The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134187	Salmonella enterica subsp. enterica serovar Havana strain NCTC6086 genome assembly, chromosome: 1	4708696	16431	26542	4708696		Bacillus_phage(25.0%)	11	NA	NA
VEB45868.1|16431_17670_+	Colanic acid biosynthesis protein wcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	1.3e-20
VEB45869.1|18016_18910_+	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
VEB45870.1|19244_19505_+	UDP-galactose-4-epimerase	NA	A0A1V0SG19	Hokovirus	45.2	2.0e-11
VEB45871.1|19805_20264_+	UDP-galactose-4-epimerase	NA	A0A2K9L1R4	Tupanvirus	42.9	6.9e-31
VEB45872.1|20312_21425_+	glycosyl transferase family 1	NA	NA	NA	NA	NA
VEB45873.1|21472_22591_+	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	5.3e-133
VEB45874.1|22593_23559_+	GDP-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
VEB45875.1|23561_24062_+	O-antigen biosynthesis protein	NA	NA	NA	NA	NA
VEB45876.1|24054_25122_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.6	2.2e-35
VEB45877.1|25123_25504_+	mannose-1-phosphate guanyltransferase	NA	NA	NA	NA	NA
VEB45878.1|25507_26542_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	28.2	5.0e-29
>prophage 2
LR134187	Salmonella enterica subsp. enterica serovar Havana strain NCTC6086 genome assembly, chromosome: 1	4708696	242303	284771	4708696	protease,transposase,integrase	Moraxella_phage(22.22%)	43	235772:235786	275698:275712
235772:235786	attL	TACGCCGCTGGATGT	NA	NA	NA	NA
VEB46097.1|242303_242573_-|integrase	phage integrase protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.5	1.1e-17
VEB46098.1|242918_245339_+	leucine-rich repeat protein	NA	Q9MBL9	Phage_Gifsy-2	72.7	1.1e-55
VEB46099.1|245345_245708_+|transposase	transposase, Mutator family protein	transposase	A0A218MNI5	uncultured_virus	61.9	1.1e-15
VEB46100.1|245670_246009_+|transposase	transposase	transposase	NA	NA	NA	NA
VEB46101.1|247173_247521_+	acetyltransferase	NA	NA	NA	NA	NA
VEB46102.1|247908_248385_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB46103.1|248713_249109_-	protein ycgX	NA	C6ZCX4	Enterobacteria_phage	32.8	7.0e-16
VEB46104.1|249793_250516_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
VEB46105.1|250800_250965_+	membrane protein	NA	NA	NA	NA	NA
VEB46106.1|251190_251838_+	Serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	6.5e-59
VEB46107.1|251856_252048_-	putative secreted protein	NA	NA	NA	NA	NA
VEB46108.1|252158_252398_-	conserved domain protein	NA	NA	NA	NA	NA
VEB46109.1|252794_254054_-	rRNA (cytosine-C(5)-)-methyltransferase RsmF	NA	NA	NA	NA	NA
VEB46110.1|254029_256663_-	mce-related protein	NA	NA	NA	NA	NA
VEB46111.1|256631_257915_-	Paraquat-inducible protein A	NA	NA	NA	NA	NA
VEB46112.1|257971_258541_+	GAF domain-containing protein	NA	NA	NA	NA	NA
VEB46113.1|258638_259325_+	ProP effector	NA	NA	NA	NA	NA
VEB46114.1|259344_259653_+|protease	Tail-specific protease precursor	protease	NA	NA	NA	NA
VEB46115.1|259597_261394_+|protease	Tail-specific protease precursor	protease	A0A0R6PIZ1	Moraxella_phage	34.8	2.4e-79
VEB46116.1|261588_262470_+	heat shock protein	NA	NA	NA	NA	NA
VEB46117.1|262518_263892_-	export protein	NA	NA	NA	NA	NA
VEB46118.1|263956_264064_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB46119.1|264067_264859_+	transcriptional regulator KdgR	NA	NA	NA	NA	NA
VEB46120.1|265070_265310_-	putative exported protein	NA	NA	NA	NA	NA
VEB46121.1|265467_265611_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VEB46122.1|265681_265969_+	putative exported protein	NA	NA	NA	NA	NA
VEB46123.1|267202_268948_+	penicillin-binding protein	NA	NA	NA	NA	NA
VEB46124.1|269013_269823_+	23S rRNA methyltransferase A	NA	NA	NA	NA	NA
VEB46125.1|269819_270209_-	membrane protein YebN	NA	NA	NA	NA	NA
VEB46126.1|270198_270387_-	membrane protein YebN	NA	NA	NA	NA	NA
VEB46127.1|270796_271255_-	membrane protein	NA	NA	NA	NA	NA
VEB46128.1|271313_272165_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
VEB46129.1|272177_272978_-	phosphotransferase enzyme II, C component	NA	NA	NA	NA	NA
VEB46130.1|273030_273999_-	PTS system mannose-specific transporter subunit IIAB	NA	NA	NA	NA	NA
VEB46131.1|274471_276031_+	Magnesium and cobalt efflux protein CorC	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
275698:275712	attR	TACGCCGCTGGATGT	NA	NA	NA	NA
VEB46132.1|276052_277654_-	cyclic diguanylate phosphodiesterase (EAL) domain protein	NA	NA	NA	NA	NA
VEB46133.1|277791_279156_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
VEB46134.1|279419_279998_-	putative nudix hydrolase YeaB	NA	NA	NA	NA	NA
VEB46135.1|280001_281366_-	para-aminobenzoate synthase component I	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
VEB46136.1|281446_281626_+	conserved domain protein	NA	NA	NA	NA	NA
VEB46137.1|281631_281976_-	Putative translation initiation inhibitor YoaB	NA	NA	NA	NA	NA
VEB46138.1|282107_284018_+	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	32.7	5.9e-92
VEB46139.1|284075_284771_+|protease	metal-dependent protease-like protein, putative molecular chaperone	protease	NA	NA	NA	NA
>prophage 3
LR134187	Salmonella enterica subsp. enterica serovar Havana strain NCTC6086 genome assembly, chromosome: 1	4708696	1494606	1504027	4708696	transposase,integrase	Salmonella_phage(42.86%)	11	1498228:1498272	1504041:1504085
VEB47313.1|1494606_1495932_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.8e-103
VEB47314.1|1496147_1497002_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VEB47315.1|1497052_1497244_-	cation efflux system protein CusA	NA	NA	NA	NA	NA
VEB47316.1|1497274_1497586_+	sensor kinase CusS	NA	NA	NA	NA	NA
VEB47317.1|1497895_1498141_+	copE1	NA	NA	NA	NA	NA
1498228:1498272	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
VEB47318.1|1498565_1498928_+	translocase	NA	I1TED9	Salmonella_phage	98.3	3.3e-60
VEB47319.1|1498924_1499842_+	bactoprenol glucosyl transferase	NA	I1TED8	Salmonella_phage	92.8	4.9e-161
VEB47320.1|1499838_1501263_+	GtrC	NA	F1C5A9	Cronobacter_phage	26.5	1.8e-29
VEB47321.1|1501364_1501946_+|transposase	transposase IS1113	transposase	F6MIM4	Haemophilus_phage	60.8	8.8e-07
VEB47322.1|1501961_1502573_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	47.6	8.6e-45
VEB47323.1|1502863_1504027_+|integrase	integrase	integrase	B9UDL9	Salmonella_phage	96.9	9.7e-223
1504041:1504085	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGA	NA	NA	NA	NA
>prophage 4
LR134187	Salmonella enterica subsp. enterica serovar Havana strain NCTC6086 genome assembly, chromosome: 1	4708696	1554126	1613366	4708696	protease,transposase,tRNA	Bacillus_phage(23.08%)	55	NA	NA
VEB47377.1|1554126_1555044_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VEB47378.1|1555040_1555493_+|protease	Putative activity regulator of membraneprotease YbbK	protease	NA	NA	NA	NA
VEB47379.1|1555493_1555910_-	copper efflux regulator	NA	NA	NA	NA	NA
VEB47380.1|1556019_1558521_+	Lead cadmium zinc and mercury transporting ATPase	NA	A0A218MNH6	uncultured_virus	37.2	5.1e-112
VEB47381.1|1558674_1559502_+	Secreted protein	NA	NA	NA	NA	NA
VEB47382.1|1560583_1561063_+|tRNA	Cys-tRNA(Pro) deacylase YbaK	tRNA	NA	NA	NA	NA
VEB47383.1|1561179_1562832_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
VEB47384.1|1563004_1564225_+	fosmidomycin resistance protein	NA	NA	NA	NA	NA
VEB47385.1|1564439_1566116_+	transport protein	NA	NA	NA	NA	NA
VEB47386.1|1566164_1567469_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
VEB47387.1|1567621_1568161_+	acetyl esterase	NA	M1PGN2	Moumouvirus	32.9	1.3e-07
VEB47388.1|1568126_1568594_+	acetyl esterase	NA	NA	NA	NA	NA
VEB47389.1|1568590_1569553_-	ferrochelatase	NA	NA	NA	NA	NA
VEB47390.1|1569781_1570426_-	adenylate kinase	NA	NA	NA	NA	NA
VEB47391.1|1570783_1571962_-	chaperone protein HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.7	2.1e-63
VEB47392.1|1571933_1572659_-	chaperone protein HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	46.5	7.8e-45
VEB47393.1|1572769_1573375_-	recombination protein RecR	NA	NA	NA	NA	NA
VEB47394.1|1573374_1573704_-	DNA-binding protein, YbaB/EbfC family	NA	NA	NA	NA	NA
VEB47395.1|1575791_1576343_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
VEB47396.1|1576495_1576873_-	Inner membrane protein YbaN	NA	NA	NA	NA	NA
VEB47397.1|1576953_1577469_+	Primosomal replication protein N prime prime	NA	NA	NA	NA	NA
VEB47398.1|1577482_1577650_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VEB47399.1|1577719_1578643_+|transposase	ISNCY transposase	transposase	Q2A0A7	Sodalis_phage	52.1	7.3e-64
VEB47400.1|1578684_1579665_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEB47401.1|1579687_1581745_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEB47402.1|1581698_1582049_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEB47403.1|1582167_1582821_-	potential acrAB operon repressor	NA	NA	NA	NA	NA
VEB47404.1|1582962_1584156_+	acriflavin resistance protein A	NA	NA	NA	NA	NA
VEB47405.1|1584178_1585162_+	acriflavin resistance protein B	NA	NA	NA	NA	NA
VEB47406.1|1585115_1587329_+	acriflavin resistance protein B	NA	NA	NA	NA	NA
VEB47407.1|1587824_1588199_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
VEB47408.1|1588226_1588445_+	hemolysin expression modulating protein	NA	NA	NA	NA	NA
VEB47409.1|1588623_1589175_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
VEB47410.1|1589291_1589762_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VEB47411.1|1589959_1590223_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEB47412.1|1590447_1591998_+	Uncharacterized protein ylaB	NA	NA	NA	NA	NA
VEB47413.1|1592306_1592618_+	methylated-DNA-[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
VEB47414.1|1592650_1593220_-	lipoprotein	NA	NA	NA	NA	NA
VEB47415.1|1593434_1594295_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
VEB47416.1|1594394_1595681_-	ammonium transporter	NA	NA	NA	NA	NA
VEB47417.1|1595712_1596051_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
VEB47418.1|1596263_1598045_-	Multidrug resistance-like ATP-binding protein mdlB	NA	W8CYL7	Bacillus_phage	26.7	5.4e-39
VEB47419.1|1598037_1599810_-	ABC transporter ATP-binding membrane protein	NA	W8CYL7	Bacillus_phage	29.8	8.0e-51
VEB47420.1|1599850_1600360_-	transcriptional regulator	NA	NA	NA	NA	NA
VEB47421.1|1600421_1601477_+	lyase	NA	NA	NA	NA	NA
VEB47422.1|1601525_1602344_-	HMP-PP phosphatase	NA	NA	NA	NA	NA
VEB47423.1|1602444_1604145_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEB47424.1|1604209_1604905_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.6e-87
VEB47425.1|1605010_1605409_-	4-hydroxybenzoyl-CoA thio esterase family activesite	NA	NA	NA	NA	NA
VEB47426.1|1605512_1605887_-	competence protein ComEA	NA	NA	NA	NA	NA
VEB47427.1|1606036_1607908_-	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VEB47428.1|1608198_1608471_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
VEB47429.1|1608679_1611034_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.5	1.6e-224
VEB47430.1|1611219_1612491_-|protease	ATP-dependent clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
VEB47431.1|1612742_1613366_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 5
LR134187	Salmonella enterica subsp. enterica serovar Havana strain NCTC6086 genome assembly, chromosome: 1	4708696	1662360	1672280	4708696		Bacillus_phage(50.0%)	8	NA	NA
VEB47481.1|1662360_1663656_-	phosphate regulon sensor protein PhoR	NA	W8CYF6	Bacillus_phage	31.1	1.5e-27
VEB47482.1|1663725_1664415_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	38.0	2.6e-37
VEB47483.1|1664629_1665832_+	Nuclease sbcCD subunit D	NA	A0A0A0PQ58	Bacillus_phage	25.3	4.3e-08
VEB47484.1|1665828_1668969_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	3.4e-12
VEB47485.1|1669141_1670314_+	MFS transport protein AraJ	NA	NA	NA	NA	NA
VEB47486.1|1670333_1671242_-	fructokinase	NA	NA	NA	NA	NA
VEB47487.1|1671367_1671835_+	recombination associated protein	NA	S4TWL4	Salmonella_phage	55.7	1.6e-38
VEB47488.1|1671818_1672280_+	recombination associated protein	NA	S4TWL4	Salmonella_phage	69.9	1.2e-54
>prophage 6
LR134187	Salmonella enterica subsp. enterica serovar Havana strain NCTC6086 genome assembly, chromosome: 1	4708696	3006474	3053920	4708696	transposase	Enterobacteria_phage(33.33%)	60	NA	NA
VEB48703.1|3006474_3007416_+|transposase	Putative transposase, YhgA-like	transposase	Q2A0A7	Sodalis_phage	53.4	4.7e-66
VEB48704.1|3007458_3008361_-	Permease of the drug/metabolite transporter (DMT) superfamily	NA	NA	NA	NA	NA
VEB48705.1|3008878_3009562_+	magnesium transporter	NA	G3MA03	Bacillus_virus	42.4	3.6e-15
VEB48706.1|3009781_3012508_+	Magnesium transporting ATPase, P-type 1	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	2.8e-34
VEB48707.1|3012529_3012622_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB48708.1|3012822_3013302_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VEB48709.1|3013530_3014211_-	Nicotinamidase family protein YcaC	NA	NA	NA	NA	NA
VEB48710.1|3015278_3015854_+	putative transcriptional regulator MarT	NA	NA	NA	NA	NA
VEB48711.1|3015864_3016329_+	YqeJ protein	NA	NA	NA	NA	NA
VEB48712.1|3016423_3019276_-	autotransporter MisL	NA	A0A2L1IV18	Escherichia_phage	43.9	5.5e-94
VEB48713.1|3019350_3019968_-	RmbA	NA	NA	NA	NA	NA
VEB48714.1|3020703_3020835_-|transposase	transposase	transposase	NA	NA	NA	NA
VEB48715.1|3021250_3021748_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	81.8	7.0e-13
VEB48716.1|3021814_3022765_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	76.2	4.2e-139
VEB48717.1|3022751_3023705_-	membrane protein	NA	Q7M295	Enterobacteria_phage	82.3	3.9e-145
VEB48718.1|3024768_3025629_-	restriction methylase	NA	NA	NA	NA	NA
VEB48719.1|3025894_3026386_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB48720.1|3026382_3026760_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VEB48721.1|3026817_3027465_-	antitoxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VEB48722.1|3027461_3027833_-	antitoxin YeeU	NA	NA	NA	NA	NA
VEB48723.1|3027804_3028173_-	antitoxin	NA	NA	NA	NA	NA
VEB48724.1|3028190_3028355_-	Protein of uncharacterised function (DUF987)	NA	NA	NA	NA	NA
VEB48725.1|3028351_3028642_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEB48726.1|3028657_3029137_-	DNA repair protein, RadC family	NA	NA	NA	NA	NA
VEB48727.1|3029147_3029606_-	antirestriction protein	NA	NA	NA	NA	NA
VEB48728.1|3029687_3030071_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB48729.1|3030191_3030419_-	cytoplasmic protein	NA	NA	NA	NA	NA
VEB48730.1|3030490_3030940_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB48731.1|3030936_3031392_-	Uncharacterized lipoprotein yafY precursor	NA	NA	NA	NA	NA
VEB48732.1|3031430_3032066_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB48733.1|3032282_3032777_-	transcriptional regulator	NA	NA	NA	NA	NA
VEB48734.1|3033037_3033352_-	GTPase	NA	NA	NA	NA	NA
VEB48735.1|3033344_3033755_-	GTPase	NA	NA	NA	NA	NA
VEB48736.1|3033717_3033915_-	GTPase	NA	NA	NA	NA	NA
VEB48737.1|3033999_3034992_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB48738.1|3035548_3035755_+	transcriptional regulator	NA	NA	NA	NA	NA
VEB48739.1|3035850_3036432_+	malate transporter	NA	NA	NA	NA	NA
VEB48740.1|3036869_3037526_+	prophage protein	NA	NA	NA	NA	NA
VEB48741.1|3037733_3038114_+	Protein of uncharacterised function (DUF3279)	NA	NA	NA	NA	NA
VEB48742.1|3038110_3038530_+	Protein of uncharacterised function (DUF3279)	NA	NA	NA	NA	NA
VEB48743.1|3038532_3038673_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB48744.1|3039123_3039570_-	Transposase and inactivated derivatives	NA	U5N3F9	Enterobacteria_phage	66.7	1.4e-41
VEB48745.1|3039660_3039801_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB48746.1|3039818_3040064_+|transposase	transposase	transposase	NA	NA	NA	NA
VEB48747.1|3040815_3041106_+	fimbriae biosynthesis regulatory protein	NA	NA	NA	NA	NA
VEB48748.1|3041140_3041680_+	K88 fimbrial protein A	NA	NA	NA	NA	NA
VEB48749.1|3041689_3044128_+	fimbrial protein	NA	NA	NA	NA	NA
VEB48750.1|3044144_3044942_+	chaperone protein ClpE	NA	NA	NA	NA	NA
VEB48751.1|3044977_3045469_+	K88 minor fimbrial protein FaeF	NA	NA	NA	NA	NA
VEB48752.1|3045686_3046463_+	CshE pilin	NA	NA	NA	NA	NA
VEB48753.1|3046696_3047494_+	K88 minor fimbrial subunit faeH	NA	NA	NA	NA	NA
VEB48754.1|3047521_3048286_+	K88 minor fimbrial subunit faeI	NA	NA	NA	NA	NA
VEB48755.1|3048329_3048548_+	endothelin converting protein	NA	NA	NA	NA	NA
VEB48756.1|3048547_3049387_+	K88 minor fimbrial subunit faeJ	NA	NA	NA	NA	NA
VEB48757.1|3049399_3049972_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB48758.1|3050044_3050257_+	plasmid-encoded fimbriae; regulatory	NA	NA	NA	NA	NA
VEB48759.1|3050444_3050660_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB48760.1|3050695_3051544_+	membrane protein	NA	NA	NA	NA	NA
VEB48761.1|3052122_3053310_-|transposase	transposase	transposase	NA	NA	NA	NA
VEB48762.1|3053296_3053920_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	9.4e-07
>prophage 7
LR134187	Salmonella enterica subsp. enterica serovar Havana strain NCTC6086 genome assembly, chromosome: 1	4708696	4623014	4632185	4708696	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
VEB50246.1|4623014_4623962_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
VEB50247.1|4623945_4624677_+	putative permease transmembrane component	NA	NA	NA	NA	NA
VEB50248.1|4624657_4624765_-	membrane protein	NA	NA	NA	NA	NA
VEB50249.1|4624824_4625556_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
VEB50250.1|4625778_4627464_+	putative sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
VEB50251.1|4627460_4628180_+	two-component system response regulator	NA	NA	NA	NA	NA
VEB50252.1|4628226_4628694_+	Protein of uncharacterised function (DUF1456)	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
VEB50253.1|4628750_4629281_-	lipoprotein	NA	NA	NA	NA	NA
VEB50254.1|4629452_4629911_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
VEB50255.1|4630151_4632185_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
