The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	162359	230013	4731931	protease,tRNA,transposase	Escherichia_phage(40.0%)	54	NA	NA
VEB52788.1|162359_163271_+|tRNA	glycine tRNA synthetase	tRNA	NA	NA	NA	NA
VEB52790.1|163280_165350_+|tRNA	glycine-tRNA synthetase, beta subunit	tRNA	NA	NA	NA	NA
VEB52792.1|166476_166998_-|transposase	transposase subunit	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
VEB52794.1|167077_167230_+	small toxic polypeptide	NA	NA	NA	NA	NA
VEB52796.1|167907_168198_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VEB52798.1|168631_169342_+	putative lipoprotein	NA	NA	NA	NA	NA
VEB52800.1|169391_170366_-	2-ketoaldonate reductase/glyoxylate reductase B	NA	NA	NA	NA	NA
VEB52802.1|170469_171129_-	putative outer membrane protein	NA	NA	NA	NA	NA
VEB52804.1|171281_173615_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.6	1.1e-71
VEB52806.1|173583_174024_-	putative acetyltransferase	NA	NA	NA	NA	NA
VEB52808.1|174020_174584_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
VEB52810.1|174741_175440_+	lipase	NA	NA	NA	NA	NA
VEB52812.1|175668_176877_+	transporter	NA	NA	NA	NA	NA
VEB52814.1|177200_178892_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
VEB52816.1|179804_180551_+	dipeptide ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
VEB52818.1|180492_181413_+	dipeptide ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
VEB52820.1|181720_182740_+	dipeptide transporter permease DppB	NA	NA	NA	NA	NA
VEB52822.1|182749_183652_+	dipeptide ABC transporter permease	NA	NA	NA	NA	NA
VEB52824.1|183662_184646_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
VEB52826.1|184642_185647_+	dipeptide transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
VEB52828.1|185676_186948_-	transport protein YhjV	NA	NA	NA	NA	NA
VEB52830.1|187423_187531_+	toxic polypeptide	NA	NA	NA	NA	NA
VEB52832.1|187617_188190_-	cellulose biosynthesis endoglucanase	NA	NA	NA	NA	NA
VEB52834.1|188200_189199_-	cellulose biosynthesis endoglucanase	NA	NA	NA	NA	NA
VEB52836.1|189195_189387_-	membrane protein YhjT	NA	NA	NA	NA	NA
VEB52838.1|189383_190943_-|protease	cellulose biosynthesis protease	protease	NA	NA	NA	NA
VEB52840.1|191227_191416_+	Protein of uncharacterised function (DUF2629)	NA	NA	NA	NA	NA
VEB52842.1|191427_192180_+	cell division protein	NA	NA	NA	NA	NA
VEB52844.1|192176_194795_+	cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
VEB52846.1|194835_197145_+	cellulose synthase regulator protein	NA	NA	NA	NA	NA
VEB52848.1|197151_198258_+	endo-1,4-D-glucanase	NA	NA	NA	NA	NA
VEB52850.1|198239_201713_+	cellulose synthase subunit BcsC	NA	NA	NA	NA	NA
VEB52852.1|201833_203783_+	putative diguanylate cyclase	NA	NA	NA	NA	NA
VEB52854.1|203965_205252_+	C4-dicarboxylate transport protein	NA	NA	NA	NA	NA
VEB52856.1|205472_206969_+|protease	putative protease	protease	NA	NA	NA	NA
VEB52858.1|207064_207994_-	ketodeoxygluconokinase	NA	NA	NA	NA	NA
VEB52860.1|208225_208993_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
VEB52862.1|209062_211123_+	putative outer membrane assembly protein	NA	NA	NA	NA	NA
VEB52864.1|211304_212627_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEB52866.1|213037_214051_-|tRNA	tRNA-processing ribonuclease	tRNA	NA	NA	NA	NA
VEB52868.1|214099_214999_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB52870.1|215518_216121_+	transcriptional regulator	NA	NA	NA	NA	NA
VEB52871.1|216171_217821_-	cytoplasmic trehalase	NA	NA	NA	NA	NA
VEB52873.1|218225_219701_+	putative cytochrome C peroxidase	NA	A0A2L1IV26	Escherichia_phage	52.9	7.7e-07
VEB52875.1|219635_220013_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB52877.1|220057_220333_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB52879.1|220610_222011_+	glutamate decarboxylase beta	NA	NA	NA	NA	NA
VEB52881.1|222380_223205_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VEB52883.1|223572_224301_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VEB52885.1|224663_227777_-	multidrug resistance protein	NA	NA	NA	NA	NA
VEB52887.1|227801_228959_-	multidrug resistance protein	NA	NA	NA	NA	NA
VEB52889.1|229018_229297_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB52891.1|229297_229696_-	DNA-binding transcriptional activator	NA	NA	NA	NA	NA
VEB52893.1|229737_230013_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
>prophage 2
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	747861	777482	4731931	protease,transposase	uncultured_virus(66.67%)	34	NA	NA
VEB53956.1|747861_748356_+|protease	hydrogenase 2 maturation protease	protease	NA	NA	NA	NA
VEB53958.1|748348_748837_+	hydrogenase-2 component protein	NA	NA	NA	NA	NA
VEB53960.1|748829_749171_+	hydrogenase nickel incorporation protein HybF	NA	NA	NA	NA	NA
VEB53962.1|749183_749432_+	hydrogenase-2 component protein	NA	NA	NA	NA	NA
VEB53964.1|749554_750421_-	glutathione S-transferase	NA	NA	NA	NA	NA
VEB53966.1|750625_752485_+	bifunctional glutathionylspermidine synthetase/amidase [includes glutathionylspermidine synthase;glutathionylspermidine amidase]	NA	NA	NA	NA	NA
VEB53968.1|752520_752898_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB53970.1|752942_753218_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB53972.1|753251_754400_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB53974.1|754540_754681_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB53976.1|755030_756224_-	salicylate hydroxylase	NA	NA	NA	NA	NA
VEB53978.1|756238_756883_-	glutathione-S-transferase	NA	NA	NA	NA	NA
VEB53981.1|756891_757593_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
VEB53983.1|757608_758637_-	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
VEB53985.1|758648_760007_-	major facilitator transporter	NA	NA	NA	NA	NA
VEB53987.1|760133_761042_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB53989.1|761773_762049_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VEB53991.1|762083_762230_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB53993.1|762229_762559_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB53995.1|762545_762938_+	IS66 Orf2 family protein	NA	NA	NA	NA	NA
VEB53997.1|762968_764063_+	ISSfl3 OrfC	NA	A0A218MNE7	uncultured_virus	33.6	1.1e-34
VEB53999.1|764065_764545_+	ISSfl3 OrfC	NA	A0A218MNE7	uncultured_virus	41.9	8.8e-29
VEB54001.1|765451_765682_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54003.1|766382_766574_+|transposase	transposase	transposase	NA	NA	NA	NA
VEB54005.1|767528_767693_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54007.1|767931_769329_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54009.1|769489_771274_+	KAP family protein	NA	NA	NA	NA	NA
VEB54012.1|771273_772026_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54014.1|772007_773327_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54016.1|773323_774049_+	TatD-related deoxyribonuclease	NA	NA	NA	NA	NA
VEB54018.1|774602_775178_-	putative sporulation protein YtaF	NA	NA	NA	NA	NA
VEB54020.1|775185_776514_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54022.1|776648_777047_-|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	60.5	1.9e-40
VEB54024.1|777176_777482_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	1033138	1040278	4731931	tRNA	Escherichia_phage(83.33%)	6	NA	NA
VEB54512.1|1033138_1033777_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VEB54514.1|1033773_1035036_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
VEB54516.1|1035032_1035941_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
VEB54518.1|1036136_1036904_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
VEB54520.1|1036954_1037611_-	serine/threonine-specific protein phosphatase 2	NA	A0A077SLQ6	Escherichia_phage	46.1	9.5e-50
VEB54522.1|1037716_1040278_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 4
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	1124170	1144680	4731931	integrase,transposase	Shigella_phage(25.0%)	20	1119152:1119165	1146070:1146083
1119152:1119165	attL	AATATCATTTATCC	NA	NA	NA	NA
VEB54694.1|1124170_1124536_-|transposase	transposase	transposase	Q76S41	Shigella_phage	99.2	1.6e-59
VEB54696.1|1124779_1126192_+	CP4-57 prophage protein	NA	NA	NA	NA	NA
VEB54698.1|1126457_1126736_+	Predicted transcriptional regulator	NA	NA	NA	NA	NA
VEB54700.1|1126832_1127552_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54702.1|1127628_1128099_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54704.1|1128251_1128368_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54706.1|1128364_1129231_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VEB54708.1|1129227_1129527_-|transposase	transposase	transposase	NA	NA	NA	NA
VEB54710.1|1129589_1130138_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VEB54712.1|1130374_1131259_-	HSR1-like GTP-binding protein	NA	NA	NA	NA	NA
VEB54714.1|1131404_1131545_-|transposase	transposase	transposase	NA	NA	NA	NA
VEB54716.1|1131567_1132680_-|transposase	IS186, transposase	transposase	NA	NA	NA	NA
VEB54718.1|1132773_1133013_-	phage transcriptional regulator AlpA	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
VEB54720.1|1133126_1134008_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54722.1|1134275_1135187_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54724.1|1135232_1137515_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54726.1|1137627_1139085_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54728.1|1139552_1139900_+	addiction module	NA	NA	NA	NA	NA
VEB54730.1|1139982_1143300_+	addiction module	NA	NA	NA	NA	NA
VEB54732.1|1143438_1144680_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
1146070:1146083	attR	GGATAAATGATATT	NA	NA	NA	NA
>prophage 5
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	1539810	1545957	4731931		Pseudomonas_phage(33.33%)	8	NA	NA
VEB55503.1|1539810_1540887_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
VEB55505.1|1540928_1541135_-	yfaH	NA	NA	NA	NA	NA
VEB55507.1|1541349_1542000_+	pH-inducible protein involved in stress response (putative kinase)	NA	NA	NA	NA	NA
VEB55509.1|1542053_1542308_-	putative ferredoxin	NA	G9IAA2	Pseudomonas_phage	74.6	2.6e-24
VEB55511.1|1542307_1542844_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	82.5	9.1e-83
VEB55513.1|1542833_1543439_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H5BKL3	Erwinia_phage	78.6	2.0e-86
VEB55515.1|1543672_1545070_-	ribonucleoside-diphosphate reductase	NA	A0A2D1GNB1	Pseudoalteromonas_phage	59.8	1.7e-160
VEB55517.1|1545276_1545957_-	ribonucleoside-diphosphate reductase	NA	A0A1W5PTL2	Pseudoalteromonas_phage	67.8	7.2e-85
>prophage 6
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	1673393	1682837	4731931		Enterobacteria_phage(88.89%)	12	NA	NA
VEB55742.1|1673393_1674320_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
VEB55744.1|1674324_1675056_+	ABC transporter permease	NA	NA	NA	NA	NA
VEB55746.1|1675036_1675144_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEB55748.1|1675203_1675437_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	97.0	2.1e-12
VEB55750.1|1675447_1675936_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.8	3.2e-87
VEB55752.1|1676157_1677843_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VEB55754.1|1677839_1678559_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEB55756.1|1678605_1679076_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VEB55758.1|1679116_1679578_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
VEB55760.1|1679702_1680368_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	97.2	1.7e-110
VEB55762.1|1680309_1681704_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.3	3.2e-257
VEB55764.1|1681700_1682837_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 7
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	1772729	1779026	4731931		Enterobacteria_phage(50.0%)	6	NA	NA
VEB55917.1|1772729_1774124_+	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	33.2	2.8e-19
VEB55919.1|1774298_1775174_+	UTP--glucose-1-phosphate uridylyltransferase subunit GalF	NA	A0A127AW70	Bacillus_phage	42.8	1.2e-44
VEB55921.1|1775564_1776650_+	dTDP-D-glucose 4,6-dehydratase rmlB	NA	I7HTA3	Enterobacteria_phage	53.6	9.7e-100
VEB55923.1|1776649_1777549_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	6.3e-28
VEB55925.1|1777606_1778485_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.2	6.0e-108
VEB55927.1|1778489_1779026_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	8.3e-52
>prophage 8
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	1824484	1879442	4731931	transposase	Escherichia_phage(20.0%)	53	NA	NA
VEB56022.1|1824484_1825507_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
VEB56024.1|1825506_1826286_+	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.6	1.0e-138
VEB56026.1|1827214_1827817_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56028.1|1827910_1828117_-	InterPro motifs Prophage CP4-57 regulatory protein (AlpA)	NA	NA	NA	NA	NA
VEB56030.1|1829249_1829444_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56032.1|1829642_1830212_+	malate transporter	NA	NA	NA	NA	NA
VEB56034.1|1830471_1830873_+	ybl85	NA	NA	NA	NA	NA
VEB56036.1|1830860_1831262_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VEB56038.1|1832074_1832932_+|transposase	transposase	transposase	NA	NA	NA	NA
VEB56040.1|1833583_1834618_-	phosphotriesterase	NA	NA	NA	NA	NA
VEB56042.1|1834620_1834884_-	Putative inner membrane protein	NA	NA	NA	NA	NA
VEB56044.1|1834977_1835586_-	Putative inner membrane protein	NA	NA	NA	NA	NA
VEB56046.1|1835687_1836593_-	IS2 element protein	NA	Q9ZXG3	Shigella_phage	96.0	6.1e-172
VEB56048.1|1836550_1836916_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VEB56050.1|1836957_1837737_-	cytoplasmic protein	NA	NA	NA	NA	NA
VEB56052.1|1838204_1838699_-	carbohydrate kinase	NA	NA	NA	NA	NA
VEB56054.1|1838723_1838966_-	Lactose phosphotransferase system repressor	NA	NA	NA	NA	NA
VEB56056.1|1839160_1839277_-|transposase	putative transposase, ISEc23	transposase	A0A0P0ZBS5	Stx2-converting_phage	70.6	6.0e-08
VEB56058.1|1841018_1841561_+	bifunctional adenosylcobalamin biosynthesis protein [includes adenosylcobinamide kinase; adenosylcobinamide-phosphate guanylyltransferase]	NA	NA	NA	NA	NA
VEB56060.1|1841557_1842301_+	cobalamin synthase	NA	NA	NA	NA	NA
VEB56062.1|1842312_1843392_+	Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
VEB56064.1|1843453_1844389_+	ErfK/YbiS/YcfS/YnhG family protein	NA	NA	NA	NA	NA
VEB56066.1|1844847_1845765_+	Nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
VEB56068.1|1845866_1846817_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB56070.1|1847123_1848578_+	multidrug efflux system	NA	NA	NA	NA	NA
VEB56072.1|1849204_1849921_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEB56074.1|1850263_1851718_-	AMP nucleosidase	NA	NA	NA	NA	NA
VEB56076.1|1851819_1852494_-	shikimate transporter	NA	NA	NA	NA	NA
VEB56078.1|1852494_1853136_-	shikimate transporter	NA	NA	NA	NA	NA
VEB56080.1|1853450_1854503_+	ADP-heptose--LPS heptosyltransferase-like protein	NA	NA	NA	NA	NA
VEB56082.1|1854765_1857633_-	putative adhesin	NA	NA	NA	NA	NA
VEB56084.1|1857629_1861184_-	putative invasin	NA	NA	NA	NA	NA
VEB56086.1|1861191_1861575_-	adhesin	NA	NA	NA	NA	NA
VEB56088.1|1861647_1862220_-	adhesin	NA	NA	NA	NA	NA
VEB56090.1|1862216_1862774_-	adhesin	NA	NA	NA	NA	NA
VEB56092.1|1863234_1864032_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
VEB56094.1|1864784_1865315_-	cytochrome	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
VEB56096.1|1865657_1866308_-	metal ABC transporter substrate binding protein	NA	NA	NA	NA	NA
VEB56098.1|1866564_1867200_-	sulfite oxidase subunit YedZ	NA	NA	NA	NA	NA
VEB56099.1|1867200_1868205_-	putative oxidoreductase	NA	NA	NA	NA	NA
VEB56101.1|1868313_1868727_-	transthyretin-like protein	NA	NA	NA	NA	NA
VEB56103.1|1868748_1869531_+	transcriptional regulatory protein YedW	NA	W8CYM9	Bacillus_phage	35.2	4.8e-32
VEB56105.1|1869530_1870889_+	two-component sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	2.3e-05
VEB56107.1|1870986_1871838_-	chaperone protein	NA	NA	NA	NA	NA
VEB56109.1|1872349_1873168_-|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
VEB56111.1|1873307_1874459_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VEB56113.1|1874378_1874729_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
VEB56115.1|1874780_1875455_-	Outer membrane protein N precursor	NA	Q1MVN1	Enterobacteria_phage	45.2	7.5e-50
VEB56117.1|1875448_1875841_-	Outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	49.5	6.5e-22
VEB56119.1|1876468_1876771_+	inner membrane protein YedR	NA	NA	NA	NA	NA
VEB56121.1|1876810_1877506_+	putative phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	26.9	1.6e-07
VEB56123.1|1877572_1878991_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
VEB56125.1|1878971_1879442_+	patch repair protein	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
>prophage 9
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	1899553	1943468	4731931	integrase,transposase	Helicobacter_phage(10.0%)	47	1923303:1923317	1932656:1932670
VEB56182.1|1899553_1900102_-|transposase	transposase ORF A, IS609 family	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	1.8e-33
VEB56184.1|1900160_1900430_+|transposase	IS605 family transposase OrfB	transposase	A0A1W6JP07	Morganella_phage	96.1	6.4e-37
VEB56186.1|1900311_1900809_-	Uncharacterised ACR, COG2135	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	5.9e-52
VEB56188.1|1900917_1901151_-	SirA family protein	NA	NA	NA	NA	NA
VEB56190.1|1901147_1902353_-	inner membrane protein	NA	NA	NA	NA	NA
VEB56192.1|1902539_1902953_+	putative lipoprotein	NA	NA	NA	NA	NA
VEB56194.1|1902986_1904474_-	alpha-amylase	NA	NA	NA	NA	NA
VEB56196.1|1904551_1904917_-	flagellar protein FliT	NA	NA	NA	NA	NA
VEB56199.1|1904916_1905327_-	flagellar protein FliS	NA	NA	NA	NA	NA
VEB56201.1|1905342_1906758_-	flagellar capping protein	NA	NA	NA	NA	NA
VEB56205.1|1907005_1908055_+	Flagellin	NA	NA	NA	NA	NA
VEB56210.1|1908219_1908939_+	RNA polymerase sigma factor for flagellar operon	NA	NA	NA	NA	NA
VEB56216.1|1908984_1909536_+	FliZ protein	NA	NA	NA	NA	NA
VEB56220.1|1909566_1910424_+	cystine transporter subunit	NA	NA	NA	NA	NA
VEB56222.1|1910528_1911515_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
VEB56224.1|1911529_1912198_+	putative amino acid transport protein ABC superfamily	NA	NA	NA	NA	NA
VEB56226.1|1912194_1912947_+	putative cystine ABC-transporter, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
VEB56228.1|1913176_1913899_+	DNA-binding transcriptional activator SdiA	NA	NA	NA	NA	NA
VEB56230.1|1913965_1914190_-	conserved protein, DUF2594 family	NA	NA	NA	NA	NA
VEB56232.1|1914648_1915305_+	response regulator UvrY	NA	NA	NA	NA	NA
VEB56234.1|1915301_1917134_+	UvrABC system protein C	NA	NA	NA	NA	NA
VEB56236.1|1917190_1917739_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
VEB56238.1|1918434_1919037_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56240.1|1919255_1920458_+|integrase	integrase	integrase	NA	NA	NA	NA
VEB56242.1|1920489_1920741_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56244.1|1920835_1921207_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56246.1|1921232_1921766_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56248.1|1921838_1922273_+	Protein of uncharacterised function (DUF2787)	NA	NA	NA	NA	NA
VEB56250.1|1922883_1923702_-	Protein of uncharacterised function (DUF726)	NA	NA	NA	NA	NA
1923303:1923317	attL	TATCATTTTTAATAT	NA	NA	NA	NA
VEB56252.1|1923763_1924666_-	putative transcriptional regulator, HTH	NA	A0A0R6PH67	Moraxella_phage	31.5	9.7e-37
VEB56254.1|1925045_1925372_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56256.1|1925420_1928021_-	putative DNA-directed DNA polymerase	NA	NA	NA	NA	NA
VEB56258.1|1928067_1928706_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56260.1|1929046_1930174_-|integrase	phage integrase	integrase	A0A221SAN4	Ralstonia_phage	27.9	1.2e-15
VEB56262.1|1930317_1931448_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56264.1|1931954_1933121_-	Uncharacterised protein	NA	NA	NA	NA	NA
1932656:1932670	attR	TATCATTTTTAATAT	NA	NA	NA	NA
VEB56266.1|1933493_1935017_+	putative type I methylase	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	1.8e-88
VEB56268.1|1935006_1936239_+	putative restriction-modification DNA specificity domain protein	NA	NA	NA	NA	NA
VEB56270.1|1936235_1936451_+	putative metal-binding protein	NA	NA	NA	NA	NA
VEB56272.1|1936422_1936920_+	metal-binding protein	NA	NA	NA	NA	NA
VEB56274.1|1936864_1937662_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56276.1|1937717_1938728_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56278.1|1938797_1940282_+	putative type I restriction enzyme HsdR protein	NA	A0A220A398	Liberibacter_phage	28.4	1.1e-26
VEB56280.1|1940232_1942083_+	putative type I restriction enzyme HsdR protein	NA	NA	NA	NA	NA
VEB56282.1|1942079_1942835_+	putative hydrolase	NA	NA	NA	NA	NA
VEB56284.1|1942921_1943197_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	1.7e-45
VEB56286.1|1943261_1943468_+|transposase	transposase (partial)	transposase	Q716C2	Shigella_phage	92.6	1.3e-32
>prophage 10
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	2015828	2066395	4731931	protease,transposase,tail	Moraxella_phage(25.0%)	51	NA	NA
VEB56442.1|2015828_2017889_+|protease	protease II	protease	NA	NA	NA	NA
VEB56444.1|2017885_2018548_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
VEB56446.1|2018571_2019228_-	putative carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
VEB56448.1|2019329_2019560_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
VEB56450.1|2019698_2020073_+	putative copper resistance protein	NA	NA	NA	NA	NA
VEB56452.1|2020076_2020949_+	putative copper resistance protein	NA	NA	NA	NA	NA
VEB56455.1|2020961_2021303_+	protein	NA	NA	NA	NA	NA
VEB56457.1|2021698_2022355_+	serine/threonine protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
VEB56459.1|2022355_2022631_-	protein	NA	NA	NA	NA	NA
VEB56461.1|2022651_2022888_-	protein	NA	NA	NA	NA	NA
VEB56463.1|2023005_2024451_-	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
VEB56465.1|2024524_2027158_-	mce-like protein	NA	NA	NA	NA	NA
VEB56467.1|2027126_2028410_-	inner membrane protein	NA	NA	NA	NA	NA
VEB56469.1|2028485_2029037_+	putative signal transduction protein	NA	NA	NA	NA	NA
VEB56471.1|2029133_2029832_+	ProP effector protein	NA	NA	NA	NA	NA
VEB56473.1|2029851_2030574_+|tail,protease	tail-specific protease	tail,protease	NA	NA	NA	NA
VEB56475.1|2030570_2031899_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	40.2	1.7e-66
VEB56477.1|2032090_2032972_+	M48B family peptidase	NA	NA	NA	NA	NA
VEB56479.1|2033017_2034391_-	transporter	NA	NA	NA	NA	NA
VEB56481.1|2034567_2035359_+	IclR-family transcriptional regulator	NA	NA	NA	NA	NA
VEB56483.1|2035501_2035741_-	protein	NA	NA	NA	NA	NA
VEB56485.1|2036117_2036405_+	protein	NA	NA	NA	NA	NA
VEB56487.1|2037604_2038414_+	ribosomal RNA large subunit methyltransferase A	NA	NA	NA	NA	NA
VEB56489.1|2038410_2038977_-	inner membrane protein	NA	NA	NA	NA	NA
VEB56491.1|2039405_2039864_-	inner membrane protein	NA	NA	NA	NA	NA
VEB56493.1|2039918_2040770_-	mannose-specific PTS system EIID component	NA	NA	NA	NA	NA
VEB56495.1|2040782_2041583_-	mannose-specific PTS system transporter subunit IIC	NA	NA	NA	NA	NA
VEB56497.1|2041645_2042617_-	mannose-specific PTS system EIIAB component	NA	NA	NA	NA	NA
VEB56499.1|2042882_2043092_+	cytoplasmic protein	NA	NA	NA	NA	NA
VEB56501.1|2043079_2044636_+	membrane protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
VEB56503.1|2044639_2046238_-	putative signal transduction protein	NA	NA	NA	NA	NA
VEB56505.1|2046368_2047733_-	L-serine deaminase 1	NA	NA	NA	NA	NA
VEB56507.1|2047916_2048495_-	NUDIX-family hydrolase	NA	NA	NA	NA	NA
VEB56509.1|2048498_2049860_-	para-aminobenzoate synthase component I	NA	S4VT78	Pandoravirus	33.4	3.4e-41
VEB56511.1|2049933_2050113_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEB56513.1|2050232_2050532_-	protein	NA	NA	NA	NA	NA
VEB56515.1|2050953_2051298_-	putative translation initiation inhibitor	NA	NA	NA	NA	NA
VEB56517.1|2051429_2053340_+	putative ATP-binding protein	NA	A0A127AW80	Bacillus_phage	31.9	5.9e-92
VEB56519.1|2053397_2054093_+|protease	protease YeaZ	protease	NA	NA	NA	NA
VEB56521.1|2054132_2054714_+	putative lipoprotein	NA	NA	NA	NA	NA
VEB56523.1|2054852_2056310_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.2	6.8e-24
VEB56525.1|2056686_2057802_+	ribonuclease D	NA	NA	NA	NA	NA
VEB56527.1|2057855_2058821_-	putative oxidoreductase	NA	NA	NA	NA	NA
VEB56529.1|2058876_2060001_-	putative oxidoreductase	NA	NA	NA	NA	NA
VEB56531.1|2060032_2061643_-	BCCT-family transporter	NA	NA	NA	NA	NA
VEB56533.1|2061893_2062979_-	tartrate dehydrogenase/decarboxylase (D-malate dehydrogenase [decarboxylating])	NA	NA	NA	NA	NA
VEB56535.1|2063081_2064005_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB56537.1|2064131_2064770_+	putative transport protein	NA	NA	NA	NA	NA
VEB56539.1|2064942_2065107_+	Uncharacterized protein/domain, possibly involved in tellurite resistance	NA	NA	NA	NA	NA
VEB56541.1|2065119_2066232_+|transposase	IS186, transposase	transposase	NA	NA	NA	NA
VEB56543.1|2066254_2066395_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	2276211	2331143	4731931	portal,lysis,tail,head,protease,coat,terminase,transposase,capsid	Enterobacteria_phage(45.0%)	62	NA	NA
VEB57007.1|2276211_2277033_-|protease	putative protease	protease	NA	NA	NA	NA
VEB57009.1|2277308_2277617_-	acid shock protein	NA	NA	NA	NA	NA
VEB57011.1|2278040_2278544_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEB57013.1|2278620_2279295_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEB57015.1|2279401_2280295_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB57017.1|2280429_2281650_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VEB57019.1|2281774_2282470_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VEB57021.1|2282422_2283679_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VEB57023.1|2283873_2284488_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VEB57025.1|2284530_2285385_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VEB57027.1|2285386_2286004_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VEB57029.1|2286014_2288411_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	4.8e-208
VEB57031.1|2288498_2290925_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
VEB57033.1|2291123_2291429_-	protein	NA	NA	NA	NA	NA
VEB57035.1|2291500_2292247_+	lipoprotein	NA	NA	NA	NA	NA
VEB57037.1|2292249_2292810_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VEB57039.1|2292844_2293186_-	protein	NA	NA	NA	NA	NA
VEB57041.1|2293321_2293648_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
VEB57043.1|2293980_2294334_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	40.4	1.4e-15
VEB57045.1|2294362_2294638_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB57047.1|2294682_2295060_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB57049.1|2296269_2297121_+	IS150 protein InsAB	NA	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
VEB57051.1|2297163_2297376_+	putative prophage protein	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-28
VEB57053.1|2297592_2297844_+	putative prophage protein	NA	NA	NA	NA	NA
VEB57055.1|2298190_2299240_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	2.8e-112
VEB57057.1|2299253_2300006_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VEB57059.1|2300427_2300640_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VEB57061.1|2301918_2302125_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VEB57063.1|2302129_2302681_+	putative prophage protein	NA	Q08JA0	Stx2-converting_phage	50.0	1.5e-35
VEB57065.1|2302628_2302889_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57067.1|2303002_2303536_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
VEB57069.1|2303532_2304030_+	Qin prophage protein	NA	NA	NA	NA	NA
VEB57071.1|2305281_2305455_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VEB57073.1|2305750_2305957_+	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	77.9	7.6e-22
VEB57075.1|2306790_2307336_+	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
VEB57077.1|2307310_2309236_+|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
VEB57079.1|2309232_2309439_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VEB57081.1|2309435_2311037_+|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
VEB57083.1|2311017_2312337_+|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A2I6TC87	Escherichia_phage	98.2	4.0e-233
VEB57085.1|2312346_2312679_+	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
VEB57087.1|2312734_2313760_+|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
VEB57089.1|2313801_2314200_+	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.2e-57
VEB57091.1|2314211_2314565_+|capsid	minor capsid protein	capsid	A0A0K2FJB7	Enterobacteria_phage	97.4	6.4e-61
VEB57093.1|2314576_2315155_+|tail	minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.9e-79
VEB57095.1|2315151_2315547_+|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	5.5e-69
VEB57097.1|2315554_2316295_+|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.8e-129
VEB57099.1|2316310_2316733_+|tail	Minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
VEB57101.1|2316714_2317149_+|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	9.0e-65
VEB57103.1|2317141_2319703_+|tail	tail component of prophage	tail	A0A2R9YJM8	Escherichia_phage	88.8	0.0e+00
VEB57105.1|2319699_2320029_+|tail	Minor tail protein M	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
VEB57107.1|2320028_2320727_+|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
VEB57109.1|2320732_2321476_+|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
VEB57111.1|2321472_2322045_+|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
VEB57113.1|2322105_2325147_+|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	97.5	0.0e+00
VEB57114.1|2325300_2325522_+|tail	tail component of prophage CP-933K	tail	A0A291AWT4	Escherichia_phage	98.6	9.6e-31
VEB57116.1|2325591_2325858_+	membrane protein, Lom/All family	NA	K7PJP9	Enterobacteria_phage	96.9	1.2e-27
VEB57118.1|2325889_2326192_+	Lom-like outer membrane protein of prophage	NA	Q687E7	Enterobacteria_phage	100.0	2.7e-52
VEB57120.1|2326752_2327490_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57122.1|2327620_2329330_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	57.2	8.2e-77
VEB57124.1|2330001_2330256_-	DNA invertase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	40.0	3.8e-07
VEB57126.1|2330227_2330593_-	putative DNA-invertase	NA	NA	NA	NA	NA
VEB57128.1|2330909_2331143_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
>prophage 12
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	2446956	2509772	4731931	transposase	Moraxella_phage(15.38%)	59	NA	NA
VEB57342.1|2446956_2447334_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB57344.1|2447378_2447654_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB57346.1|2447704_2448256_-	putative glutathione S-transferase	NA	NA	NA	NA	NA
VEB57348.1|2448522_2450022_+	L-asparagine permease	NA	NA	NA	NA	NA
VEB57350.1|2450136_2451198_-	putative receptor	NA	NA	NA	NA	NA
VEB57352.1|2451439_2453542_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
VEB57355.1|2453577_2454243_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEB57357.1|2454440_2454947_-	Putative NADP-dependent oxidoreductase yncB	NA	NA	NA	NA	NA
VEB57359.1|2454960_2455479_-	putative zinc-binding dehydrogenase	NA	NA	NA	NA	NA
VEB57361.1|2455659_2456178_+	acetyltransferase yncA	NA	NA	NA	NA	NA
VEB57363.1|2456174_2456624_+	inner membrane protein	NA	NA	NA	NA	NA
VEB57365.1|2456624_2456858_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEB57367.1|2456943_2457117_-	inner membrane protein	NA	NA	NA	NA	NA
VEB57369.1|2457503_2458928_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
VEB57371.1|2458949_2459744_-	transporter permease	NA	NA	NA	NA	NA
VEB57373.1|2459733_2460216_-	ABC transporter permease	NA	NA	NA	NA	NA
VEB57375.1|2460216_2461230_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
VEB57377.1|2461247_2462393_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEB57379.1|2462587_2464045_-	transcriptional regulator protein YdcR	NA	NA	NA	NA	NA
VEB57381.1|2464123_2464561_-	putative transcriptional regulator	NA	A0A0R6PH90	Moraxella_phage	50.4	1.5e-30
VEB57383.1|2464924_2465095_+	protein	NA	NA	NA	NA	NA
VEB57385.1|2465186_2467190_-	putative peptidase	NA	Q6DW11	Phage_TP	28.6	1.6e-23
VEB57387.1|2467220_2467757_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VEB57389.1|2467848_2469024_+	putative benzoate transporter	NA	NA	NA	NA	NA
VEB57391.1|2469063_2470212_-|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	96.9	9.0e-205
VEB57393.1|2470279_2470786_+|transposase	transposase TnA	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	2.8e-41
VEB57395.1|2470803_2471472_-	putative lipoprotein	NA	NA	NA	NA	NA
VEB57397.1|2471774_2472368_-	tellurite resistance protein	NA	NA	NA	NA	NA
VEB57399.1|2472364_2473087_-	potassium-tellurite ethidium and proflavin transporter	NA	NA	NA	NA	NA
VEB57401.1|2473481_2473580_+	putative transferase	NA	NA	NA	NA	NA
VEB57403.1|2473533_2474463_+	putative transferase	NA	NA	NA	NA	NA
VEB57405.1|2474457_2474817_-	ribosomal-protein-serine acetyltransferase	NA	NA	NA	NA	NA
VEB57407.1|2474899_2474995_-	ribosomal-protein-serine N-acetyltransferase	NA	NA	NA	NA	NA
VEB57409.1|2475057_2475282_-	protein	NA	NA	NA	NA	NA
VEB57411.1|2475421_2477041_-	glucans biosynthesis protein D	NA	NA	NA	NA	NA
VEB57413.1|2477301_2478645_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEB57415.1|2478765_2479785_+	transcriptional regulator	NA	NA	NA	NA	NA
VEB57417.1|2479822_2480299_-	methyl-accepting chemotaxis protein III (ribose an galactose chemoreceptor protein)	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.3	1.4e-05
VEB57419.1|2480267_2480516_-	methyl-accepting chemotaxis protein III (ribose an galactose chemoreceptor protein)	NA	NA	NA	NA	NA
VEB57421.1|2480546_2481464_-	methyl-accepting chemotaxis protein III (ribose an galactose chemoreceptor protein)	NA	NA	NA	NA	NA
VEB57423.1|2482357_2483209_+	IS150 protein InsAB	NA	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
VEB57425.1|2483250_2483418_+	regulatory peptide	NA	NA	NA	NA	NA
VEB57427.1|2483529_2483703_-	Uncharacterised protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
VEB57429.1|2483947_2484478_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
VEB57431.1|2484666_2485668_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VEB57433.1|2485709_2487149_-	aldehyde dehydrogenase A	NA	NA	NA	NA	NA
VEB57435.1|2487345_2488146_-	conserved SAM-binding protein, DUF218 family	NA	NA	NA	NA	NA
VEB57437.1|2488417_2492320_-	ATP-dependent helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
VEB57439.1|2492520_2493090_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
VEB57441.1|2493177_2494494_-	Putative enzyme YnbD	NA	NA	NA	NA	NA
VEB57443.1|2494483_2496241_-	putative hydrolase	NA	NA	NA	NA	NA
VEB57445.1|2496419_2497154_-	membrane associated CTP-phosphosubstrate transferase	NA	NA	NA	NA	NA
VEB57447.1|2497153_2497759_-	phosphatidylglycerophosphate synthase	NA	NA	NA	NA	NA
VEB57449.1|2497929_2500236_-	protein involved in detoxification of methylglyoxal	NA	NA	NA	NA	NA
VEB57451.1|2500299_2501109_-	putative oxidoreductase	NA	NA	NA	NA	NA
VEB57453.1|2501368_2504947_-	putative autotransporter heamagglutinin	NA	NA	NA	NA	NA
VEB57455.1|2504933_2508218_-	putative autotransporter heamagglutinin	NA	NA	NA	NA	NA
VEB57457.1|2508542_2508908_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VEB57460.1|2509277_2509772_+|transposase	IS2, transposase orfB, truncation	transposase	Q9ZXG3	Shigella_phage	95.0	1.5e-87
>prophage 13
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	2538458	2581410	4731931	lysis,tail,coat,integrase,tRNA,terminase,transposase	Escherichia_phage(38.46%)	53	2561842:2561857	2587007:2587022
VEB57522.1|2538458_2539592_+	outer membrane protein N (porin)	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
VEB57523.1|2539732_2540167_+	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
VEB57525.1|2541128_2541362_+	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VEB57527.1|2541678_2542269_+	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
VEB57529.1|2542942_2544850_-|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	61.2	1.4e-05
VEB57531.1|2544986_2545724_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57533.1|2546285_2546885_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
VEB57535.1|2546952_2549223_-	fibronectin type III	NA	A0A291AWT4	Escherichia_phage	85.3	0.0e+00
VEB57537.1|2549179_2550448_-	Host specificity protein J	NA	A5LH43	Enterobacteria_phage	99.0	1.5e-245
VEB57539.1|2550495_2551038_-|tail	putative phage tail component	tail	A0A291AWV5	Escherichia_phage	81.9	5.4e-75
VEB57541.1|2551034_2551634_-|tail	tail component	tail	A5LH41	Enterobacteria_phage	97.5	5.7e-118
VEB57543.1|2551783_2552482_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
VEB57545.1|2552481_2552778_-|tail	putative phage minor tail protein	tail	H6WZM2	Escherichia_phage	51.0	2.0e-23
VEB57547.1|2552812_2553145_-|tail	putative phage tail length tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	64.5	2.2e-34
VEB57548.1|2553191_2554310_-|tail	putative phage tail length tape measure protein	tail	K7PKI9	Enterobacteria_phage	29.2	2.7e-20
VEB57550.1|2554366_2556046_-|tail	putative phage tail length tape measure protein	tail	A0A1V0E821	Vibrio_phage	42.5	9.2e-73
VEB57552.1|2556519_2556969_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57554.1|2557029_2557992_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57556.1|2558018_2558411_-	phage protein	NA	NA	NA	NA	NA
VEB57558.1|2558407_2558788_-	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
VEB57560.1|2558788_2559172_-	Uncharacterised protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
VEB57562.1|2559171_2559567_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57564.1|2559570_2559747_-	Uncharacterised protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
VEB57566.1|2559789_2560929_-|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
VEB57568.1|2561027_2561456_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	64.0	5.3e-41
VEB57570.1|2561456_2561792_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	55.6	2.1e-21
2561842:2561857	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
VEB57572.1|2561896_2562772_-	phage protein	NA	I6PD76	Cronobacter_phage	57.2	4.6e-92
VEB57574.1|2562791_2563013_-	phage protein	NA	I6PD76	Cronobacter_phage	48.6	3.1e-13
VEB57576.1|2562993_2564400_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
VEB57578.1|2564402_2565704_-|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
VEB57580.1|2565684_2566779_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
VEB57582.1|2566849_2567035_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57584.1|2567031_2567904_-	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	56.0	6.4e-78
VEB57586.1|2567896_2568484_-	ParB-like nuclease	NA	F8J155	Lactobacillus_virus	42.2	1.2e-32
VEB57588.1|2568440_2568689_-	Rac prophage protein	NA	A0A0R6PD10	Moraxella_phage	58.7	1.7e-15
VEB57590.1|2568826_2570251_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VEB57592.1|2570421_2570886_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	91.4	2.6e-70
VEB57594.1|2570982_2571381_-	phage lysozome	NA	A0A291AWW2	Escherichia_phage	96.8	3.1e-64
VEB57596.1|2571380_2571596_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
VEB57598.1|2571847_2572243_-	tolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VEB57600.1|2572393_2572822_-	TolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VEB57602.1|2573015_2573291_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB57604.1|2573335_2573713_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB57606.1|2573742_2573988_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	63.3	5.3e-22
VEB57608.1|2574231_2574441_+	gydaC	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
VEB57610.1|2574519_2574735_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VEB57612.1|2574736_2575972_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	3.5e-239
VEB57614.1|2576023_2576959_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
VEB57616.1|2577087_2578461_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VEB57618.1|2578490_2578664_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57620.1|2578938_2579481_-	zinc transport protein	NA	NA	NA	NA	NA
VEB57622.1|2579443_2579923_-	zinc transport protein	NA	NA	NA	NA	NA
VEB57624.1|2580177_2581410_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2587007:2587022	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
>prophage 14
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	2643281	2698640	4731931	integrase,protease,transposase	Acinetobacter_phage(18.18%)	58	2696234:2696247	2701770:2701783
VEB57756.1|2643281_2643557_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB57758.1|2643601_2643979_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB57760.1|2644234_2644453_+	osmotically inducible lipoprotein B	NA	NA	NA	NA	NA
VEB57762.1|2644578_2644905_-	translation initiation factor Sui1	NA	NA	NA	NA	NA
VEB57764.1|2644904_2645702_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
VEB57766.1|2645835_2647005_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
VEB57768.1|2647011_2647320_-	inner membrane protein	NA	NA	NA	NA	NA
VEB57770.1|2647468_2648233_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
VEB57772.1|2648402_2648993_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
VEB57774.1|2649056_2651732_-	aconitate hydratase 1	NA	NA	NA	NA	NA
VEB57776.1|2652104_2652272_-	protein, C-ter fragment, truncated protein	NA	NA	NA	NA	NA
VEB57778.1|2652274_2652403_-	small predicted membrane protein	NA	NA	NA	NA	NA
VEB57780.1|2652733_2653708_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
VEB57782.1|2653917_2656515_-	DNA topoisomerase I	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
VEB57784.1|2656894_2657146_+	protein	NA	NA	NA	NA	NA
VEB57786.1|2657181_2658231_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
VEB57788.1|2658450_2659209_+	putative short chain dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
VEB57790.1|2659205_2659796_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
VEB57792.1|2659835_2660711_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
VEB57794.1|2660923_2661298_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEB57796.1|2661315_2662821_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEB57798.1|2662848_2663469_-	putative RNA binding protein	NA	NA	NA	NA	NA
VEB57800.1|2663465_2664347_-	putative phosphoesterase	NA	NA	NA	NA	NA
VEB57802.1|2664620_2665484_+	anthranilate synthase component I	NA	NA	NA	NA	NA
VEB57804.1|2665497_2666184_+	anthranilate synthase component I	NA	NA	NA	NA	NA
VEB57806.1|2666183_2667779_+	anthranilate synthase component II [includes: glutamine amidotransferase; anthranilate phosphoribosyltransferase]	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	3.2e-51
VEB57808.1|2667782_2669141_+	tryptophan biosynthesis protein [includes: indole-3-glycero phosphate synthase; N-(5'-phospho ribosyl)anthranilate isomerase]	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
VEB57810.1|2669152_2670346_+	tryptophan synthase	NA	NA	NA	NA	NA
VEB57812.1|2670345_2671152_+	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
VEB57814.1|2671532_2671712_+	protein	NA	NA	NA	NA	NA
VEB57816.1|2671797_2672298_+	YciF protein	NA	NA	NA	NA	NA
VEB57818.1|2672343_2672850_+	protein YciE	NA	NA	NA	NA	NA
VEB57820.1|2672909_2673548_-	outer membrane protein W	NA	NA	NA	NA	NA
VEB57822.1|2673904_2674648_+	membrane protein YciC	NA	NA	NA	NA	NA
VEB57824.1|2674677_2675217_+	putative intracellular septation protein	NA	NA	NA	NA	NA
VEB57826.1|2675321_2675720_+	putative acyl-coA thioester hydrolase	NA	NA	NA	NA	NA
VEB57828.1|2675759_2676479_-	transport protein TonB	NA	NA	NA	NA	NA
VEB57830.1|2676702_2676999_+	putative cytoplasmic protein YciI	NA	NA	NA	NA	NA
VEB57832.1|2677298_2678552_+	voltage-gated potassium channel	NA	NA	NA	NA	NA
VEB57834.1|2678922_2680383_+	cardiolipin synthetase	NA	NA	NA	NA	NA
VEB57836.1|2680417_2680747_+	dsDNA-mimic protein	NA	NA	NA	NA	NA
VEB57838.1|2680799_2681804_-	oligopeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
VEB57840.1|2681800_2682814_-	oligopeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
VEB57842.1|2682825_2683734_-	oligopeptide ABC transporter permease	NA	NA	NA	NA	NA
VEB57844.1|2683748_2684669_-	oligopeptide ABC transporter	NA	NA	NA	NA	NA
VEB57846.1|2684754_2686431_-	periplasmic oligopeptide-binding protein	NA	NA	NA	NA	NA
VEB57848.1|2686804_2686966_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57850.1|2686941_2687097_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57852.1|2687123_2687771_-	MarC family integral membrane protein	NA	NA	NA	NA	NA
VEB57854.1|2688247_2690923_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
VEB57856.1|2691046_2691232_+|transposase	transposase	transposase	NA	NA	NA	NA
VEB57858.1|2691397_2691943_+|transposase	transposase, IS4 family protein	transposase	NA	NA	NA	NA
VEB57860.1|2692224_2692842_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
VEB57862.1|2693446_2693860_+	H-NS histone family protein	NA	NA	NA	NA	NA
VEB57864.1|2694003_2694912_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
VEB57866.1|2695113_2696127_-	orphan two-component response regulator	NA	NA	NA	NA	NA
VEB57868.1|2696218_2697163_-	patatin	NA	NA	NA	NA	NA
2696234:2696247	attL	TACCAACGGCAAAA	NA	NA	NA	NA
VEB57870.1|2697473_2698640_+|integrase	integrase family protein	integrase	Q716F9	Shigella_phage	32.8	1.1e-37
VEB57870.1|2697473_2698640_+|integrase	integrase family protein	integrase	Q716F9	Shigella_phage	32.8	1.1e-37
2701770:2701783	attR	TTTTGCCGTTGGTA	NA	NA	NA	NA
>prophage 15
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	3158963	3199431	4731931	integrase,transposase,lysis	Enterobacteria_phage(47.37%)	59	3166577:3166591	3207918:3207932
VEB58789.1|3158963_3159239_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB58791.1|3159283_3159661_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB58793.1|3159595_3160312_-	inner membrane protein	NA	A0A2L1IV26	Escherichia_phage	100.0	1.9e-06
VEB58795.1|3160448_3160901_-	molybdopterin converting factor subunit 2	NA	NA	NA	NA	NA
VEB58797.1|3160902_3161148_-	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
VEB58799.1|3161140_3161626_-	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
VEB58801.1|3161628_3162141_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
VEB58803.1|3163548_3164457_+	transferase with NAD(P)-binding Rossmann-fold domain; UPF0052 family	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
VEB58805.1|3164648_3164957_-	UvrABC system protein B (excinuclease ABC subunit B)	NA	NA	NA	NA	NA
VEB58807.1|3164953_3166672_-	UvrABC system protein B (excinuclease ABC subunit B)	NA	NA	NA	NA	NA
3166577:3166591	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
VEB58809.1|3167251_3167929_-	dithiobiotin synthetase	NA	NA	NA	NA	NA
VEB58811.1|3167921_3168677_-	biotin biosynthesis protein BioC	NA	NA	NA	NA	NA
VEB58813.1|3168663_3169818_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
VEB58815.1|3169814_3170855_-	biotin synthetase	NA	NA	NA	NA	NA
VEB58817.1|3170941_3172231_+	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	7.7e-19
VEB58819.1|3172289_3172766_+	putative phosphatidylethanolamine-binding protein	NA	NA	NA	NA	NA
VEB58821.1|3173095_3173311_-	Transposase IS3/IS911 family protein	NA	U5P4I9	Shigella_phage	86.5	1.8e-18
VEB58823.1|3173473_3173827_+	IS2 ORF2	NA	Q9ZXG3	Shigella_phage	69.9	3.7e-40
VEB58825.1|3173868_3174612_-	putative AraC-type regulatory protein encoded in prophage CP-933H	NA	NA	NA	NA	NA
VEB58827.1|3174833_3175211_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
VEB58829.1|3175255_3175531_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB58831.1|3176818_3177196_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB58833.1|3177322_3177616_+	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
VEB58835.1|3177647_3178109_-	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	98.0	1.6e-75
VEB58837.1|3178105_3178603_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
VEB58839.1|3178602_3178818_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VEB58841.1|3179406_3180489_+	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	79.0	1.2e-161
VEB58843.1|3180677_3181061_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
VEB58845.1|3181283_3181646_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
VEB58847.1|3181642_3181933_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
VEB58849.1|3181925_3182096_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
VEB58851.1|3182095_3182551_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
VEB58853.1|3182765_3183563_-	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VEB58855.1|3183572_3184124_-	kinase inhibitor	NA	NA	NA	NA	NA
VEB58857.1|3184588_3186115_-	site-specific invertase; DLP12 prophage	NA	Q3HQV4	Burkholderia_phage	27.8	1.0e-30
VEB58859.1|3186369_3186702_-	Multidrug transporter emrE	NA	NA	NA	NA	NA
VEB58861.1|3186769_3187072_-	Ren protein from phage origin	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
VEB58863.1|3187068_3187770_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	98.7	2.4e-128
VEB58865.1|3187766_3188771_-	replication protein O	NA	M1FN81	Enterobacteria_phage	67.6	2.3e-111
VEB58867.1|3188782_3189322_-	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
VEB58869.1|3189352_3189580_-	represror Cro	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
VEB58871.1|3189897_3190383_+	Regulatory protein CI from bacteriophage origin	NA	Q76H56	Enterobacteria_phage	84.5	3.1e-74
VEB58873.1|3190502_3190913_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB58875.1|3190937_3191525_+	HTH-type transcriptional regulator ygiT	NA	NA	NA	NA	NA
VEB58877.1|3191521_3192025_+	Uncharacterised protein	NA	A0A2H4J2Z0	uncultured_Caudovirales_phage	38.4	7.3e-26
VEB58879.1|3192513_3192720_+	prophage Kil protein	NA	K7P6H3	Enterobacteria_phage	82.4	1.0e-26
VEB58881.1|3192795_3193092_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
VEB58883.1|3193097_3193883_+	bacteriophage recombination protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
VEB58885.1|3193879_3194560_+	exonuclease	NA	A0A0N6WET1	Escherichia_phage	99.6	2.7e-132
VEB58887.1|3194556_3194739_+	phage protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
VEB58889.1|3194711_3194903_+	phage protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
VEB58891.1|3194979_3195195_+	ybl17	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
VEB58893.1|3195293_3195515_+	putative C4-type zinc finger protein	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
VEB58895.1|3195511_3196060_+	ea22	NA	A0A0K2FJF6	Enterobacteria_phage	98.4	1.6e-98
VEB58897.1|3196216_3197122_-	IS2 element protein	NA	Q9ZXG3	Shigella_phage	97.0	4.2e-173
VEB58899.1|3197079_3197445_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VEB58901.1|3197587_3197869_+	ea8.5	NA	A0A0K2FIU9	Enterobacteria_phage	98.9	8.2e-51
VEB58903.1|3197957_3198125_+	Uncharacterised protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
VEB58906.1|3198360_3199431_+|integrase	putative integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3207918:3207932	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 16
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	3389917	3430520	4731931	transposase	Macacine_betaherpesvirus(33.33%)	37	NA	NA
VEB59259.1|3389917_3390058_-|transposase	transposase	transposase	NA	NA	NA	NA
VEB59261.1|3390080_3391193_-|transposase	IS186, transposase	transposase	NA	NA	NA	NA
VEB59263.1|3391269_3391422_-	Hok/gef cell toxic protein	NA	NA	NA	NA	NA
VEB59265.1|3391519_3392371_-	IS150 protein InsAB	NA	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	7.8e-113
VEB59267.1|3392367_3392652_-|transposase	transposase subunit	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	1.7e-43
VEB59269.1|3393319_3394438_+	carboxylate-amine ligase	NA	NA	NA	NA	NA
VEB59271.1|3394503_3394752_+	membrane protein YbdJ	NA	NA	NA	NA	NA
VEB59273.1|3394816_3395185_+	putative cytoplasmic protein YjbR	NA	NA	NA	NA	NA
VEB59275.1|3395278_3395932_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
VEB59277.1|3396039_3397287_+	putative mechanosensitive ion channel protein	NA	NA	NA	NA	NA
VEB59279.1|3397354_3398731_-	phenylalanine transporter	NA	NA	NA	NA	NA
VEB59281.1|3398832_3401976_-	cation efflux system protein	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
VEB59283.1|3401987_3403211_-	cation efflux system protein	NA	NA	NA	NA	NA
VEB59285.1|3403226_3403559_-	cation efflux system protein	NA	NA	NA	NA	NA
VEB59287.1|3403716_3405090_-	copper/silver efflux system outer membrane protein CusC	NA	NA	NA	NA	NA
VEB59289.1|3405246_3405930_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
VEB59291.1|3405919_3407368_+	sensor kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
VEB59293.1|3407753_3408131_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB59295.1|3408175_3408451_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB59297.1|3408881_3410783_+	Rhs element Vgr protein	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.0e-27
VEB59299.1|3410810_3411272_+	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VEB59301.1|3411291_3415614_+	Rhs core protein	NA	NA	NA	NA	NA
VEB59303.1|3415837_3416098_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59305.1|3416097_3416385_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59307.1|3416675_3416873_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59309.1|3417349_3418486_+	H repeat-associated protein	NA	NA	NA	NA	NA
VEB59311.1|3418756_3419551_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
VEB59313.1|3419592_3420996_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
VEB59315.1|3420982_3421657_+	bacteriophage N4 receptor, outer membrane subunit	NA	NA	NA	NA	NA
VEB59317.1|3421663_3423955_+	bacteriophage N4 receptor, outer membrane subunit	NA	NA	NA	NA	NA
VEB59319.1|3423955_3424846_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59321.1|3425028_3425790_+	porin thermoregulatory protein	NA	NA	NA	NA	NA
VEB59323.1|3426209_3426788_+	two component transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
VEB59325.1|3426790_3427306_-	fimbrial protein	NA	NA	NA	NA	NA
VEB59327.1|3427316_3428294_-	fimbrial protein	NA	NA	NA	NA	NA
VEB59329.1|3428335_3430117_-	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEB59331.1|3430142_3430520_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
>prophage 17
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	3652473	3694983	4731931	integrase,holin,transposase	Vibrio_phage(14.29%)	38	3689186:3689205	3695670:3695689
VEB59746.1|3652473_3653244_-|holin	high-affinity choline transport protein (BCCT-family transporter)	holin	NA	NA	NA	NA
VEB59748.1|3653188_3654508_-|holin	high-affinity choline transport protein (BCCT-family transporter)	holin	A0A2I7QNT1	Vibrio_phage	27.1	2.4e-20
VEB59750.1|3654636_3655224_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
VEB59752.1|3655237_3656710_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
VEB59754.1|3656723_3658394_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
VEB59756.1|3658606_3659275_+	inner membrane protein	NA	NA	NA	NA	NA
VEB59758.1|3659517_3660213_-	transporter	NA	NA	NA	NA	NA
VEB59760.1|3660205_3661567_-	putative electron transport protein YkgF	NA	NA	NA	NA	NA
VEB59762.1|3661644_3662364_-	hydroxyacid oxidoreductase (Fe-S centre)	NA	NA	NA	NA	NA
VEB59763.1|3662890_3663745_-	transcriptional regulator YkgD	NA	NA	NA	NA	NA
VEB59765.1|3663970_3665296_+	putative pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
VEB59767.1|3665652_3666246_+	inner membrane protein	NA	NA	NA	NA	NA
VEB59769.1|3666835_3667687_+	Putatve transcriptional regulator ykgA	NA	NA	NA	NA	NA
VEB59771.1|3667643_3667802_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59773.1|3667826_3672083_-	Ig domain-containing protein	NA	NA	NA	NA	NA
VEB59775.1|3673198_3673300_+	small predicted membrane protein	NA	NA	NA	NA	NA
VEB59777.1|3673660_3673927_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEB59779.1|3673926_3674067_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
VEB59781.1|3675152_3675695_+	putative fimbrial transcriptional regulator	NA	NA	NA	NA	NA
VEB59783.1|3675769_3676357_+	fimbrillin	NA	NA	NA	NA	NA
VEB59785.1|3676414_3677083_+	putative fimbrial protein	NA	NA	NA	NA	NA
VEB59787.1|3677108_3679634_+	putative fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEB59789.1|3679623_3681267_+	putative fimbrial protein	NA	NA	NA	NA	NA
VEB59791.1|3681235_3681946_+	putative fimbrial protein	NA	NA	NA	NA	NA
VEB59793.1|3682835_3683450_-	integral membrane protein	NA	NA	NA	NA	NA
VEB59795.1|3683867_3684557_+	putative xanthine dehydrogenase, iron-sulfur binding subunit	NA	NA	NA	NA	NA
VEB59797.1|3684553_3685510_+	putative xanthine dehydrogenase, FAD-binding subunit	NA	NA	NA	NA	NA
VEB59799.1|3685506_3687705_+	putative xanthine dehydrogenase, molybdenum-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	8.7e-39
VEB59801.1|3687714_3688671_+	xanthine dehydrogenase accessory factor	NA	NA	NA	NA	NA
VEB59803.1|3688649_3689060_+	transcriptional regulator	NA	NA	NA	NA	NA
3689186:3689205	attL	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
VEB59805.1|3689347_3690625_+|integrase	integrase	integrase	NA	NA	NA	NA
VEB59807.1|3690705_3691383_-	Uncharacterised protein	NA	A0A1D7XFF4	Escherichia_phage	52.3	3.0e-46
VEB59809.1|3691430_3693272_-	Uncharacterised protein	NA	A0A140G5Z0	Enterobacteria_phage	27.6	6.4e-19
VEB59811.1|3693306_3693504_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59813.1|3693661_3693997_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59815.1|3694116_3694275_+	Insertion element IS2A protein	NA	Q76S41	Shigella_phage	98.1	4.9e-21
VEB59817.1|3694285_3694663_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB59819.1|3694707_3694983_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
3695670:3695689	attR	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
>prophage 18
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	3700643	3747490	4731931	portal,tail,lysis,head,protease,integrase,terminase,transposase	Enterobacteria_phage(32.65%)	57	3695670:3695716	3743588:3743634
3695670:3695716	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
VEB59831.1|3700643_3700919_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB59833.1|3700963_3701341_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB59835.1|3701386_3701779_+	Domain of uncharacterised function (DUF955)	NA	NA	NA	NA	NA
VEB59837.1|3701765_3701915_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59839.1|3701904_3702048_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59841.1|3702469_3703132_+	Uncharacterised protein	NA	G9IA57	Pseudomonas_phage	43.5	7.4e-34
VEB59843.1|3703897_3706972_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
VEB59845.1|3707036_3707636_-	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
VEB59847.1|3707706_3709434_-|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	96.0	0.0e+00
VEB59849.1|3709387_3711121_-	Host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.2	0.0e+00
VEB59851.1|3711181_3711730_-	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	100.0	4.7e-95
VEB59853.1|3711726_3712326_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	95.0	3.3e-118
VEB59855.1|3712475_3713174_-|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
VEB59857.1|3713183_3713513_-|tail	Minor tail protein M	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
VEB59859.1|3713512_3716578_-|tail	putative tail length tape measure protein from putative prophage	tail	A0A291AWX1	Escherichia_phage	99.3	0.0e+00
VEB59861.1|3716549_3716879_-|tail	minor tail protein T of prophage	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
VEB59863.1|3716887_3717274_-|tail	minor tail component of prophage	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
VEB59865.1|3717334_3718078_-|tail	Major tail protein V	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
VEB59867.1|3718089_3718491_-|tail	Minor tail protein U	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
VEB59869.1|3718487_3719066_-|tail	Minor tail protein Z (GPZ) of prophage	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
VEB59871.1|3719077_3719353_-	prophage protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
VEB59873.1|3719345_3719669_-	prophage protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
VEB59875.1|3719755_3721783_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
VEB59877.1|3721727_3723236_-|head,tail,portal	portal protein (head-tail preconnector protein) from prophage	head,tail,portal	K7PJP3	Enterobacteria_phage	99.2	2.9e-288
VEB59879.1|3723235_3723448_-	prophage protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
VEB59881.1|3723444_3725547_-|terminase	DNA packaging protein of prophage (terminase large subunit)	terminase	A0A291AWY5	Escherichia_phage	99.6	0.0e+00
VEB59883.1|3725546_3726041_-	prophage protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
VEB59885.1|3726612_3727305_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59887.1|3727473_3728010_-	putative phage related protein	NA	K7PHH7	Enterobacteria_phage	83.5	1.1e-72
VEB59889.1|3728006_3728549_-	prophage lysozyme (endolysin)	NA	Q08J98	Stx2-converting_phage	87.8	3.0e-94
VEB59891.1|3728654_3728927_+	ybl58	NA	NA	NA	NA	NA
VEB59893.1|3728892_3729237_-	putative prophage protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
VEB59895.1|3729241_3729457_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VEB59897.1|3729523_3730576_-	DNA methylase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
VEB59899.1|3730725_3730920_-	lipoprotein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
VEB59901.1|3731101_3731632_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59903.1|3731786_3732539_-	lambdoid prophage Qin antitermination protein Q-like protein	NA	Q8SBE4	Shigella_phage	99.2	1.5e-136
VEB59905.1|3732552_3733542_-	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	99.7	2.1e-194
VEB59907.1|3733549_3734359_-	putative KilA-N domain protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
VEB59909.1|3734378_3734768_-	putative Crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	2.1e-68
VEB59911.1|3734764_3735091_-	putative LexA repressor	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
VEB59913.1|3735090_3735579_-	CPS-53 (KpLE1) prophage protein	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	3.6e-86
VEB59915.1|3735581_3736523_-	phage O protein family	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
VEB59917.1|3736532_3736871_-	Uncharacterised protein	NA	U5P0J9	Shigella_phage	98.2	6.0e-56
VEB59919.1|3736867_3737419_-	nucleic acid-binding protein; e14 prophage	NA	S5FXP0	Shigella_phage	100.0	2.6e-101
VEB59921.1|3737411_3737672_-	putative lambda repressor-like DNA-binding domains	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
VEB59923.1|3737814_3738462_+	regulatory protein	NA	S5FUZ3	Shigella_phage	100.0	2.8e-118
VEB59925.1|3738979_3739171_-	Uncharacterised protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
VEB59927.1|3739609_3739972_+	CPS-53 (KpLE1) prophage protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
VEB59929.1|3740037_3740862_+	CPS-53 (KpLE1) prophage protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
VEB59931.1|3740989_3741526_+	CPS-53 (KpLE1) prophage protein	NA	U5P0T3	Shigella_phage	99.4	4.8e-100
VEB59933.1|3741516_3741879_+	CPS-53 (KpLE1) prophage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
VEB59935.1|3741878_3742184_+	CPS-53 (KpLE1) prophage protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
VEB59937.1|3742410_3743574_+|integrase	prophage integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
VEB59939.1|3743778_3745032_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3743588:3743634	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
VEB59941.1|3745043_3746147_-	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
VEB59943.1|3746434_3747490_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 19
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	4056886	4135575	4731931	integrase,tRNA,transposase	Shigella_phage(33.33%)	78	4082160:4082175	4138205:4138220
VEB60504.1|4056886_4057096_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB60506.1|4057897_4059130_+	multidrug resistance protein	NA	NA	NA	NA	NA
VEB60508.1|4059170_4060451_+	inner membrane protein	NA	NA	NA	NA	NA
VEB60510.1|4060566_4061718_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
VEB60512.1|4061727_4062495_+	ATPase, activator of (R)-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
VEB60514.1|4062491_4062749_+	Protein of uncharacterised function (DUF3343)	NA	NA	NA	NA	NA
VEB60516.1|4062702_4063674_+	SdiA-regulated domain protein	NA	NA	NA	NA	NA
VEB60518.1|4063741_4064920_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEB60520.1|4064932_4065487_-	RNA 2'-phosphotransferase-like protein	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
VEB60522.1|4065736_4066420_+	putative transporter	NA	NA	NA	NA	NA
VEB60524.1|4066416_4066878_+	putative transporter	NA	NA	NA	NA	NA
VEB60526.1|4066890_4068063_+	isoaspartyl dipeptidase	NA	NA	NA	NA	NA
VEB60528.1|4068127_4069039_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VEB60530.1|4069031_4069424_-	DNA replication/recombination/repair protein	NA	NA	NA	NA	NA
VEB60532.1|4070095_4070926_+	Protein of uncharacterised function (DUF2686)	NA	NA	NA	NA	NA
VEB60534.1|4071066_4071792_-	uxu operon transcriptional regulator	NA	NA	NA	NA	NA
VEB60536.1|4071838_4072033_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB60538.1|4072054_4073515_-	D-mannonate oxidoreductase, NAD-binding	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	3.6e-49
VEB60540.1|4073595_4074780_-	mannonate dehydratase	NA	NA	NA	NA	NA
VEB60542.1|4075119_4076463_+	high-affinity gluconate transporter	NA	NA	NA	NA	NA
VEB60544.1|4076483_4076618_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB60546.1|4076636_4077539_-	FimH protein	NA	NA	NA	NA	NA
VEB60548.1|4077597_4077975_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB60550.1|4078019_4078295_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB60552.1|4078624_4078834_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB60554.1|4078834_4079128_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	89.0	4.2e-42
VEB60556.1|4079613_4080135_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VEB60558.1|4080131_4081085_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VEB60560.1|4081171_4083496_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
4082160:4082175	attL	TCAACAGCCTGCTGCA	NA	NA	NA	NA
VEB60562.1|4083540_4084443_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VEB60564.1|4084439_4085438_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VEB60566.1|4085434_4086391_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VEB60568.1|4086391_4087159_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VEB60570.1|4087673_4087880_-|transposase	transposase (partial)	transposase	Q716C2	Shigella_phage	100.0	1.3e-34
VEB60572.1|4087946_4088327_-|integrase	putative integrase	integrase	Q716C2	Shigella_phage	100.0	1.0e-72
VEB60574.1|4088588_4089740_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VEB60576.1|4089696_4090065_-	CP4-6 prophage; partial regulator of insertion element IS911A	NA	Q716C1	Shigella_phage	98.9	2.5e-39
VEB60578.1|4090744_4091158_-	PGA biosynthesis protein	NA	NA	NA	NA	NA
VEB60580.1|4091159_4092485_-	N-glycosyltransferase	NA	NA	NA	NA	NA
VEB60582.1|4092477_4094496_-	lipoprotein YcdR	NA	NA	NA	NA	NA
VEB60584.1|4094462_4097003_-	outer membrane protein PgaA	NA	NA	NA	NA	NA
VEB60586.1|4097428_4098796_+	putative diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	3.3e-20
VEB60588.1|4098973_4099327_+|transposase	transposase	transposase	F6MIM4	Haemophilus_phage	64.2	1.4e-10
VEB60590.1|4099446_4099896_+|transposase	IS1414, transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	30.3	4.7e-08
VEB60592.1|4099954_4100410_-|integrase	integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	51.0	3.4e-38
VEB60594.1|4100693_4100963_-|transposase	transposase	transposase	NA	NA	NA	NA
VEB60596.1|4101341_4101980_-	ribose/galactose isomerase	NA	NA	NA	NA	NA
VEB60598.1|4102211_4103384_+	putative oligogalacturonide lyase	NA	NA	NA	NA	NA
VEB60599.1|4103412_4104213_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
VEB60601.1|4104267_4104591_+	barrel cupin 2 domain-containing protein	NA	NA	NA	NA	NA
VEB60603.1|4104956_4105586_+	putative oligogalacturonide transporter	NA	NA	NA	NA	NA
VEB60605.1|4105551_4106472_+	putative oligogalacturonide transporter	NA	NA	NA	NA	NA
VEB60607.1|4106473_4107295_+	exopolygalacturonate lyase	NA	NA	NA	NA	NA
VEB60609.1|4107275_4108709_+	exopolygalacturonate lyase	NA	NA	NA	NA	NA
VEB60611.1|4108819_4109782_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB60613.1|4110586_4110964_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB60615.1|4111008_4111284_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB60617.1|4111398_4111857_-	membraneprotein	NA	NA	NA	NA	NA
VEB60619.1|4112097_4113003_-	IS2 element protein	NA	Q9ZXG3	Shigella_phage	97.0	4.2e-173
VEB60621.1|4112960_4113326_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VEB60623.1|4114395_4114923_+	putative fimbrial protein FanC	NA	NA	NA	NA	NA
VEB60625.1|4115022_4117431_+	putative fimbrial usher protein FanD	NA	NA	NA	NA	NA
VEB60627.1|4117423_4118116_+	putative fimbrial assembly chaperone FanE	NA	NA	NA	NA	NA
VEB60629.1|4118102_4118624_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB60631.1|4119102_4119534_+	inner membrane protein	NA	NA	NA	NA	NA
VEB60633.1|4119567_4120428_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB60635.1|4120712_4121453_+	heat resistant agglutinin 1	NA	NA	NA	NA	NA
VEB60637.1|4121633_4123133_+	putative membrane-associated, metal-dependent hydrolase	NA	NA	NA	NA	NA
VEB60639.1|4123461_4124727_-|integrase	phage integrase family site specific recombinase	integrase	Q7M297	Enterobacteria_phage	38.0	1.7e-79
VEB60641.1|4124680_4124875_-	Su+6 (supP) amber suppressor transfer RNA-Leu	NA	NA	NA	NA	NA
VEB60647.1|4125191_4126211_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
VEB60649.1|4126340_4126583_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	71.4	1.9e-11
VEB60651.1|4126566_4127844_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	42.0	3.7e-66
VEB60653.1|4127962_4129045_-	putative permease	NA	NA	NA	NA	NA
VEB60655.1|4129044_4130145_-	putative permease	NA	NA	NA	NA	NA
VEB60657.1|4130411_4131923_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
VEB60659.1|4132276_4132720_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VEB60661.1|4132719_4135575_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
4138205:4138220	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
>prophage 20
LR134191	Escherichia coli strain NCTC5934 genome assembly, chromosome: 1	4731931	4502775	4556630	4731931	protease,transposase,tRNA	Erwinia_phage(14.29%)	59	NA	NA
VEB61309.1|4502775_4503306_+|protease	ATP-dependent hslVU protease peptidase subunit HslV	protease	NA	NA	NA	NA
VEB61311.1|4503315_4504647_+|protease	ATP-dependent hslVU protease ATP-binding subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
VEB61313.1|4504713_4505640_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
VEB61315.1|4505732_4506218_+	ribonuclease activity regulator protein RraA	NA	NA	NA	NA	NA
VEB61317.1|4506302_4506542_-	cell division factor ZapB	NA	NA	NA	NA	NA
VEB61319.1|4506972_4507818_+	glycerol uptake facilitator protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	3.4e-15
VEB61321.1|4507840_4509349_+	glycerol kinase	NA	NA	NA	NA	NA
VEB61323.1|4509354_4510494_+	fructose 1,6-bisphosphatase II	NA	NA	NA	NA	NA
VEB61324.1|4510590_4511337_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
VEB61326.1|4511341_4511770_-	universal stress protein D	NA	NA	NA	NA	NA
VEB61328.1|4511796_4512096_-	conserved protein, UPF0381 family	NA	NA	NA	NA	NA
VEB61330.1|4512307_4512748_-	inner membrane protein	NA	NA	NA	NA	NA
VEB61332.1|4512848_4513448_+	Protein of uncharacterised function (DUF1454)	NA	NA	NA	NA	NA
VEB61334.1|4513555_4514323_+	triosephosphate isomerase	NA	NA	NA	NA	NA
VEB61336.1|4514377_4515133_-	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
VEB61338.1|4515239_4516229_-	sulfate-binding protein (sulfate starvation-induced protein 2)	NA	NA	NA	NA	NA
VEB61340.1|4516548_4517511_-	6-phosphofructokinase	NA	NA	NA	NA	NA
VEB61342.1|4517691_4518594_-	ferrous-iron efflux pump	NA	NA	NA	NA	NA
VEB61344.1|4518742_4519243_-	repressor CpxP	NA	NA	NA	NA	NA
VEB61346.1|4519392_4520091_+	transcriptional regulatory protein CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
VEB61348.1|4520087_4521461_+	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
VEB61350.1|4521566_4522241_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
VEB61352.1|4522389_4523373_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
VEB61354.1|4523632_4524253_-	Mn dependent superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
VEB61356.1|4524537_4525572_+	L rhamnose-proton symporter	NA	NA	NA	NA	NA
VEB61358.1|4525568_4526507_-	transcriptional activator RhaR	NA	NA	NA	NA	NA
VEB61360.1|4526490_4527327_-	L-rhamnose operon regulatory protein	NA	NA	NA	NA	NA
VEB61362.1|4527614_4529084_+	rhamnulokinase	NA	NA	NA	NA	NA
VEB61364.1|4529080_4530340_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
VEB61366.1|4530790_4531615_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
VEB61368.1|4531624_4531939_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
VEB61370.1|4532146_4532422_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB61372.1|4532466_4532844_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB61374.1|4533016_4533463_+	fructose-like phosphotransferase system subunit EIIA	NA	NA	NA	NA	NA
VEB61376.1|4533473_4534925_+	PTS system subunit IIC	NA	NA	NA	NA	NA
VEB61378.1|4534914_4535985_+	fructose-specific phosphotransferase system protein FrvX	NA	NA	NA	NA	NA
VEB61380.1|4535984_4537733_+	frv operon regulatory protein	NA	NA	NA	NA	NA
VEB61382.1|4537782_4538838_-	putative lipoprotein	NA	NA	NA	NA	NA
VEB61384.1|4538990_4539824_-	formate dehydrogenase accessory protein	NA	NA	NA	NA	NA
VEB61386.1|4543080_4543983_+	formate dehydrogenase-O	NA	NA	NA	NA	NA
VEB61388.1|4543979_4544615_+	formate dehydrogenase, cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
VEB61390.1|4544611_4545541_+	putative formate dehydrogenase formation protein	NA	NA	NA	NA	NA
VEB61392.1|4545688_4545871_-	enterobactin synthetase component D	NA	NA	NA	NA	NA
VEB61394.1|4545870_4546113_-	YiiF protein	NA	NA	NA	NA	NA
VEB61396.1|4546330_4546549_-	CopG-family DNA-binding protein	NA	NA	NA	NA	NA
VEB61398.1|4546883_4546991_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61400.1|4547401_4547677_-	putative acetyltransferase	NA	NA	NA	NA	NA
VEB61402.1|4547666_4548344_-	putative acetyltransferase	NA	NA	NA	NA	NA
VEB61404.1|4548388_4548826_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
VEB61406.1|4548822_4549695_-|tRNA	tRNA-processing ribonuclease BN	tRNA	NA	NA	NA	NA
VEB61408.1|4549688_4550288_-	phosphatase	NA	NA	NA	NA	NA
VEB61410.1|4550386_4551172_-	transcriptional regulator, DeoR/GntR family	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
VEB61412.1|4551205_4552102_-	kinase	NA	NA	NA	NA	NA
VEB61414.1|4552269_4553166_+	putative phosphogluconate dehydrogenase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
VEB61416.1|4553189_4554068_+	putative sugar 1,6-diphosphate aldolase	NA	NA	NA	NA	NA
VEB61418.1|4554084_4555326_+	putative N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
VEB61420.1|4555439_4555904_+	aldose-1-epimerase	NA	NA	NA	NA	NA
VEB61422.1|4555932_4556208_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEB61424.1|4556252_4556630_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
