The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	516593	525195	4733176	tRNA,protease	Lactococcus_phage(33.33%)	16	NA	NA
VEB51137.1|516593_517325_-|tRNA	putative tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
VEB51138.1|517479_517941_-	ribonuclease R (RNase R)	NA	NA	NA	NA	NA
VEB51139.1|517952_518693_-	ribonuclease R (RNase R)	NA	Q0GXV6	Lactococcus_phage	33.9	1.0e-23
VEB51140.1|518664_519006_-	ribonuclease R (RNase R)	NA	NA	NA	NA	NA
VEB51141.1|519045_519861_-	ribonuclease R (RNase R)	NA	NA	NA	NA	NA
VEB51142.1|519898_520324_-	transcriptional regulator	NA	NA	NA	NA	NA
VEB51143.1|520532_521009_-	adenylosuccinate synthetase	NA	NA	NA	NA	NA
VEB51144.1|520977_521469_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	39.9	3.1e-21
VEB51145.1|521416_521833_-	adenylosuccinate synthetase	NA	A0A291AUF9	Pandoravirus	43.0	7.2e-19
VEB51146.1|521935_522133_-	membrane protein	NA	NA	NA	NA	NA
VEB51147.1|522211_522391_-|protease	FtsH protease regulator HflC	protease	NA	NA	NA	NA
VEB51148.1|522396_522627_-|protease	FtsH protease regulator HflC	protease	NA	NA	NA	NA
VEB51149.1|522858_523224_-|protease	FtsH protease regulator HflC	protease	NA	NA	NA	NA
VEB51150.1|523226_523736_-|protease	protease	protease	NA	NA	NA	NA
VEB51151.1|523732_524488_-|protease	protease	protease	NA	NA	NA	NA
VEB51152.1|524703_525195_-|protease	GTP-binding subunit of protease	protease	NA	NA	NA	NA
>prophage 2
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	584170	588686	4733176		Escherichia_phage(100.0%)	9	NA	NA
VEB51256.1|584170_584443_-	Twin-arginine leader-binding protein DmsD	NA	A0A077SLS7	Escherichia_phage	71.9	1.1e-28
VEB51257.1|584429_584765_-	Twin-arginine leader-binding protein DmsD	NA	A0A077SLS7	Escherichia_phage	67.3	2.5e-38
VEB51258.1|584840_585059_-	dimethyl sulfoxide reductase subunit C	NA	A0A077SK59	Escherichia_phage	72.2	1.4e-18
VEB51259.1|585033_585612_-	dimethyl sulfoxide reductase subunit C	NA	A0A077SK59	Escherichia_phage	82.0	4.6e-72
VEB51260.1|585608_586028_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	90.6	1.1e-67
VEB51261.1|585981_586227_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	92.3	6.7e-33
VEB51262.1|586250_586394_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	95.7	4.9e-20
VEB51263.1|586429_588004_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	81.2	1.3e-254
VEB51264.1|588341_588686_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	75.7	1.0e-39
>prophage 3
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	664053	667443	4733176		uncultured_Mediterranean_phage(66.67%)	6	NA	NA
VEB51390.1|664053_664491_-	Single-stranded DNA-binding protein SSB; Helix-destabilizing protein	NA	A0A0A0P1Q9	Enterobacteria_phage	85.7	1.5e-38
VEB51391.1|664450_664690_-	Single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	100.0	1.6e-07
VEB51392.1|664704_665076_+	excision nuclease subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	81.2	1.1e-21
VEB51393.1|665032_665359_+	excision nuclease subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	50.5	1.6e-21
VEB51394.1|665423_666155_+	excision nuclease subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	42.2	1.5e-51
VEB51395.1|666132_667443_+	excision nuclease subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	50.9	1.2e-96
>prophage 4
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	675984	721513	4733176	tRNA,plate,tail	Burkholderia_phage(37.5%)	79	NA	NA
VEB51414.1|675984_676536_-|tRNA	tRNA dihydrouridine synthase A	tRNA	NA	NA	NA	NA
VEB51415.1|676519_676930_-|tRNA	tRNA dihydrouridine synthase A	tRNA	NA	NA	NA	NA
VEB51416.1|677075_677351_-	conjugative transfer protein	NA	NA	NA	NA	NA
VEB51417.1|677355_677916_-	conjugative transfer protein	NA	NA	NA	NA	NA
VEB51418.1|677926_678421_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB51419.1|678637_679153_+	zinc uptake regulation protein	NA	NA	NA	NA	NA
VEB51420.1|679149_679467_-	stress-response protein	NA	NA	NA	NA	NA
VEB51421.1|679581_680118_-	DNA-damage-inducible membrane protein	NA	NA	NA	NA	NA
VEB51422.1|680105_680699_-	DNA-damage-inducible membrane protein	NA	NA	NA	NA	NA
VEB51423.1|681095_682193_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.8e-13
VEB51424.1|682364_683018_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VEB51425.1|683153_683276_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VEB51426.1|683275_683515_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VEB51427.1|683653_683782_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VEB51428.1|684057_684336_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VEB51429.1|684299_684809_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VEB51430.1|684999_685482_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
VEB51431.1|685580_685784_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
VEB51432.1|685797_686295_-	chorismate lyase	NA	NA	NA	NA	NA
VEB51433.1|686477_686636_-	maltose operon periplasmic protein	NA	NA	NA	NA	NA
VEB51434.1|686629_687034_-	maltose operon periplasmic protein	NA	NA	NA	NA	NA
VEB51435.1|687108_687387_-	maltose operon periplasmic protein	NA	NA	NA	NA	NA
VEB51436.1|687551_687818_-	maltoporin	NA	NA	NA	NA	NA
VEB51437.1|687789_688200_-	maltoporin	NA	NA	NA	NA	NA
VEB51438.1|688541_688910_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB51439.1|689006_690116_-	maltose/maltodextrin transport ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
VEB51440.1|690522_690717_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB51441.1|691001_691217_+	maltose ABC transporter periplasmic protein	NA	NA	NA	NA	NA
VEB51442.1|691170_691647_+	maltose ABC transporter periplasmic protein	NA	NA	NA	NA	NA
VEB51443.1|692032_692755_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VEB51444.1|692711_693131_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VEB51445.1|693376_693847_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VEB51446.1|693961_694270_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VEB51447.1|694435_694663_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
VEB51448.1|694610_694847_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
VEB51449.1|694936_695380_-	lipoprotein	NA	NA	NA	NA	NA
VEB51450.1|695393_696812_-	lipoprotein	NA	NA	NA	NA	NA
VEB51451.1|696774_697089_-	lipoprotein	NA	NA	NA	NA	NA
VEB51452.1|697088_697379_-	putative lipoprotein	NA	NA	NA	NA	NA
VEB51453.1|697365_697827_-	putative lipoprotein	NA	NA	NA	NA	NA
VEB51454.1|697823_698372_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
VEB51455.1|698526_698772_-	YjbE secreted protein	NA	NA	NA	NA	NA
VEB51456.1|699262_700159_-	Glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
VEB51457.1|700166_700865_-	Glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
VEB51458.1|701210_702560_+	lysine-sensitive aspartokinase III	NA	NA	NA	NA	NA
VEB51459.1|702692_703040_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
VEB51460.1|703397_703847_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB51461.1|703827_704511_+	lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.8e-60
VEB51462.1|704523_704838_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
VEB51463.1|704997_705234_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEB51464.1|705214_705454_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEB51465.1|705450_705648_+	gp12	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
VEB51466.1|705637_706186_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	62.9	3.6e-42
VEB51467.1|706142_707066_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.0	1.2e-138
VEB51468.1|707065_707377_+|tail	tail protein	tail	Q6QIA9	Burkholderia_phage	71.0	3.6e-23
VEB51469.1|707644_707767_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB51470.1|707738_707963_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB51471.1|708149_708329_+|tail	tail protein	tail	NA	NA	NA	NA
VEB51472.1|708342_708885_+|tail	tail protein	tail	NA	NA	NA	NA
VEB51473.1|708970_709285_+|tail	tail protein	tail	NA	NA	NA	NA
VEB51474.1|709256_709874_+|tail	tail protein	tail	A4JWL0	Burkholderia_virus	28.3	2.3e-21
VEB51475.1|709836_710508_+|tail	tail protein	tail	A4JWL0	Burkholderia_virus	45.8	1.2e-20
VEB51476.1|710507_711461_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
VEB51477.1|711460_711670_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
VEB51478.1|711657_712353_+	gp21	NA	Q6QIA2	Burkholderia_phage	49.3	3.3e-53
VEB51479.1|712336_712702_+	gp21	NA	NA	NA	NA	NA
VEB51480.1|712711_713434_+|plate	baseplate protein	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
VEB51481.1|713761_714124_+	phage glucose translocase	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
VEB51482.1|714120_715050_+	bactoprenol glucosyl transferase	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
VEB51483.1|715104_715671_+	membrane protein	NA	B9UDL6	Salmonella_phage	43.0	1.4e-25
VEB51484.1|715706_716489_+	membrane protein	NA	B9UDL6	Salmonella_phage	25.2	4.1e-15
VEB51485.1|716581_716704_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB51486.1|716843_717125_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	3.7e-19
VEB51487.1|717185_717932_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	56.3	9.1e-57
VEB51488.1|717897_718233_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	45.0	4.1e-17
VEB51489.1|718225_718858_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
VEB51490.1|718860_719985_+|tail	phage tail fiber protein H	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.2e-52
VEB51491.1|720116_720332_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB51492.1|720526_721513_+|tail	Phage tail fiber assembly	tail	NA	NA	NA	NA
>prophage 5
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	1005907	1011426	4733176		Enterobacteria_phage(50.0%)	8	NA	NA
VEB51954.1|1005907_1007089_-	UDP-4-amino-4-deoxy-L-arabinose- oxoglutarateaminotransferase UDP-(beta-L-threo-pentapyranosyl-4''-ulose diphosphate) aminotransferase; UDP-Ara4O aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.5e-18
VEB51955.1|1007151_1007772_-	TDP-D-fucosamine acetyltransferase	NA	NA	NA	NA	NA
VEB51956.1|1007749_1007974_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	52.2	2.0e-07
VEB51957.1|1008072_1008468_-	UDP-N-acetylglucosamine epimerase	NA	I7HTA3	Enterobacteria_phage	53.8	7.8e-31
VEB51958.1|1008511_1009063_-	UDP-N-acetylglucosamine epimerase	NA	I7HTA3	Enterobacteria_phage	48.1	1.8e-30
VEB51959.1|1009142_1009682_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	NA	NA	NA	NA
VEB51960.1|1009692_1010250_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	27.8	7.1e-06
VEB51961.1|1010340_1011426_-	UDP-N-acetyl-D-glucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	31.9	1.4e-26
>prophage 7
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	1602675	1622087	4733176	protease	Oenococcus_phage(100.0%)	34	NA	NA
VEB53362.1|1602675_1604121_+|protease	protease TldD	protease	NA	NA	NA	NA
VEB53364.1|1604243_1604594_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB53366.1|1604616_1605174_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB53368.1|1605355_1605559_+	electron transfer flavoprotein FixA	NA	NA	NA	NA	NA
VEB53369.1|1605566_1605698_+	Fusaric acid resistance protein fusE	NA	NA	NA	NA	NA
VEB53371.1|1606574_1607054_+	fusaric acid resistance protein FusB/ fusaricacid resistance protein FusC	NA	NA	NA	NA	NA
VEB53373.1|1607094_1607487_+	fusaric acid resistance protein FusB/ fusaricacid resistance protein FusC	NA	NA	NA	NA	NA
VEB53375.1|1607677_1607878_+	fusaric acid resistance protein FusB/ fusaricacid resistance protein FusC	NA	NA	NA	NA	NA
VEB53377.1|1607825_1608446_+	fusaric acid resistance protein FusB/ fusaricacid resistance protein FusC	NA	NA	NA	NA	NA
VEB53379.1|1608673_1608943_+	putative ribonuclease inhibitor	NA	NA	NA	NA	NA
VEB53381.1|1609002_1609158_-	membrane protein	NA	NA	NA	NA	NA
VEB53383.1|1609534_1609639_-	membrane protein	NA	NA	NA	NA	NA
VEB53385.1|1610202_1610478_-	arginine repressor	NA	NA	NA	NA	NA
VEB53387.1|1610891_1611830_+	malate dehydrogenase	NA	NA	NA	NA	NA
VEB53389.1|1611949_1612489_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEB53391.1|1612568_1613039_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB53393.1|1612998_1613235_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB53395.1|1613667_1614621_+	possible membrane transport protein	NA	Q6A201	Oenococcus_phage	30.0	5.1e-20
VEB53397.1|1614750_1615125_+	tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
VEB53399.1|1615093_1615651_+	tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
VEB53401.1|1615876_1616269_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
VEB53403.1|1616424_1616679_+	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
VEB53405.1|1616694_1616979_+	oxaloacetate decarboxylase alpha chain	NA	NA	NA	NA	NA
VEB53407.1|1617369_1617537_+	oxaloacetate decarboxylase alpha subunit	NA	NA	NA	NA	NA
VEB53409.1|1617511_1617805_+	oxaloacetate decarboxylase alpha subunit	NA	NA	NA	NA	NA
VEB53411.1|1617828_1618470_+	oxaloacetate decarboxylase alpha chain	NA	NA	NA	NA	NA
VEB53413.1|1618482_1619268_+	oxaloacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
VEB53415.1|1619242_1619785_+	oxaloacetate decarboxylase beta chain	NA	NA	NA	NA	NA
VEB53417.1|1620024_1620435_+	membrane protein	NA	NA	NA	NA	NA
VEB53419.1|1620571_1620739_-|protease	serine endoprotease	protease	NA	NA	NA	NA
VEB53421.1|1620713_1621316_-|protease	serine endoprotease	protease	NA	NA	NA	NA
VEB53423.1|1621348_1621645_-|protease	serine endoprotease	protease	NA	NA	NA	NA
VEB53425.1|1621738_1621876_-|protease	serine protease	protease	NA	NA	NA	NA
VEB53427.1|1621853_1622087_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 8
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	1672034	1697116	4733176	tRNA,protease	Phaeocystis_globosa_virus(20.0%)	48	NA	NA
VEB53610.1|1672034_1672451_+|protease	ATP-dependent metalloprotease	protease	NA	NA	NA	NA
VEB53612.1|1672401_1672887_+|protease	ATP-dependent metalloprotease	protease	R4TQL5	Phaeocystis_globosa_virus	56.7	5.4e-42
VEB53614.1|1672849_1673398_+|protease	ATP-dependent metalloprotease	protease	M4QNJ1	Ostreococcus_lucimarinus_virus	55.3	7.0e-30
VEB53616.1|1673555_1673747_+|protease	ATP-dependent metalloprotease	protease	NA	NA	NA	NA
VEB53619.1|1673706_1673886_+|protease	ATP-dependent metalloprotease	protease	NA	NA	NA	NA
VEB53621.1|1674098_1674266_+	dihydropteroate synthase	NA	NA	NA	NA	NA
VEB53623.1|1674265_1674448_+	dihydropteroate synthase	NA	NA	NA	NA	NA
VEB53625.1|1674410_1674734_+	dihydropteroate synthase	NA	NA	NA	NA	NA
VEB53627.1|1674944_1675976_+	PGM/PMM family protein	NA	NA	NA	NA	NA
VEB53630.1|1676000_1676207_+	PGM/PMM family protein	NA	NA	NA	NA	NA
VEB53632.1|1676551_1676851_+	Protein-export membrane protein secG	NA	NA	NA	NA	NA
VEB53634.1|1677556_1678105_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEB53636.1|1678070_1678358_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEB53638.1|1678443_1678953_-	argininosuccinate synthase	NA	NA	NA	NA	NA
VEB53640.1|1679018_1679276_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	91.0	8.9e-28
VEB53642.1|1679391_1679790_-	argininosuccinate synthase	NA	NA	NA	NA	NA
VEB53644.1|1680451_1680874_+	ribosome maturation protein RimP	NA	NA	NA	NA	NA
VEB53646.1|1680926_1682105_+	L factor	NA	NA	NA	NA	NA
VEB53647.1|1682076_1682406_+	L factor	NA	NA	NA	NA	NA
VEB53649.1|1682430_1683738_+	protein chain initiation factor 2	NA	NA	NA	NA	NA
VEB53651.1|1683751_1684165_+	protein chain initiation factor 2	NA	NA	NA	NA	NA
VEB53653.1|1684127_1685111_+	protein chain initiation factor 2	NA	NA	NA	NA	NA
VEB53655.1|1685458_1685734_+	ribosome-binding factor A	NA	NA	NA	NA	NA
VEB53657.1|1685733_1686003_+|tRNA	tRNA pseudouridine 55 synthase	tRNA	NA	NA	NA	NA
VEB53659.1|1685962_1686679_+|tRNA	tRNA pseudouridine 55 synthase	tRNA	NA	NA	NA	NA
VEB53661.1|1687341_1687923_+	Polyribonucleotide nucleotidyl transferase	NA	NA	NA	NA	NA
VEB53663.1|1687873_1688263_+	Polyribonucleotide nucleotidyl transferase	NA	NA	NA	NA	NA
VEB53665.1|1688316_1689480_+	Polyribonucleotide nucleotidyl transferase	NA	NA	NA	NA	NA
VEB53667.1|1689589_1689880_+	Lipoprotein nlpI precursor	NA	NA	NA	NA	NA
VEB53669.1|1689836_1690112_+	Lipoprotein nlpI precursor	NA	NA	NA	NA	NA
VEB53671.1|1690074_1690476_+	Lipoprotein nlpI precursor	NA	NA	NA	NA	NA
VEB53673.1|1690603_1691002_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	35.4	3.9e-14
VEB53675.1|1690970_1691459_+	ATP-dependent RNA helicase DeaD	NA	A0A1V0SIR5	Klosneuvirus	36.4	1.3e-14
VEB53677.1|1691409_1691592_+	ATP-dependent RNA helicase DeaD	NA	NA	NA	NA	NA
VEB53679.1|1691576_1691903_+	ATP-dependent RNA helicase DeaD	NA	NA	NA	NA	NA
VEB53681.1|1692008_1692347_+	ATP-dependent RNA helicase DeaD	NA	NA	NA	NA	NA
VEB53683.1|1692463_1692556_+	ATP-dependent RNA helicase DeaD	NA	NA	NA	NA	NA
VEB53685.1|1692711_1692987_+	tryptophan permease	NA	NA	NA	NA	NA
VEB53687.1|1692980_1693157_+	tryptophan permease	NA	NA	NA	NA	NA
VEB53689.1|1693198_1693522_+	tryptophan permease	NA	NA	NA	NA	NA
VEB53691.1|1693460_1693595_+	tryptophan permease	NA	NA	NA	NA	NA
VEB53693.1|1693623_1693830_+	tryptophan permease	NA	NA	NA	NA	NA
VEB53695.1|1693790_1694288_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB53697.1|1695050_1695254_+	transpeptidase	NA	NA	NA	NA	NA
VEB53699.1|1695427_1695523_-	monooxygenase	NA	NA	NA	NA	NA
VEB53701.1|1695527_1696043_-	monooxygenase	NA	NA	NA	NA	NA
VEB53703.1|1696108_1696213_-	monooxygenase	NA	NA	NA	NA	NA
VEB53705.1|1696693_1697116_-|protease	putative protease	protease	NA	NA	NA	NA
>prophage 9
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	1899869	1934971	4733176	integrase,protease	Prochlorococcus_phage(57.14%)	60	1905252:1905268	1943182:1943198
VEB54338.1|1899869_1900034_-|protease	Putative metalloprotease yggG	protease	NA	NA	NA	NA
VEB54340.1|1900030_1900219_-|protease	Putative metalloprotease yggG	protease	NA	NA	NA	NA
VEB54342.1|1900191_1900353_-|protease	Putative metalloprotease yggG	protease	NA	NA	NA	NA
VEB54344.1|1900444_1900621_-|protease	Putative metalloprotease yggG	protease	NA	NA	NA	NA
VEB54346.1|1900896_1901496_+	transketolase	NA	NA	NA	NA	NA
VEB54348.1|1901464_1902691_+	transketolase	NA	NA	NA	NA	NA
VEB54350.1|1902644_1902890_+	transketolase	NA	NA	NA	NA	NA
VEB54352.1|1903411_1903792_-	ATPase component of energizing module ofqueuosine-regulated ECF transporter	NA	NA	NA	NA	NA
VEB54354.1|1904462_1904981_-	cobalt ABC transporter permease	NA	NA	NA	NA	NA
1905252:1905268	attL	CGCTGACGATCACTTTG	NA	NA	NA	NA
VEB54356.1|1905260_1905569_-	Substrate-specific component of queuosine-regulated ECF transporter	NA	NA	NA	NA	NA
VEB54358.1|1905594_1906020_-	DNA-binding protein	NA	NA	NA	NA	NA
VEB54360.1|1906415_1906889_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VEB54362.1|1906845_1907052_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54364.1|1907557_1907704_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
VEB54366.1|1907696_1907870_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
VEB54368.1|1907880_1908633_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
VEB54370.1|1908735_1908843_+	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
VEB54372.1|1909099_1909819_+	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
VEB54374.1|1910047_1910398_+	Protein involved in stability of MscS mechanosensitive channel	NA	NA	NA	NA	NA
VEB54376.1|1910423_1910909_+	Protein involved in stability of MscS mechanosensitive channel	NA	NA	NA	NA	NA
VEB54378.1|1911109_1911745_+	membrane transport protein	NA	NA	NA	NA	NA
VEB54380.1|1911887_1912100_+	oxidative stress defense protein	NA	NA	NA	NA	NA
VEB54382.1|1912080_1912542_+	oxidative stress defense protein	NA	NA	NA	NA	NA
VEB54384.1|1912843_1913749_-	chromosome intitiation inhibitor	NA	NA	NA	NA	NA
VEB54386.1|1913903_1914563_+	ribose 5-phosphate isomerase	NA	NA	NA	NA	NA
VEB54388.1|1914832_1916065_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.8e-102
VEB54390.1|1917294_1917624_-	Z-ring-associated protein ZapA	NA	NA	NA	NA	NA
VEB54392.1|1918002_1918371_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEB54394.1|1918396_1918510_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54396.1|1918677_1918965_+	proline aminopeptidase II	NA	NA	NA	NA	NA
VEB54398.1|1918933_1919716_+	proline aminopeptidase II	NA	NA	NA	NA	NA
VEB54400.1|1919712_1920498_+	2-octaprenyl-6-methoxyphenol hydroxylase	NA	NA	NA	NA	NA
VEB54402.1|1920448_1920892_+	2-octaprenyl-6-methoxyphenol hydroxylase	NA	NA	NA	NA	NA
VEB54404.1|1921018_1922026_+	monooxygenase	NA	NA	NA	NA	NA
VEB54406.1|1922079_1922223_+	monooxygenase	NA	NA	NA	NA	NA
VEB54408.1|1922677_1923163_+	aminomethyltransferase	NA	NA	NA	NA	NA
VEB54410.1|1923128_1923773_+	aminomethyltransferase	NA	NA	NA	NA	NA
VEB54412.1|1923798_1924188_+	glycine cleavage system H protein	NA	NA	NA	NA	NA
VEB54414.1|1924350_1925517_+	glycine cleavage complex protein P, glycine decarboxylase	NA	M4QFZ1	Prochlorococcus_phage	48.4	1.4e-88
VEB54416.1|1925527_1926001_+	glycine cleavage complex protein P, glycine decarboxylase	NA	M4QFZ1	Prochlorococcus_phage	65.5	3.2e-15
VEB54418.1|1926051_1926942_+	glycine cleavage complex protein P, glycine decarboxylase	NA	E3ST28	Prochlorococcus_phage	63.7	1.0e-91
VEB54420.1|1926892_1927216_+	glycine cleavage complex protein P, glycine decarboxylase	NA	E3SN07	Prochlorococcus_phage	55.0	3.7e-23
VEB54422.1|1927689_1927992_+	outer membrane protein	NA	NA	NA	NA	NA
VEB54424.1|1928237_1928588_+	membrane protein	NA	NA	NA	NA	NA
VEB54426.1|1928635_1929088_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.7	3.0e-10
VEB54428.1|1929093_1929192_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
VEB54430.1|1929199_1929373_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
VEB54432.1|1929466_1929922_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
VEB54434.1|1930075_1930531_+	UPF0267 protein	NA	NA	NA	NA	NA
VEB54436.1|1930710_1930971_+	hemolysin	NA	NA	NA	NA	NA
VEB54438.1|1931056_1931290_+	hemolysin	NA	NA	NA	NA	NA
VEB54440.1|1931304_1931574_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54442.1|1931490_1931874_-	Folate-dependent protein for Fe/S clustersynthesis/repair in oxidative stress	NA	NA	NA	NA	NA
VEB54444.1|1932008_1932206_-	Folate-dependent protein for Fe/S clustersynthesis/repair in oxidative stress	NA	NA	NA	NA	NA
VEB54446.1|1932187_1932475_-	Folate-dependent protein for Fe/S clustersynthesis/repair in oxidative stress	NA	NA	NA	NA	NA
VEB54448.1|1932725_1932992_+	YgfY	NA	NA	NA	NA	NA
VEB54450.1|1932972_1933386_+	membrane protein	NA	NA	NA	NA	NA
VEB54452.1|1933438_1933915_-	flavodoxin FldB	NA	NA	NA	NA	NA
VEB54454.1|1934073_1934340_+|integrase	site-specific integrase/recombinase	integrase	NA	NA	NA	NA
VEB54456.1|1934308_1934971_+|integrase	site-specific integrase/recombinase	integrase	A0A0K2CP59	Brevibacillus_phage	31.8	2.5e-26
1943182:1943198	attR	CGCTGACGATCACTTTG	NA	NA	NA	NA
>prophage 10
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	2038620	2042385	4733176		Only_Syngen_Nebraska_virus(33.33%)	6	NA	NA
VEB54799.1|2038620_2039040_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	64.0	4.5e-45
VEB54801.1|2039183_2039765_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	38.7	4.8e-21
VEB54803.1|2039749_2040247_+	CTP synthetase	NA	A0A0R6PHX8	Moraxella_phage	48.3	3.2e-34
VEB54805.1|2040357_2040633_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	60.7	4.6e-22
VEB54807.1|2040712_2041282_+	enolase	NA	W6LP63	Streptococcus_phage	48.6	1.3e-42
VEB54809.1|2041773_2042385_+	Queuosine Biosynthesis QueE Radical SAM	NA	A0A2I7S8X1	Vibrio_phage	33.3	5.1e-13
>prophage 11
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	2072379	2080067	4733176		Escherichia_phage(85.71%)	13	NA	NA
VEB54894.1|2072379_2073372_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
VEB54896.1|2073472_2073655_-	Hydroxyaromatic non-oxidative decarboxylaseprotein D	NA	NA	NA	NA	NA
VEB54898.1|2073665_2074826_-	Hydroxyaromatic non-oxidative decarboxylaseprotein B, Hydroxyaromatic non-oxidatived ecarboxylase protein C	NA	NA	NA	NA	NA
VEB54900.1|2074875_2075067_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB54902.1|2075093_2075447_-	decarboxylase	NA	NA	NA	NA	NA
VEB54904.1|2075556_2075688_-	decarboxylase	NA	NA	NA	NA	NA
VEB54906.1|2075858_2076263_+	Transcriptional regulator hosA	NA	NA	NA	NA	NA
VEB54908.1|2076281_2076803_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	1.4e-43
VEB54910.1|2076750_2077047_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	59.1	3.0e-19
VEB54912.1|2077266_2078169_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.8	1.4e-104
VEB54914.1|2078162_2079209_+	membrane protein	NA	A0A077SLJ7	Escherichia_phage	61.2	2.3e-98
VEB54916.1|2079425_2079590_+	sugar aldolase	NA	A0A077SK32	Escherichia_phage	82.9	3.7e-11
VEB54918.1|2079809_2080067_+	sugar aldolase	NA	A0A077SK32	Escherichia_phage	72.6	6.2e-29
>prophage 12
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	2162674	2168183	4733176	tRNA	Pseudomonas_phage(50.0%)	12	NA	NA
VEB55219.1|2162674_2162881_+	competence damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	56.9	1.1e-09
VEB55221.1|2162846_2163164_+	competence damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	47.5	9.0e-14
VEB55223.1|2163257_2163476_+	recombinase A	NA	NA	NA	NA	NA
VEB55225.1|2163432_2163600_+	recombinase A	NA	A0A0S2MVG1	Bacillus_phage	72.0	1.2e-12
VEB55226.1|2163541_2164321_+	recombinase A	NA	A0A2D1GPX2	Mycobacterium_phage	63.5	2.9e-77
VEB55227.1|2164443_2164941_+	Regulatory protein recX	NA	NA	NA	NA	NA
VEB55228.1|2165176_2165848_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	43.5	1.3e-46
VEB55230.1|2165825_2166197_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEB55232.1|2166331_2166832_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEB55233.1|2166887_2167607_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEB55234.1|2167681_2167933_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEB55236.1|2168048_2168183_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	73.0	1.0e-06
>prophage 13
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	2183674	2187055	4733176		Mycobacterium_phage(25.0%)	9	NA	NA
VEB55276.1|2183674_2184001_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	A0A0N7CCA3	Skermania_phage	68.3	2.0e-32
VEB55278.1|2184072_2184276_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	73.4	6.3e-21
VEB55280.1|2184250_2184511_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	74.6	6.7e-23
VEB55282.1|2184600_2185221_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A0A2H4P903	Corynebacterium_phage	49.1	1.2e-38
VEB55284.1|2185481_2185967_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A7IYE5	Corynebacterium_phage	69.2	1.3e-59
VEB55286.1|2185995_2186223_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A8E2R1	Enterococcus_phage	60.0	3.9e-11
VEB55288.1|2186164_2186512_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A0A096XT50	Enterococcus_phage	49.1	2.8e-24
VEB55290.1|2186489_2186645_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	NA	NA	NA	NA
VEB55292.1|2186644_2187055_-	ribonucleotide reductase stimulatory protein	NA	A0A142F1R4	Bacillus_phage	41.8	3.3e-16
>prophage 14
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	2232510	2260356	4733176	integrase,transposase	Escherichia_phage(60.0%)	38	2233317:2233332	2260759:2260774
VEB55435.1|2232510_2232903_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VEB55437.1|2233284_2233647_-|integrase	prophage integrase	integrase	A0A1B5FPC6	Escherichia_phage	87.4	4.7e-51
2233317:2233332	attL	AACGGAAGATTTCATT	NA	NA	NA	NA
VEB55439.1|2233597_2233882_-|integrase	prophage integrase	integrase	A0A1B5FPC6	Escherichia_phage	91.2	3.8e-40
VEB55441.1|2235367_2235511_+	putative inner membrane protein	NA	NA	NA	NA	NA
VEB55443.1|2235998_2236148_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB55445.1|2236200_2237385_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEB55447.1|2238067_2238595_-|integrase	Phage integrase	integrase	NA	NA	NA	NA
VEB55449.1|2238620_2238950_-|integrase	Phage integrase	integrase	NA	NA	NA	NA
VEB55451.1|2239887_2240070_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB55453.1|2240069_2240240_-	putative dipeptide/oligopeptide/nickel ABC-type transport system periplasmic component	NA	NA	NA	NA	NA
VEB55455.1|2240199_2240991_-	putative dipeptide/oligopeptide/nickel ABC-type transport system periplasmic component	NA	NA	NA	NA	NA
VEB55457.1|2241067_2241283_-	putative dipeptide/oligopeptide/nickel ABC-type transport system periplasmic component	NA	NA	NA	NA	NA
VEB55459.1|2241227_2241617_-	putative dipeptide/oligopeptide/nickel ABC-type transport system periplasmic component	NA	NA	NA	NA	NA
VEB55461.1|2241975_2243214_+	PTS system, glucose-specific IIB component	NA	NA	NA	NA	NA
VEB55463.1|2243152_2243518_+	PTS system, glucose-specific IIB component	NA	NA	NA	NA	NA
VEB55465.1|2243647_2243923_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
VEB55467.1|2244060_2244492_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
VEB55469.1|2244488_2244986_+	6-phospho 3-hexuloisomerase	NA	NA	NA	NA	NA
VEB55471.1|2244964_2245336_+	D-arabino-3-hexulose 6-phosphate formaldehyde lyase	NA	NA	NA	NA	NA
VEB55472.1|2245283_2245721_+	D-arabino-3-hexulose 6-phosphate formaldehyde lyase	NA	NA	NA	NA	NA
VEB55474.1|2245953_2246112_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB55476.1|2246362_2246734_-	hexulose 6 phosphate synthase	NA	NA	NA	NA	NA
VEB55478.1|2246760_2246952_-	hexulose 6 phosphate synthase	NA	NA	NA	NA	NA
VEB55480.1|2247423_2247699_-	putative dehydrogenase	NA	NA	NA	NA	NA
VEB55482.1|2247730_2248294_-	putative dehydrogenase	NA	NA	NA	NA	NA
VEB55484.1|2248380_2249310_-	PTS system glucitol/sorbitol-specific IIB component and second of two IIC component	NA	NA	NA	NA	NA
VEB55486.1|2249306_2249528_-	PTS system glucitol/sorbitol-specific IIA component	NA	NA	NA	NA	NA
VEB55488.1|2249910_2250204_-	PTS system glucitol/sorbitol-specific IIC component	NA	NA	NA	NA	NA
VEB55490.1|2250368_2250602_-	Ner-like regulatory protein	NA	A0A2I7S995	Vibrio_phage	64.7	3.4e-18
VEB55492.1|2250824_2251055_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
VEB55494.1|2252455_2252623_-	ATPase	NA	NA	NA	NA	NA
VEB55496.1|2252936_2253368_-	ATPase	NA	NA	NA	NA	NA
VEB55498.1|2254080_2255943_-	Phage DNA primase	NA	A0A1B0VP75	Pseudomonas_phage	38.0	2.2e-67
VEB55500.1|2256081_2256195_-	Prophage CP4-57 regulatory protein (AlpA)	NA	NA	NA	NA	NA
VEB55502.1|2256823_2257327_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEB55504.1|2258661_2258931_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEB55506.1|2259499_2259739_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB55508.1|2260053_2260356_-|integrase	prophage integrase (pseudogene)	integrase	A0A1B5FPC6	Escherichia_phage	47.7	4.3e-13
2260759:2260774	attR	AACGGAAGATTTCATT	NA	NA	NA	NA
>prophage 15
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	2706444	2718474	4733176	protease,tail,holin,head	Salmonella_phage(43.75%)	23	NA	NA
VEB56968.1|2706444_2706693_+|tail	side tail fiber protein	tail	C9DGR1	Escherichia_phage	86.0	3.2e-22
VEB56970.1|2706851_2707235_+|tail	bacteriophage tail fiber assembly protein (pseudogene)	tail	Q6K1H1	Salmonella_virus	66.1	4.0e-32
VEB56972.1|2707399_2707744_+	Fis family transcriptional regulator	NA	Q9MBL9	Phage_Gifsy-2	81.2	1.5e-43
VEB56974.1|2707918_2709208_+	E3 ubiquitin-protein ligase SspH2	NA	NA	NA	NA	NA
VEB56976.1|2709207_2709480_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
VEB56978.1|2709529_2709781_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
VEB56980.1|2709913_2710108_+	DNA-binding protein	NA	Q8HA92	Salmonella_phage	75.0	3.6e-13
VEB56982.1|2710115_2710322_+	putative cytoplasmic protein	NA	A0A1C9IHZ5	Salmonella_phage	98.5	1.7e-29
VEB56984.1|2710321_2710570_+	putative cytoplasmic protein	NA	Q8HA91	Salmonella_phage	97.5	3.3e-19
VEB56986.1|2710526_2711006_+	putative cytoplasmic protein	NA	A0A1C9IHZ5	Salmonella_phage	92.9	5.4e-79
VEB56988.1|2710962_2711109_+	putative cytoplasmic protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	9.5e-19
VEB56990.1|2711126_2711492_+	phage antiterminator	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
VEB56992.1|2711626_2712442_-	NTPase	NA	R9TRQ8	Vibrio_phage	43.5	3.4e-12
VEB56994.1|2712629_2712719_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB56996.1|2713155_2713485_+|holin	holin	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
VEB56998.1|2713498_2713609_+|head,protease	phage pro-head protease	head,protease	Q8SBH9	Shigella_phage	77.1	8.7e-09
VEB57000.1|2713580_2713922_+|head,protease	phage pro-head protease	head,protease	Q8SBH9	Shigella_phage	91.7	1.6e-37
VEB57002.1|2714079_2714769_+	bacteriophage protein	NA	Q8HAB4	Salmonella_phage	95.3	5.7e-53
VEB57004.1|2714716_2715322_+	bacteriophage protein	NA	NA	NA	NA	NA
VEB57006.1|2715324_2715750_+|tail	tail protein	tail	A0A1S6KZZ1	Salmonella_phage	42.0	4.8e-10
VEB57008.1|2716213_2716669_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57010.1|2716730_2717018_-	acetylase	NA	NA	NA	NA	NA
VEB57012.1|2717010_2718474_-	acetylase	NA	A0A193GZ69	Enterobacter_phage	41.1	2.1e-49
>prophage 16
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	2792041	2801162	4733176	tRNA	Enterobacteria_phage(75.0%)	19	NA	NA
VEB57251.1|2792041_2792728_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.4	1.7e-20
VEB57253.1|2792705_2792990_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VEB57255.1|2792973_2793705_+	putative permease transmembrane component	NA	NA	NA	NA	NA
VEB57257.1|2793685_2793793_-	membrane protein	NA	NA	NA	NA	NA
VEB57259.1|2793841_2794585_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.6e-101
VEB57261.1|2794973_2795657_+	putative sensor kinase	NA	Q9EYF3	Enterobacteria_phage	92.2	2.0e-87
VEB57263.1|2795653_2796496_+	putative sensor kinase	NA	Q9EYF3	Enterobacteria_phage	89.6	5.2e-141
VEB57265.1|2796492_2796948_+	two-component system response regulator	NA	NA	NA	NA	NA
VEB57267.1|2796940_2797123_+	two-component system response regulator	NA	NA	NA	NA	NA
VEB57269.1|2797261_2797729_+	Protein of uncharacterised function (DUF1456)	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
VEB57271.1|2797796_2798018_-	lipoprotein	NA	NA	NA	NA	NA
VEB57273.1|2797968_2798211_-	lipoprotein	NA	NA	NA	NA	NA
VEB57275.1|2798495_2798666_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	60.8	1.5e-07
VEB57277.1|2798607_2798889_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	75.9	6.3e-27
VEB57279.1|2798857_2798956_-	lipoprotein	NA	NA	NA	NA	NA
VEB57281.1|2799200_2799872_-|tRNA	methionyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEB57283.1|2799837_2800311_-|tRNA	methionyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEB57285.1|2800285_2800756_-|tRNA	methionyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEB57286.1|2800763_2801162_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	35.0	3.2e-16
>prophage 17
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	2972577	2983216	4733176		Salmonella_phage(33.33%)	15	NA	NA
VEB57895.1|2972577_2973051_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
VEB57897.1|2974361_2975159_-	Putative inner membrane protein	NA	NA	NA	NA	NA
VEB57899.1|2975929_2976106_+	umuDC operon protein-like protein	NA	A0A1W6JNS2	Morganella_phage	59.6	2.2e-09
VEB57901.1|2976110_2976338_+	Error-prone repair protein UmuD	NA	I6S1S3	Salmonella_phage	84.6	1.5e-23
VEB57903.1|2976353_2976611_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.4	2.3e-36
VEB57905.1|2976657_2977407_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	84.3	2.6e-112
VEB57907.1|2977396_2977612_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	90.3	3.4e-25
VEB57909.1|2977643_2977883_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB57912.1|2978788_2979472_-	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	44.4	8.7e-30
VEB57914.1|2979459_2979960_-	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	67.8	1.5e-50
VEB57916.1|2980615_2980930_+	membrane protein	NA	NA	NA	NA	NA
VEB57918.1|2981009_2981603_+	metal-dependent phospho hydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.6	8.1e-08
VEB57920.1|2981782_2982148_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	88.5	3.0e-05
VEB57922.1|2982120_2982486_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	80.0	2.2e-24
VEB57924.1|2982520_2983216_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.1	5.0e-49
>prophage 18
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	3089255	3100381	4733176	integrase,tail,transposase	Salmonella_phage(33.33%)	16	3089103:3089125	3098872:3098894
3089103:3089125	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
VEB58326.1|3089255_3090824_-|integrase	phage integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.0	1.1e-80
VEB58328.1|3090987_3091086_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	95.8	2.8e-06
VEB58330.1|3091363_3091597_+	Protein gp55	NA	NA	NA	NA	NA
VEB58332.1|3091937_3092102_-	lytic enzyme	NA	NA	NA	NA	NA
VEB58334.1|3092412_3092607_+	DNA breaking-rejoining protein	NA	Q9EYD0	Enterobacteria_phage	72.7	1.3e-10
VEB58336.1|3092772_3093096_+|tail	caudovirales tail fibre assembly protein	tail	A0A0M4QWS3	Salmonella_phage	90.7	1.3e-15
VEB58338.1|3093073_3093271_+|tail	caudovirales tail fibre assembly protein	tail	NA	NA	NA	NA
VEB58340.1|3094327_3094771_-|transposase	transposase (fragment)	transposase	NA	NA	NA	NA
VEB58342.1|3095197_3095422_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB58344.1|3095871_3096090_-	inner membrane protein	NA	NA	NA	NA	NA
VEB58346.1|3096381_3096507_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB58348.1|3097366_3097564_-	drug/metabolite transporter DMT permease	NA	NA	NA	NA	NA
VEB58350.1|3097503_3097719_-	drug/metabolite transporter DMT permease	NA	NA	NA	NA	NA
VEB58352.1|3098322_3098490_+	putative product	NA	NA	NA	NA	NA
VEB58354.1|3099522_3099708_+|transposase	transposase	transposase	F6MIM4	Haemophilus_phage	64.7	8.7e-09
3098872:3098894	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
VEB58356.1|3099676_3100381_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.9	1.1e-19
>prophage 19
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	3481240	3487864	4733176		Escherichia_phage(100.0%)	11	NA	NA
VEB59717.1|3481240_3482161_+	dimethyl sulfoxide reductase, subunit A1	NA	A0A077SK27	Escherichia_phage	55.2	1.9e-88
VEB59719.1|3482135_3482612_+	dimethyl sulfoxide reductase, subunit A1	NA	A0A077SK27	Escherichia_phage	42.0	7.2e-23
VEB59721.1|3482608_3483049_+	dimethyl sulfoxide reductase, subunit A1	NA	A0A077SK27	Escherichia_phage	61.0	1.1e-36
VEB59723.1|3483174_3484578_+	dimethyl sulfoxide reductase subunit	NA	A0A077SK27	Escherichia_phage	50.2	6.9e-106
VEB59725.1|3484519_3484906_+	dimethyl sulfoxide reductase subunit	NA	NA	NA	NA	NA
VEB59727.1|3484911_3485154_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB59729.1|3485386_3485587_+	dimethyl sulfoxide reductase subunit	NA	A0A077SK27	Escherichia_phage	65.6	2.3e-15
VEB59731.1|3485623_3486151_+	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	9.0e-59
VEB59733.1|3486219_3486660_+	dimethyl sulfoxide reductase subunit H	NA	NA	NA	NA	NA
VEB59735.1|3486616_3487078_+	dimethyl sulfoxide reductase subunit H	NA	NA	NA	NA	NA
VEB59737.1|3487120_3487864_+	Anaerobic dimethyl sulfoxide reductasechaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.4	1.3e-26
>prophage 20
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	3629757	3635268	4733176		Hokovirus(50.0%)	12	NA	NA
VEB60242.1|3629757_3630135_+	short chain acyl-CoA synthetase	NA	A0A1V0SBX8	Catovirus	36.4	1.3e-11
VEB60244.1|3630109_3630340_+	short chain acyl-CoA synthetase	NA	NA	NA	NA	NA
VEB60246.1|3630516_3630738_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	55.2	1.4e-10
VEB60247.1|3630794_3631010_-	phosphoenolpyruvate synthase	NA	NA	NA	NA	NA
VEB60249.1|3631283_3631586_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.7	9.8e-10
VEB60251.1|3631557_3631761_-	phosphoenolpyruvate synthase	NA	NA	NA	NA	NA
VEB60253.1|3631760_3632801_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	43.7	2.9e-61
VEB60255.1|3633137_3633368_+	PEP synthetase regulatory protein	NA	NA	NA	NA	NA
VEB60257.1|3633354_3633558_+	PEP synthetase regulatory protein	NA	NA	NA	NA	NA
VEB60259.1|3633557_3633878_+	PEP synthetase regulatory protein	NA	NA	NA	NA	NA
VEB60261.1|3634130_3634415_+	3-deoxy-D-arabinoheptulosonate-7-phosphate synthase	NA	A0A0B6VT43	Edwardsiella_phage	44.6	8.1e-14
VEB60263.1|3634431_3635268_+	3-deoxy-D-arabinoheptulosonate-7-phosphate synthase	NA	S4W5F1	Pandoravirus	50.2	5.8e-52
>prophage 21
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	3886906	3965317	4733176	protease,terminase,tRNA,tail,head,holin,portal	Salmonella_phage(44.78%)	130	NA	NA
VEB61114.1|3886906_3887080_+|tRNA	tRNA 2-thiouridine synthesizing protein E	tRNA	NA	NA	NA	NA
VEB61116.1|3887045_3887237_+|tRNA	tRNA 2-thiouridine synthesizing protein E	tRNA	NA	NA	NA	NA
VEB61118.1|3887282_3887516_-	acylphosphatase	NA	NA	NA	NA	NA
VEB61120.1|3887744_3887984_-	Bacterial regulatory protein, AraC	NA	NA	NA	NA	NA
VEB61122.1|3888077_3888359_-	transcriptional regulator	NA	NA	NA	NA	NA
VEB61124.1|3888375_3888657_-	kinase inhibitor	NA	NA	NA	NA	NA
VEB61126.1|3889735_3890359_+	LSU m5C1962 methyl transferase RlmI	NA	NA	NA	NA	NA
VEB61128.1|3890416_3890734_+	hemimethylated DNA binding protein YccV	NA	NA	NA	NA	NA
VEB61130.1|3890806_3891193_-	Succinyl-CoA synthetase alpha subunit-related enzyme	NA	NA	NA	NA	NA
VEB61132.1|3891367_3891520_+	UPF0319 protein YccT precursor	NA	NA	NA	NA	NA
VEB61133.1|3891482_3891788_+	UPF0319 protein YccT precursor	NA	NA	NA	NA	NA
VEB61135.1|3891738_3891912_+	UPF0319 protein YccT precursor	NA	NA	NA	NA	NA
VEB61137.1|3892127_3892586_+	methylglyoxal synthase	NA	NA	NA	NA	NA
VEB61139.1|3892621_3893680_-	helicase IV	NA	A7KV33	Bacillus_phage	25.5	2.0e-09
VEB61141.1|3893654_3894482_-	helicase IV	NA	NA	NA	NA	NA
VEB61143.1|3894807_3895020_+	Inner membrane protein YccF	NA	NA	NA	NA	NA
VEB61145.1|3895019_3895235_+	Inner membrane protein YccF	NA	NA	NA	NA	NA
VEB61147.1|3895610_3896378_+	Putative efflux (PET) family inner membrane protein YccS	NA	NA	NA	NA	NA
VEB61149.1|3896352_3896667_+	Putative efflux (PET) family inner membrane protein YccS	NA	NA	NA	NA	NA
VEB61151.1|3896686_3897085_+	Putative efflux (PET) family inner membrane protein YccS	NA	NA	NA	NA	NA
VEB61153.1|3897186_3897438_+	Putative efflux (PET) family inner membrane protein YccS	NA	NA	NA	NA	NA
VEB61155.1|3897424_3897607_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61157.1|3897569_3897803_-	DNA transformation protein	NA	NA	NA	NA	NA
VEB61159.1|3897777_3898020_-	DNA transformation protein TfoX	NA	NA	NA	NA	NA
VEB61161.1|3898270_3898753_+	cell division inhibitor	NA	NA	NA	NA	NA
VEB61163.1|3899153_3899798_+	outer membrane protein A	NA	NA	NA	NA	NA
VEB61165.1|3899631_3900078_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61167.1|3900253_3900652_-	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
VEB61169.1|3900893_3901784_+|protease	protease	protease	NA	NA	NA	NA
VEB61171.1|3901839_3902343_+|protease	protease	protease	NA	NA	NA	NA
VEB61173.1|3902299_3902656_+|protease	protease	protease	NA	NA	NA	NA
VEB61175.1|3902724_3903243_+	3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase	NA	NA	NA	NA	NA
VEB61178.1|3903342_3903510_-	ribosome modulation factor	NA	NA	NA	NA	NA
VEB61180.1|3903765_3904227_-	lipoprotein	NA	NA	NA	NA	NA
VEB61182.1|3904165_3904468_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
VEB61184.1|3904427_3904697_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
VEB61186.1|3904797_3905970_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
VEB61188.1|3905974_3906319_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
VEB61190.1|3906273_3907581_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
VEB61192.1|3907519_3908062_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	29.9	1.7e-12
VEB61194.1|3908081_3908252_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VEB61196.1|3908378_3909158_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.9	1.8e-23
VEB61198.1|3909170_3909950_-	23S rRNA (guanine-N-2-) -methyl transferase rlmL	NA	NA	NA	NA	NA
VEB61200.1|3910190_3911282_-	23S rRNA (guanine-N-2-) -methyl transferase rlmL	NA	NA	NA	NA	NA
VEB61202.1|3911381_3912434_+	Flavodoxin reductases (ferredoxin-NADPHreductases) family 1	NA	NA	NA	NA	NA
VEB61204.1|3912492_3912999_-	Z-ring-associated protein C	NA	NA	NA	NA	NA
VEB61206.1|3913201_3913837_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
VEB61208.1|3913814_3914213_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
VEB61210.1|3914420_3915992_-	aminopeptidase N	NA	NA	NA	NA	NA
VEB61212.1|3915930_3916257_-	aminopeptidase N	NA	NA	NA	NA	NA
VEB61214.1|3916258_3917035_-	aminopeptidase N	NA	NA	NA	NA	NA
VEB61216.1|3917465_3917573_+	Gifsy-2 prophage MsgA	NA	S4TNM0	Salmonella_phage	100.0	4.8e-12
VEB61217.1|3918670_3918955_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61218.1|3920626_3920941_-|tail	phage tail assembly-like protein	tail	A0A0M4RTP2	Salmonella_phage	91.4	4.9e-44
VEB61220.1|3920940_3921705_-|tail	Gifsy-2 prophage tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	3.5e-43
VEB61222.1|3923460_3923685_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61224.1|3923723_3924506_-	host specificity protein J	NA	C6ZCZ5	Enterobacteria_phage	80.5	7.9e-35
VEB61226.1|3924619_3924862_-|tail	Phage tail fiber protein	tail	A5LH43	Enterobacteria_phage	72.2	6.2e-23
VEB61228.1|3924858_3925122_-|tail	Phage tail fiber protein	tail	A0A0P0ZDT4	Stx2-converting_phage	71.8	1.7e-26
VEB61230.1|3925152_3925956_-|tail	Phage tail fiber protein	tail	A0A291AWT4	Escherichia_phage	86.0	1.0e-85
VEB61232.1|3925903_3926128_-|tail	Phage tail fiber protein	tail	A0A2I6TCW5	Escherichia_phage	84.1	1.9e-26
VEB61234.1|3926117_3926885_-|tail	Phage tail fiber protein	tail	A0A2I6TCW5	Escherichia_phage	78.6	5.2e-116
VEB61236.1|3926850_3927096_-|tail	Phage tail fiber protein	tail	A0A2I6TCW5	Escherichia_phage	80.2	8.2e-31
VEB61238.1|3927158_3927701_-|tail	tail protein	tail	A5LH42	Enterobacteria_phage	79.3	1.0e-73
VEB61240.1|3927841_3928096_-	Gifsy-1 prophage VtaK	NA	K7PLW1	Enterobacteria_phage	82.3	7.4e-27
VEB61242.1|3928092_3928446_-	Tail fiber component K	NA	K7PLW1	Enterobacteria_phage	82.5	6.9e-55
VEB61244.1|3928452_3929025_-|tail	Minor tail protein L	tail	B6DZB1	Enterobacteria_phage	77.8	3.0e-84
VEB61246.1|3928981_3929152_-|tail	Minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	69.6	4.5e-12
VEB61248.1|3929161_3929491_-|tail	tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
VEB61250.1|3929493_3930801_-|tail	tail protein	tail	A5LH38	Enterobacteria_phage	57.3	8.1e-117
VEB61252.1|3930797_3931427_-|tail	tail protein	tail	A0A291AWX1	Escherichia_phage	59.7	1.0e-40
VEB61254.1|3931419_3932592_-|tail	tail protein	tail	E4WL33	Enterobacteria_phage	52.5	1.0e-94
VEB61256.1|3932563_3932881_-|tail	minor tail-like protein	tail	A5LH37	Enterobacteria_phage	62.3	3.1e-30
VEB61258.1|3932898_3933294_-|tail	minor tail protein	tail	A5LH36	Enterobacteria_phage	55.7	8.6e-30
VEB61260.1|3933344_3933938_-|tail	putative tail component of prophage	tail	A0A291AWU6	Escherichia_phage	65.0	5.0e-50
VEB61262.1|3934100_3934502_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
VEB61264.1|3934498_3935077_-	Gifsy-1 prophagei VmtZ	NA	A5LH33	Enterobacteria_phage	80.2	3.7e-82
VEB61266.1|3935063_3935441_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
VEB61268.1|3935451_3935817_-	DNA packaging protein	NA	NA	NA	NA	NA
VEB61270.1|3935874_3936903_-|head	head protein	head	C6ZCY2	Enterobacteria_phage	61.1	2.3e-114
VEB61272.1|3936957_3937305_-	Head decoration protein	NA	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
VEB61274.1|3937317_3938814_-	scaffold protein	NA	A0A0K2FI53	Enterobacteria_phage	51.9	4.0e-96
VEB61276.1|3938803_3939046_-	Portal protein Head protein Gp4	NA	A0A2I6TC89	Escherichia_phage	67.5	3.5e-18
VEB61278.1|3939035_3939698_-	Portal protein Head protein Gp4	NA	K7P6U7	Enterobacteria_phage	69.0	7.3e-74
VEB61280.1|3939672_3940587_-|portal	phage portal protein, lambda family	portal	K7P6U7	Enterobacteria_phage	58.7	3.8e-65
VEB61282.1|3940570_3940852_-|terminase	terminase	terminase	O64317	Escherichia_phage	56.6	7.7e-17
VEB61284.1|3940857_3942132_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	68.5	9.4e-179
VEB61286.1|3942079_3942505_-|terminase	terminase	terminase	O64317	Escherichia_phage	65.5	9.8e-48
VEB61288.1|3942476_3943022_-|terminase	terminase	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
VEB61290.1|3943386_3943710_+	Inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
VEB61292.1|3944042_3944288_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61294.1|3944301_3944478_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61296.1|3944723_3945272_-	putative endopeptidase	NA	A0A0M4RD57	Salmonella_phage	88.7	1.0e-60
VEB61298.1|3945268_3945721_-	Lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
VEB61300.1|3945720_3946041_-|holin	bacteriophage holin	holin	A0A0M3ULK9	Salmonella_phage	99.0	4.2e-51
VEB61302.1|3946524_3946998_+	GogA	NA	Q9MBM0	Phage_Gifsy-2	100.0	9.1e-87
VEB61304.1|3947004_3947142_-|holin	holin	holin	NA	NA	NA	NA
VEB61306.1|3947358_3947808_+	Gifsy-2 prophage protein	NA	NA	NA	NA	NA
VEB61308.1|3948263_3949091_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	50.6	9.8e-60
VEB61310.1|3949087_3949699_-	bacteriophage Lambda NinG protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
VEB61312.1|3949701_3949908_-	Phage protein	NA	S4TNP0	Salmonella_phage	98.5	4.6e-35
VEB61314.1|3949907_3950510_-	bacteriophage protein	NA	A0A0M4QX23	Salmonella_phage	98.0	3.2e-108
VEB61316.1|3950927_3951161_-	DNA damage-inducible protein I	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
VEB61318.1|3951753_3952350_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61320.1|3952361_3952517_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61322.1|3952666_3953341_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61325.1|3953395_3953656_-	putative DNA methyl transferase	NA	NA	NA	NA	NA
VEB61327.1|3953937_3954300_-	Phage EaA protein	NA	A0A1V0E5L6	Salmonella_phage	75.3	3.8e-24
VEB61329.1|3954303_3954612_-	Uncharacterised protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
VEB61331.1|3954615_3955074_-	prophage protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
VEB61333.1|3955070_3955418_-	DNA-binding protein	NA	H6WRX9	Salmonella_phage	91.3	2.2e-53
VEB61335.1|3955428_3955728_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	89.8	1.8e-43
VEB61337.1|3955681_3956095_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	91.5	2.4e-59
VEB61339.1|3956714_3957167_-	prophage protein replication Protein O	NA	S4TNJ9	Salmonella_phage	97.3	1.1e-78
VEB61341.1|3957257_3957578_-	repressor	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
VEB61343.1|3958114_3958345_+	regulatory protein	NA	NA	NA	NA	NA
VEB61345.1|3958564_3958681_+	Gifsy-1 prophage protein	NA	NA	NA	NA	NA
VEB61347.1|3958673_3958832_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
VEB61349.1|3958917_3959040_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61351.1|3959334_3959724_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	96.1	6.6e-67
VEB61353.1|3960130_3961096_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	92.8	6.8e-121
VEB61355.1|3961174_3961444_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	98.7	1.2e-35
VEB61357.1|3961391_3962111_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	87.3	1.8e-86
VEB61359.1|3962139_3962283_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	100.0	3.8e-20
VEB61361.1|3962293_3962707_+	Gifsy-2 prophage RecT	NA	H6WRX0	Salmonella_phage	99.2	2.6e-69
VEB61363.1|3963065_3963473_+	gifsy-2 prophage RecT	NA	H6WRX0	Salmonella_phage	100.0	3.3e-45
VEB61365.1|3963450_3963690_+	putative bacteriophage protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
VEB61367.1|3963730_3963979_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
VEB61369.1|3964023_3964845_+	Integrase	NA	S4TSP2	Salmonella_phage	100.0	6.1e-155
VEB61371.1|3964807_3965317_+	Integrase	NA	S4TSP2	Salmonella_phage	99.4	7.3e-90
>prophage 22
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	4015518	4039764	4733176	integrase,tRNA,transposase,protease	Escherichia_phage(38.89%)	44	4031613:4031627	4043315:4043329
VEB61560.1|4015518_4016010_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	62.3	2.1e-62
VEB61562.1|4016145_4016694_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	47.8	3.7e-39
VEB61564.1|4016665_4017199_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.2	7.5e-37
VEB61566.1|4017294_4017495_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	57.4	3.3e-14
VEB61568.1|4017436_4017736_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.3	4.4e-18
VEB61570.1|4017704_4018253_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.5e-35
VEB61572.1|4018209_4018476_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	NA	NA	NA	NA
VEB61574.1|4018713_4019889_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.9	3.0e-94
VEB61576.1|4020261_4021407_-	Holliday junction DNA helicase	NA	G3MBE0	Bacillus_virus	38.6	2.2e-62
VEB61578.1|4021408_4021555_-	Holliday junction DNA helicase	NA	NA	NA	NA	NA
VEB61580.1|4021708_4022236_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VEB61582.1|4022378_4022687_-	DNA translocase ftsK	NA	J7I0T4	Pseudomonas_phage	58.1	1.7e-12
VEB61584.1|4022698_4022992_-	DNA translocase ftsK	NA	A0A218M9A2	Mycobacterium_phage	70.7	2.9e-22
VEB61586.1|4023008_4023362_-	DNA translocase ftsK	NA	A0A218M9A2	Mycobacterium_phage	54.9	2.0e-14
VEB61588.1|4023381_4025409_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.8	1.1e-24
VEB61590.1|4025395_4025752_-	DNA translocase ftsK	NA	NA	NA	NA	NA
VEB61592.1|4025702_4026440_-	DNA translocase ftsK	NA	NA	NA	NA	NA
VEB61594.1|4026574_4027069_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
VEB61596.1|4027614_4027827_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	51.6	2.6e-09
VEB61598.1|4027792_4028095_+	thioredoxin reductase	NA	G3MA85	Bacillus_virus	43.1	2.3e-14
VEB61600.1|4028129_4028477_+	thioredoxin reductase	NA	NA	NA	NA	NA
VEB61602.1|4028700_4028991_+	cysteine/glutathione ABC transporter membrane /ATP-binding component	NA	NA	NA	NA	NA
VEB61604.1|4028944_4029268_+	cysteine/glutathione ABC transporter membrane /ATP-binding component	NA	NA	NA	NA	NA
VEB61606.1|4029254_4029644_+	cysteine/glutathione ABC transporter membrane /ATP-binding component	NA	NA	NA	NA	NA
VEB61608.1|4029884_4030499_+	cysteine/glutathione ABC transporter membrane /ATP-binding component	NA	W8CYL7	Bacillus_phage	33.6	3.3e-12
VEB61610.1|4030653_4030944_+	transport ATP-binding protein CydC	NA	NA	NA	NA	NA
VEB61612.1|4031154_4031427_+	transport ATP-binding protein CydC	NA	NA	NA	NA	NA
VEB61614.1|4031540_4032053_+	Uncharacterised protein	NA	NA	NA	NA	NA
4031613:4031627	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
VEB61616.1|4032007_4032112_+	transport ATP-binding protein CydC	NA	NA	NA	NA	NA
VEB61618.1|4032262_4032583_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VEB61620.1|4032560_4033004_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VEB61622.1|4033281_4033428_+	initiation factor IF-1	NA	NA	NA	NA	NA
VEB61624.1|4033367_4033484_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61626.1|4033546_4034203_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB61628.1|4034141_4034507_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB61630.1|4034615_4034999_+	pirin-like protein	NA	NA	NA	NA	NA
VEB61632.1|4034979_4035486_+	pirin-like protein	NA	NA	NA	NA	NA
VEB61634.1|4035540_4036176_+	Isochorismatase family protein	NA	NA	NA	NA	NA
VEB61636.1|4036514_4036916_+|transposase	ISPsy11, transposase OrfA	transposase	NA	NA	NA	NA
VEB61638.1|4037166_4037469_+|integrase	integrase	integrase	NA	NA	NA	NA
VEB61640.1|4037536_4037803_+|integrase	integrase	integrase	NA	NA	NA	NA
VEB61642.1|4038336_4038705_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1S6UBG5	Serratia_phage	34.8	1.4e-05
VEB61644.1|4038966_4039200_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	50.0	3.1e-11
VEB61646.1|4039377_4039764_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	55.1	2.3e-35
4043315:4043329	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 23
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	4196029	4199608	4733176		Pandoravirus(33.33%)	9	NA	NA
VEB61966.1|4196029_4196338_-	Phospho-2-dehydro-3-deoxyheptonate aldolase	NA	S4VUY9	Pandoravirus	44.7	4.3e-13
VEB61967.1|4196357_4196600_-	Phospho-2-dehydro-3-deoxyheptonate aldolase	NA	S4VUY9	Pandoravirus	50.0	6.2e-07
VEB61968.1|4196740_4196896_-	Phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A218MA87	Escherichia_phage	66.7	6.8e-07
VEB61969.1|4196840_4197215_-	Phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A218MA87	Escherichia_phage	48.3	3.0e-08
VEB61970.1|4197406_4197700_+	putative secreted protein	NA	NA	NA	NA	NA
VEB61971.1|4197671_4197794_+	putative secreted protein	NA	NA	NA	NA	NA
VEB61972.1|4197904_4198528_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	38.0	2.2e-11
VEB61973.1|4198589_4198841_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB61974.1|4198840_4199608_-	protein PnuC	NA	A0A126HGA3	Vibrio_phage	35.3	8.9e-23
>prophage 24
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	4268314	4275085	4733176	tRNA	Escherichia_phage(66.67%)	10	NA	NA
VEB62088.1|4268314_4269163_+	citrate-proton symporter	NA	Q6JIH2	Burkholderia_virus	37.2	7.5e-31
VEB62089.1|4269116_4269422_+	citrate-proton symporter	NA	NA	NA	NA	NA
VEB62090.1|4269471_4269777_-	putative lipoprotein	NA	NA	NA	NA	NA
VEB62091.1|4269958_4270615_-	outer membrane protein	NA	NA	NA	NA	NA
VEB62092.1|4270565_4271009_-	outer membrane protein	NA	NA	NA	NA	NA
VEB62093.1|4271936_4272167_-|tRNA	glutaminyl-tRNA synthetase	tRNA	A0A222YZ70	Escherichia_phage	86.7	1.2e-31
VEB62094.1|4272219_4272516_-|tRNA	glutaminyl-tRNA synthetase	tRNA	A0A222YZ70	Escherichia_phage	98.0	2.3e-51
VEB62095.1|4272523_4273135_-|tRNA	glutaminyl-tRNA synthetase	tRNA	A0A222YZ70	Escherichia_phage	100.0	5.5e-108
VEB62096.1|4273293_4273608_-|tRNA	glutaminyl-tRNA synthetase	tRNA	A0A222YZ70	Escherichia_phage	97.8	1.2e-50
VEB62097.1|4273819_4275085_-	pts system, N-acetylglucosamine-specific IIABC component	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.9e-09
>prophage 25
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	4459185	4518579	4733176	tRNA,transposase,protease	Moraxella_phage(21.43%)	102	NA	NA
VEB62411.1|4459185_4459422_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VEB62412.1|4459525_4459756_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VEB62413.1|4459752_4460049_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VEB62414.1|4460110_4460404_+|protease	Putative activity regulator of membraneprotease YbbK	protease	NA	NA	NA	NA
VEB62415.1|4460415_4460565_+|protease	Putative activity regulator of membraneprotease YbbK	protease	NA	NA	NA	NA
VEB62416.1|4460565_4460907_-	copper efflux regulator	NA	NA	NA	NA	NA
VEB62417.1|4461095_4461314_+	Lead cadmium zinc and mercury transporting ATPase	NA	NA	NA	NA	NA
VEB62418.1|4461636_4461813_+	Lead cadmium zinc and mercury transporting ATPase	NA	NA	NA	NA	NA
VEB62419.1|4461848_4462202_+	Lead cadmium zinc and mercury transporting ATPase	NA	NA	NA	NA	NA
VEB62420.1|4462168_4462525_+	Lead cadmium zinc and mercury transporting ATPase	NA	NA	NA	NA	NA
VEB62421.1|4462564_4462825_+	Lead cadmium zinc and mercury transporting ATPase	NA	A0A218MNH6	uncultured_virus	44.7	1.9e-09
VEB62422.1|4462921_4463083_+	Lead cadmium zinc and mercury transporting ATPase	NA	NA	NA	NA	NA
VEB62423.1|4463114_4463600_+	Lead cadmium zinc and mercury transporting ATPase	NA	NA	NA	NA	NA
VEB62424.1|4463767_4464112_+	Secreted protein	NA	NA	NA	NA	NA
VEB62425.1|4464050_4464374_+	Secreted protein	NA	NA	NA	NA	NA
VEB62426.1|4464688_4465111_+	GumN family protein	NA	NA	NA	NA	NA
VEB62427.1|4465082_4465295_+	GumN family protein	NA	NA	NA	NA	NA
VEB62428.1|4465686_4466166_+|tRNA	Cys-tRNA(Pro) deacylase YbaK	tRNA	NA	NA	NA	NA
VEB62429.1|4466256_4466853_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase periplasmic precursor	NA	NA	NA	NA	NA
VEB62430.1|4466849_4467059_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
VEB62431.1|4467104_4467593_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase periplasmic precursor	NA	NA	NA	NA	NA
VEB62432.1|4467686_4467965_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase periplasmic precursor	NA	NA	NA	NA	NA
VEB62433.1|4468119_4469271_+	fosmidomycin resistance protein	NA	NA	NA	NA	NA
VEB62434.1|4469556_4469901_+	transport protein	NA	NA	NA	NA	NA
VEB62435.1|4469900_4470728_+	transport protein	NA	NA	NA	NA	NA
VEB62436.1|4470814_4471237_+	transport protein	NA	NA	NA	NA	NA
VEB62437.1|4471395_4472520_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
VEB62438.1|4472823_4473000_+	acetyl esterase	NA	NA	NA	NA	NA
VEB62439.1|4473144_4473729_+	acetyl esterase	NA	NA	NA	NA	NA
VEB62440.1|4473891_4474203_-	ferrochelatase	NA	NA	NA	NA	NA
VEB62441.1|4474526_4474766_-	ferrochelatase	NA	NA	NA	NA	NA
VEB62442.1|4474995_4475121_-	adenylate kinase	NA	NA	NA	NA	NA
VEB62443.1|4475229_4475358_-	adenylate kinase	NA	NA	NA	NA	NA
VEB62444.1|4475354_4475645_-	adenylate kinase	NA	NA	NA	NA	NA
VEB62445.1|4475888_4476689_-	chaperone protein HtpG	NA	NA	NA	NA	NA
VEB62446.1|4476787_4476964_-	chaperone protein HtpG	NA	NA	NA	NA	NA
VEB62447.1|4477255_4477516_-	chaperone protein HtpG	NA	A0A1V0SHA7	Hokovirus	52.5	2.0e-11
VEB62448.1|4477555_4477768_-	chaperone protein HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	56.9	3.4e-09
VEB62449.1|4477878_4478127_-	recombination protein RecR	NA	NA	NA	NA	NA
VEB62450.1|4478490_4478820_-	DNA-binding protein, YbaB/EbfC family	NA	NA	NA	NA	NA
VEB62451.1|4478865_4479291_-	DNA polymerase III subunits gamma and tau	NA	NA	NA	NA	NA
VEB62452.1|4480908_4481463_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	6.0e-29
VEB62453.1|4481755_4482055_-	Inner membrane protein YbaN	NA	NA	NA	NA	NA
VEB62454.1|4482171_4482339_+	Primosomal replication protein N''	NA	NA	NA	NA	NA
VEB62455.1|4482335_4482605_+	Primosomal replication protein N prime prime	NA	NA	NA	NA	NA
VEB62456.1|4482619_4482757_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VEB62457.1|4482859_4483018_+	Transposase_31	NA	NA	NA	NA	NA
VEB62458.1|4483014_4483578_+|transposase	ISNCY transposase	transposase	Q2A0A7	Sodalis_phage	59.3	4.6e-37
VEB62459.1|4483588_4483798_+|transposase	Putative transposase	transposase	NA	NA	NA	NA
VEB62460.1|4483840_4484050_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEB62461.1|4484046_4484679_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEB62462.1|4484846_4485089_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEB62463.1|4485027_4485357_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEB62464.1|4485307_4487098_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEB62465.1|4487042_4487210_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEB62466.1|4487266_4487983_-	potential acrAB operon repressor	NA	NA	NA	NA	NA
VEB62467.1|4488125_4489271_+	acriflavin resistance protein A	NA	NA	NA	NA	NA
VEB62468.1|4489342_4491121_+	acriflavin resistance protein B	NA	NA	NA	NA	NA
VEB62469.1|4491110_4491575_+	acriflavin resistance protein B	NA	NA	NA	NA	NA
VEB62470.1|4491664_4492495_+	acriflavin resistance protein B	NA	NA	NA	NA	NA
VEB62471.1|4492994_4493177_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
VEB62472.1|4493157_4493370_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
VEB62473.1|4493397_4493616_+	hemolysin expression modulating protein	NA	NA	NA	NA	NA
VEB62474.1|4493794_4494337_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
VEB62475.1|4494464_4494686_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VEB62476.1|4495304_4495400_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEB62477.1|4495624_4495951_+	Uncharacterized protein ylaB	NA	NA	NA	NA	NA
VEB62478.1|4495985_4496195_+	Uncharacterized protein ylaB	NA	NA	NA	NA	NA
VEB62479.1|4496197_4496869_+	Uncharacterized protein ylaB	NA	NA	NA	NA	NA
VEB62480.1|4496942_4497179_+	Uncharacterized protein ylaB	NA	NA	NA	NA	NA
VEB62481.1|4497488_4497800_+	methylated-DNA-[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
VEB62482.1|4497869_4498094_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB62483.1|4498068_4498404_-	lipoprotein	NA	NA	NA	NA	NA
VEB62484.1|4498618_4498966_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
VEB62485.1|4498928_4499480_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
VEB62486.1|4499580_4499901_-	ammonium transporter	NA	NA	NA	NA	NA
VEB62487.1|4499893_4500205_-	ammonium transporter	NA	NA	NA	NA	NA
VEB62488.1|4500221_4500674_-	ammonium transporter	NA	NA	NA	NA	NA
VEB62489.1|4500919_4501243_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
VEB62490.1|4501455_4502523_-	Multidrug resistance-like ATP-binding protein mdlB	NA	W8CYL7	Bacillus_phage	30.1	8.6e-24
VEB62491.1|4502467_4503025_-	Multidrug resistance-like ATP-binding protein mdlB	NA	NA	NA	NA	NA
VEB62492.1|4502969_4503239_-	Multidrug resistance-like ATP-binding protein mdlB	NA	NA	NA	NA	NA
VEB62493.1|4503231_4503843_-	ABC transporter ATP-binding membrane protein	NA	W8CYL7	Bacillus_phage	51.3	3.9e-21
VEB62494.1|4503844_4504576_-	ABC transporter ATP-binding membrane protein	NA	NA	NA	NA	NA
VEB62495.1|4504535_4505006_-	ABC transporter ATP-binding membrane protein	NA	NA	NA	NA	NA
VEB62496.1|4505046_4505166_-	transcriptional regulator	NA	NA	NA	NA	NA
VEB62497.1|4505152_4505506_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VEB62498.1|4505619_4506333_+	lyase	NA	NA	NA	NA	NA
VEB62499.1|4506394_4506748_+	lyase	NA	NA	NA	NA	NA
VEB62500.1|4506727_4507546_-	HMP-PP phosphatase	NA	NA	NA	NA	NA
VEB62501.1|4507646_4508654_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEB62502.1|4508598_4509348_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEB62503.1|4509412_4509679_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	72.8	1.3e-26
VEB62504.1|4509662_4510109_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.3	4.8e-53
VEB62505.1|4510214_4510613_-	4-hydroxybenzoyl-CoA thio esterase family activesite	NA	NA	NA	NA	NA
VEB62506.1|4510716_4511091_-	competence protein ComEA	NA	NA	NA	NA	NA
VEB62507.1|4511240_4513112_-	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VEB62508.1|4513887_4514115_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	60.0	4.6e-12
VEB62509.1|4514280_4515516_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	62.6	1.1e-147
VEB62510.1|4515475_4516246_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	29.2	2.1e-19
VEB62511.1|4516432_4517704_-|protease	ATP-dependent clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
VEB62512.1|4517955_4518579_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 26
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	4614902	4623609	4733176		Enterobacteria_phage(50.0%)	11	NA	NA
VEB62691.1|4614902_4615820_-	type III restriction-modification system protein	NA	Q71TG1	Escherichia_phage	46.2	1.2e-34
VEB62692.1|4615776_4616709_-	type III restriction-modification system protein	NA	Q71TG1	Escherichia_phage	35.2	8.5e-28
VEB62693.1|4616870_4617545_-	type III restriction-modification system StyLTI enzyme mod	NA	NA	NA	NA	NA
VEB62694.1|4617531_4618350_-	type III restriction-modification system StyLTI enzyme mod	NA	Q1MVP0	Enterobacteria_phage	31.9	2.4e-26
VEB62695.1|4618375_4618486_-	type III restriction-modification system StyLTI enzyme mod	NA	Q1MVP0	Enterobacteria_phage	71.4	2.6e-05
VEB62696.1|4618460_4618832_-	type III restriction-modification system StyLTI enzyme mod	NA	Q1MVP0	Enterobacteria_phage	29.3	1.1e-05
VEB62697.1|4619020_4619542_-	metabolite transport protein	NA	NA	NA	NA	NA
VEB62698.1|4619531_4620275_-	metabolite transport protein	NA	NA	NA	NA	NA
VEB62699.1|4620410_4620833_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB62700.1|4620856_4621309_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VEB62701.1|4621320_4623609_-	Heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.3	2.1e-91
>prophage 27
LR134190	Salmonella enterica subsp. enterica strain NCTC6754 genome assembly, chromosome: 1	4733176	4652397	4657149	4733176	transposase	Enterobacteria_phage(50.0%)	8	NA	NA
VEB62752.1|4652397_4652598_+|transposase	IS3 transposase	transposase	U5P429	Shigella_phage	57.9	2.4e-12
VEB62753.1|4653554_4654637_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	1.1e-87
VEB62754.1|4654657_4654753_-	gamma-glutamyl phosphate reductase	NA	NA	NA	NA	NA
VEB62755.1|4654853_4655135_-	Glutamate 5-kinase	NA	NA	NA	NA	NA
VEB62756.1|4655228_4655873_-	Glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	47.4	7.4e-39
VEB62757.1|4656159_4656744_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	62.7	4.2e-57
VEB62758.1|4656697_4656988_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	49.4	5.5e-10
VEB62759.1|4656984_4657149_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	70.5	2.8e-11
