NA
VEB78463.1|4490248_4490773_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78464.1|4490769_4491321_+	lipoprotein	NA	NA	NA	NA	NA
VEB78465.1|4491317_4492277_+	membrane protein	NA	NA	NA	NA	NA
VEB78466.1|4492579_4493962_-	maltoporin	NA	NA	NA	NA	NA
VEB78467.1|4494292_4495612_-	Xylose isomerase	NA	NA	NA	NA	NA
VEB78468.1|4496023_4497478_+	xyloside transporter	NA	NA	NA	NA	NA
VEB78469.1|4497536_4499216_+	beta-xylosidase	NA	NA	NA	NA	NA
VEB78470.1|4499297_4499936_-	HNH endonuclease domain protein	NA	NA	NA	NA	NA
VEB78471.1|4500115_4500985_+	restriction endonuclease	NA	NA	NA	NA	NA
VEB78472.1|4501735_4502203_+|integrase	integrase	integrase	S5WIU1	Leptospira_phage	49.3	4.7e-35
VEB78473.1|4502461_4503850_-	NurA domain	NA	NA	NA	NA	NA
VEB78474.1|4503849_4505865_-	Domain of uncharacterised function DUF87	NA	NA	NA	NA	NA
VEB78475.1|4505861_4506830_-	Modification methylase PvuII	NA	NA	NA	NA	NA
VEB78476.1|4507157_4507442_+|transposase	ISEc14 transposase A	transposase	NA	NA	NA	NA
VEB78477.1|4507489_4508212_+|integrase	integrase catalytic subunit	integrase	U5P429	Shigella_phage	52.9	8.3e-63
VEB78478.1|4509011_4511195_+	recombination protein F	NA	Q858T2	Yersinia_virus	21.4	1.2e-08
VEB78479.1|4511194_4512058_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78480.1|4512162_4512840_-|integrase	putative P4-type integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.4	4.9e-33
4513470:4513503	attL	ACTTGGTGCCGAAGGCCGGACTCGAACCGGCACG	NA	NA	NA	NA
VEB78481.1|4513690_4514845_+|integrase	phage integrase family site-specific recombinase	integrase	NA	NA	NA	NA
VEB78482.1|4514926_4515541_-	MTH538 TIR-like domain (DUF1863)	NA	A0A0S2MYG4	Enterococcus_phage	30.8	3.0e-13
VEB78483.1|4515540_4516269_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78484.1|4516821_4517121_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78485.1|4517104_4517950_-	Pathogenesis-related transcriptional factor and ERF protein	NA	M4T2H2	Vibrio_phage	35.6	8.3e-06
VEB78486.1|4517961_4518471_-	Pathogenesis-related transcriptional factor and ERF protein	NA	A0A1P8VWA3	Klebsiella_phage	42.9	3.2e-21
VEB78487.1|4518487_4518718_-	Uncharacterised protein	NA	A0A088FAD6	Enterobacteria_phage	52.2	8.5e-14
VEB78488.1|4518704_4518803_-	Uncharacterised protein	NA	A0A088FAD6	Enterobacteria_phage	71.0	8.6e-08
VEB78489.1|4518870_4519218_-	Uncharacterised protein	NA	H9C0S3	Aeromonas_phage	52.7	3.3e-25
VEB78490.1|4520069_4520417_+|transposase	ISEc8 transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
VEB78491.1|4520466_4522005_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	2.1e-273
VEB78492.1|4521911_4522520_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78493.1|4522523_4522763_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78494.1|4522775_4523009_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78495.1|4523008_4523575_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78496.1|4523571_4523748_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78497.1|4523744_4523954_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78498.1|4523997_4524093_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB78499.1|4524426_4526271_-	ATP-dependent DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	25.2	1.6e-17
4530963:4530996	attR	ACTTGGTGCCGAAGGCCGGACTCGAACCGGCACG	NA	NA	NA	NA
