The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	78372	196210	4548019	transposase,tail,tRNA,integrase,capsid,terminase,protease	Erwinia_phage(14.29%)	103	141053:141095	165060:165102
VEA97482.1|78372_79476_+|tRNA	tRNA (uracil-5-)-methyltransferase	tRNA	NA	NA	NA	NA
VEA97483.1|79741_80182_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEA97484.1|80204_80837_-	DNA-binding transcriptional repressor FabR	NA	NA	NA	NA	NA
VEA97485.1|81054_82455_+	soluble pyridine nucleotide transhydrogenase	NA	NA	NA	NA	NA
VEA97486.1|82437_83370_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
VEA97487.1|83517_84249_+	putative peroxiredoxin/glutaredoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	57.9	3.8e-47
VEA97488.1|84541_85990_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
VEA97489.1|86271_86964_-	putative TonB protein	NA	NA	NA	NA	NA
VEA97490.1|87149_88481_-	HlyD family secretion protein	NA	NA	NA	NA	NA
VEA97491.1|88514_90320_-	ABC transporter	NA	W8CYL7	Bacillus_phage	30.6	1.5e-25
VEA97492.1|90484_91177_-	Preprotein translocase subunit SecG	NA	NA	NA	NA	NA
VEA97493.1|91193_91850_-	Hemophore	NA	NA	NA	NA	NA
VEA97494.1|92019_92634_-	hemophore HasA	NA	NA	NA	NA	NA
VEA97495.1|92812_93433_-	hemophore HasA	NA	NA	NA	NA	NA
VEA97496.1|93598_96088_-	putative TonB dependent receptor protein	NA	NA	NA	NA	NA
VEA97497.1|96651_98025_-	argininosuccinate lyase	NA	NA	NA	NA	NA
VEA97498.1|98196_98973_-	acetylglutamate kinase	NA	NA	NA	NA	NA
VEA97499.1|99048_100053_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
VEA97500.1|100300_101479_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
VEA97501.1|101615_104342_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
VEA97502.1|105186_106071_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
VEA97503.1|106312_108748_-	bifunctional aspartate kinase II/homoserine dehydrogenase II	NA	NA	NA	NA	NA
VEA97504.1|108750_109911_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
VEA97505.1|110286_110604_+	transcriptional repressor protein MetJ	NA	NA	NA	NA	NA
VEA97506.1|110696_110912_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEA97507.1|111159_113358_+	primosome assembly protein PriA	NA	NA	NA	NA	NA
VEA97508.1|113599_114628_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
VEA97509.1|114792_115563_+	cell division protein FtsN	NA	NA	NA	NA	NA
VEA97510.1|115662_116187_+|protease	ATP-dependent protease peptidase subunit	protease	NA	NA	NA	NA
VEA97511.1|116223_117555_+|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.0	1.7e-45
VEA97512.1|117669_118638_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
VEA97513.1|118768_119254_+	ribonuclease activity regulator protein RraA	NA	NA	NA	NA	NA
VEA97514.1|119390_119630_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEA97515.1|120224_121073_+	glycerol uptake facilitator protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	5.8e-15
VEA97516.1|121149_122673_+	glycerol kinase	NA	NA	NA	NA	NA
VEA97517.1|122854_123865_+	fructose 1,6-bisphosphatase II	NA	NA	NA	NA	NA
VEA97518.1|124057_125077_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEA97519.1|125506_126658_-	multidrug resistance protein D	NA	S4TR35	Salmonella_phage	24.6	6.9e-11
VEA97520.1|127445_128381_+	transferase	NA	NA	NA	NA	NA
VEA97521.1|128496_133434_+	Rhs family protein	NA	B6SD27	Bacteriophage	41.1	3.7e-287
VEA97522.1|133675_134422_+	ferredoxin-NADP reductase	NA	NA	NA	NA	NA
VEA97523.1|134480_134918_-	Inner membrane protein yhaH	NA	NA	NA	NA	NA
VEA97524.1|135076_135682_+	Protein of uncharacterised function (DUF1454)	NA	NA	NA	NA	NA
VEA97525.1|135810_136578_+	triosephosphate isomerase	NA	NA	NA	NA	NA
VEA97526.1|136593_137466_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA97527.1|137680_138670_-	sulfate transporter subunit	NA	NA	NA	NA	NA
VEA97528.1|138880_139864_-	6-phosphofructokinase	NA	NA	NA	NA	NA
VEA97529.1|140098_141001_-	ferrous iron efflux protein F	NA	NA	NA	NA	NA
141053:141095	attL	AAAAAAAGCCCTCCATCATGGAGGGCGAAAGACAGGGATGGTG	NA	NA	NA	NA
VEA97530.1|141112_141415_-	prophage p2 ogr protein	NA	A0A2I8TV89	Erwinia_phage	70.7	9.8e-18
VEA97531.1|141490_142639_-	gene D protein	NA	A0A218M4J7	Erwinia_phage	73.9	4.1e-157
VEA97532.1|142635_143088_-|tail	phage-related tail protein	tail	Q6K1G5	Salmonella_virus	61.4	1.2e-46
VEA97533.1|143100_145524_-	phage protein	NA	Q858U7	Yersinia_virus	62.3	2.2e-240
VEA97534.1|145680_145995_-|tail	putative phage tail protein	tail	A0A0F7LDQ8	Escherichia_phage	72.4	3.7e-28
VEA97535.1|146021_146540_-|tail	major tail tube protein	tail	Q37845	Escherichia_phage	77.9	3.5e-79
VEA97536.1|146554_147724_-|tail	phage tail sheath monomer	tail	F1BUU3	Erwinia_phage	78.1	4.3e-178
VEA97537.1|147985_148171_-	putative prophage protein	NA	NA	NA	NA	NA
VEA97538.1|148893_150237_-	protein hipA	NA	NA	NA	NA	NA
VEA97539.1|150233_150644_-	Predicted transcriptional regulator	NA	NA	NA	NA	NA
VEA97540.1|151015_151279_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
VEA97541.1|151271_151628_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
VEA97542.1|151753_153262_+|transposase	putative transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.2	1.1e-21
VEA97543.1|153248_153974_+	putative NTP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.3	3.4e-32
VEA97544.1|154021_154795_+|terminase	phage terminase, ATPase subunit	terminase	M1SNM9	Escherichia_phage	78.8	2.2e-114
VEA97545.1|154794_155817_+|capsid	phage-related capsid packaging protein	capsid	F1BUR7	Erwinia_phage	76.3	1.0e-154
VEA97546.1|156325_157564_+	putative ATP binding protein SugR	NA	C7BGE8	Burkholderia_phage	28.6	7.6e-08
VEA97547.1|157564_158221_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA97548.1|158827_160297_-	SEC-C motif	NA	NA	NA	NA	NA
VEA97549.1|160549_162631_-	phage replication protein	NA	A0A0F7LBQ2	Escherichia_phage	59.1	1.5e-226
VEA97550.1|162669_163170_-	replication gene B protein	NA	S4TTB7	Salmonella_phage	61.4	1.4e-56
VEA97551.1|163209_163482_-	cox	NA	Q1JS44	Enterobacteria_phage	78.9	3.2e-36
VEA97552.1|163615_163891_+	C protein	NA	Q1JS21	Enterobacteria_phage	65.6	3.0e-29
VEA97553.1|163975_164956_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	72.2	5.8e-136
VEA97554.1|165139_165637_-	P pilus assembly/Cpx signaling pathway,periplasmic inhibitor/zinc-resistance associated protein	NA	NA	NA	NA	NA
165060:165102	attR	AAAAAAAGCCCTCCATCATGGAGGGCGAAAGACAGGGATGGTG	NA	NA	NA	NA
VEA97555.1|165824_166523_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	4.0e-06
VEA97556.1|166519_167896_+	two-component sensor protein	NA	W8CYF6	Bacillus_phage	25.1	4.5e-17
VEA97557.1|167965_169126_-	bifunctional regulatory protein/DNA repair protein	NA	NA	NA	NA	NA
VEA97558.1|169235_169739_+	putative methyltransferase	NA	NA	NA	NA	NA
VEA97559.1|170146_170968_-	serine acetyltransferase	NA	NA	NA	NA	NA
VEA97560.1|171093_172113_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VEA97561.1|172112_172583_-	preprotein translocase subunit SecB	NA	NA	NA	NA	NA
VEA97562.1|172674_172923_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	50.0	2.4e-14
VEA97563.1|172972_173407_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
VEA97564.1|173648_175196_+	phosphoglyceromutase	NA	NA	NA	NA	NA
VEA97565.1|175205_176573_+	cell wall endopeptidase, family M23/M37	NA	G9BW84	Planktothrix_phage	34.8	2.4e-10
VEA97566.1|176596_177601_+	putative divergent polysaccharide deacetylase	NA	NA	NA	NA	NA
VEA97567.1|177991_179326_-|protease	putative Zn-dependent protease	protease	NA	NA	NA	NA
VEA97568.1|179341_180616_-	putative TRANSmembrane protein	NA	NA	NA	NA	NA
VEA97569.1|180940_181981_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	4.7e-19
VEA97570.1|181990_183202_-	2-amino-3-ketobutyrate coenzyme A ligase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	4.2e-35
VEA97571.1|183445_184378_+	ADP-L-glycero-D-manno-heptose-6-epimerase	NA	E3SL51	Synechococcus_phage	36.2	2.2e-31
VEA97572.1|184408_185473_+	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
VEA97573.1|185472_186438_+	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
VEA97574.1|186982_188260_+	3-deoxy-D-manno-octulosonic-acid transferase	NA	NA	NA	NA	NA
VEA97575.1|188260_189043_+	lipopolysaccharide core biosynthesis glycosyl transferase	NA	NA	NA	NA	NA
VEA97576.1|189039_189519_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	3.3e-28
VEA97577.1|189816_190626_-	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	30.7	1.9e-23
VEA97578.1|190712_190880_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
VEA97579.1|190891_191128_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
VEA97580.1|191391_192060_-	DNA repair protein RadC	NA	NA	NA	NA	NA
VEA97581.1|192251_193484_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	34.9	5.6e-43
VEA97582.1|193461_193920_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	59.5	2.1e-48
VEA97583.1|194041_194638_+	nucleoid occlusion protein	NA	NA	NA	NA	NA
VEA97584.1|194773_196210_-|transposase	transposase for IS1668	transposase	A0A1X9I5T2	Streptococcus_phage	39.3	7.6e-84
>prophage 2
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	842668	898595	4548019	transposase,tRNA,protease	Bacillus_virus(25.0%)	56	NA	NA
VEA98154.1|842668_843547_-|protease	putative protease	protease	NA	NA	NA	NA
VEA98155.1|843558_844554_-|protease	putative protease	protease	NA	NA	NA	NA
VEA98156.1|844928_845450_+	putative lipid carrier protein	NA	NA	NA	NA	NA
VEA98157.1|845467_845947_+	putative acetyltransferase	NA	NA	NA	NA	NA
VEA98158.1|845933_846227_-	GIY-YIG nuclease superfamily protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.6	1.4e-13
VEA98159.1|846363_847680_-	putrescine transporter	NA	NA	NA	NA	NA
VEA98160.1|847773_849939_-	ornithine decarboxylase	NA	NA	NA	NA	NA
VEA98161.1|851083_853108_-	heparinase II/III-like family protein	NA	NA	NA	NA	NA
VEA98162.1|853131_854367_-	Alginate lyase	NA	NA	NA	NA	NA
VEA98163.1|854927_856241_+	putative sugar binding protein	NA	NA	NA	NA	NA
VEA98164.1|856248_857133_+	sugar transport system, permease	NA	NA	NA	NA	NA
VEA98165.1|857151_857991_+	sugar transport system, permease	NA	NA	NA	NA	NA
VEA98166.1|858002_859118_+	putative sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	7.3e-26
VEA98167.1|859131_860298_+	Alginate lyase	NA	NA	NA	NA	NA
VEA98168.1|860371_860824_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEA98169.1|861031_861283_+	stbd replicon stabilization protein (antitoxin to StbE)	NA	NA	NA	NA	NA
VEA98170.1|861279_861567_+	stbe replicon stabilization toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	8.4e-19
VEA98171.1|861642_862272_+	oxidoreductase	NA	NA	NA	NA	NA
VEA98172.1|862272_863040_-	carbon-phosphorus lyase complex accessory protein	NA	NA	NA	NA	NA
VEA98173.1|863030_863336_-	ATP-binding protein PhnN; Guanylate kinase	NA	NA	NA	NA	NA
VEA98174.1|863354_863609_-	ribose 1,5-bisphosphokinase	NA	NA	NA	NA	NA
VEA98175.1|863608_864757_-	PhnM protein	NA	NA	NA	NA	NA
VEA98176.1|864753_865488_-	phosphonates transport ATP-binding protein PhnL	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
VEA98177.1|865501_866308_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.5	7.9e-14
VEA98178.1|866304_867171_-	PhnJ protein	NA	NA	NA	NA	NA
VEA98179.1|867163_867406_-	phni protein	NA	NA	NA	NA	NA
VEA98180.1|867438_868275_-	phni protein	NA	NA	NA	NA	NA
VEA98181.1|868274_868856_-	carbon-phosphorus lyase complex subunit	NA	NA	NA	NA	NA
VEA98182.1|868855_869332_-	PhnG protein	NA	NA	NA	NA	NA
VEA98183.1|869332_870058_-	phosphonate metabolism transcriptional regulator PhnF	NA	A0A291LID1	Streptomyces_phage	42.2	4.6e-05
VEA98184.1|870442_871546_+	putative lipoprotein	NA	NA	NA	NA	NA
VEA98185.1|871654_873391_+	putative activation/secretion signal peptide protein	NA	NA	NA	NA	NA
VEA98186.1|873538_874003_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.1	5.5e-52
VEA98187.1|874182_876321_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.9	2.4e-267
VEA98188.1|877332_878049_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	3.1e-22
VEA98189.1|878035_878914_-	putative ABC transporter transporter, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	3.3e-13
VEA98190.1|878906_879746_-	putative permease	NA	NA	NA	NA	NA
VEA98191.1|879747_880797_-	putative permease	NA	NA	NA	NA	NA
VEA98192.1|880959_882528_-	oligo-dipeptide/nickel ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEA98193.1|883080_883539_+	putative sugar isomerase involved in processing of exogenous sialic acid	NA	NA	NA	NA	NA
VEA98194.1|883691_884708_-	ornithine carbamoyltransferase subunit I	NA	NA	NA	NA	NA
VEA98195.1|884869_885301_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
VEA98196.1|885714_886476_+|transposase	transposase	transposase	NA	NA	NA	NA
VEA98197.1|886414_886717_+|transposase	transposase	transposase	NA	NA	NA	NA
VEA98198.1|887106_887610_-	putative acetyltransferase	NA	NA	NA	NA	NA
VEA98199.1|887942_890840_-|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.3	6.8e-140
VEA98200.1|890853_891303_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VEA98201.1|891552_893064_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.4	1.6e-47
VEA98202.1|893343_894438_+	putative permease	NA	NA	NA	NA	NA
VEA98203.1|894437_895508_+	lipopolysaccharide ABC transporter permease	NA	NA	NA	NA	NA
VEA98204.1|895795_896314_-|transposase	putative transposase	transposase	NA	NA	NA	NA
VEA98205.1|896434_896668_+	z1226 protein	NA	NA	NA	NA	NA
VEA98206.1|896744_896993_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
VEA98207.1|896996_897272_+	Plasmid stabilisation system protein	NA	NA	NA	NA	NA
VEA98208.1|897390_898179_+	putative transcriptional regulator	NA	NA	NA	NA	NA
VEA98209.1|898406_898595_+|transposase	ISPsy11, transposase OrfA	transposase	NA	NA	NA	NA
>prophage 3
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	1505748	1575463	4548019	transposase,tRNA,protease	Bacillus_phage(33.33%)	59	NA	NA
VEA98851.1|1505748_1507101_+|tRNA	histidyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEA98855.1|1507114_1507735_+	membrane protein	NA	NA	NA	NA	NA
VEA98858.1|1507746_1508928_+	outer membrane protein assembly complex subunit YfgL	NA	NA	NA	NA	NA
VEA98861.1|1509127_1510612_+	GTP-binding protein Der	NA	NA	NA	NA	NA
VEA98864.1|1510790_1511810_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEA98867.1|1512275_1513013_+	putative AEC family malate permease	NA	NA	NA	NA	NA
VEA98870.1|1513012_1513231_+	putative AEC family malate permease	NA	NA	NA	NA	NA
VEA98874.1|1513259_1513484_+	Protein of uncharacterised function (DUF1407)	NA	NA	NA	NA	NA
VEA98878.1|1513527_1514904_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.1	3.1e-42
VEA98881.1|1515072_1516536_+	inosine 5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	37.7	6.3e-86
VEA98885.1|1516722_1518300_+	GMP synthase	NA	NA	NA	NA	NA
VEA98890.1|1518549_1520418_+	acetyltransferase domain-containing protein	NA	NA	NA	NA	NA
VEA98895.1|1520714_1521224_+	2-keto-D-gluconate dehydrogenase,membrane-bound, gamma subunit	NA	NA	NA	NA	NA
VEA98897.1|1521241_1521673_+	2-keto-D-gluconate dehydrogenase,membrane-bound, flavoprotein	NA	NA	NA	NA	NA
VEA98900.1|1521736_1522837_+	2-keto-D-gluconate dehydrogenase,membrane-bound, flavoprotein	NA	NA	NA	NA	NA
VEA98902.1|1522860_1524129_+	putative cytochrome C	NA	NA	NA	NA	NA
VEA98908.1|1524506_1524809_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEA98911.1|1524747_1525062_-|transposase	transposase	transposase	NA	NA	NA	NA
VEA98915.1|1525085_1525529_-|transposase	transposase	transposase	NA	NA	NA	NA
VEA98920.1|1525849_1526416_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA98924.1|1527671_1528535_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA98928.1|1528628_1528787_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA98932.1|1528802_1529348_+	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
VEA98936.1|1529427_1530393_-	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.4	4.7e-37
VEA98937.1|1530385_1531156_-	DNA-binding transcriptional repressor SrlR	NA	NA	NA	NA	NA
VEA98941.1|1531240_1531606_-	DNA-binding transcriptional activator GutM	NA	NA	NA	NA	NA
VEA98945.1|1531962_1532742_-	sorbitol-6-phosphate dehydrogenase	NA	NA	NA	NA	NA
VEA98949.1|1532888_1533251_-	PTS system glucitol/sorbitol-specific transporter subunit IIA	NA	NA	NA	NA	NA
VEA98953.1|1533316_1534342_-	PTS system, glucitol/sorbitol-specific transporter subunit IIBC	NA	NA	NA	NA	NA
VEA98957.1|1534377_1534926_-	PTS system glucitol/sorbitol-specific transporter subunit IIc2	NA	NA	NA	NA	NA
VEA98961.1|1535304_1536204_-	lipid kinase	NA	NA	NA	NA	NA
VEA98966.1|1536677_1538081_-|protease	putative protease	protease	Q6DW11	Phage_TP	82.8	7.2e-180
VEA98972.1|1538304_1538643_-	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VEA98976.1|1538721_1539441_-	DNA-binding transcriptional regulator BaeR	NA	W8CYM9	Bacillus_phage	32.4	8.9e-33
VEA98980.1|1539449_1540826_-	signal transduction histidine-protein kinase BaeS	NA	W8CYF6	Bacillus_phage	32.0	2.2e-32
VEA98985.1|1540842_1542252_-	multidrug efflux system protein MdtE	NA	NA	NA	NA	NA
VEA98988.1|1542248_1542389_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA98991.1|1542395_1545470_-	multidrug efflux system subunit MdtC	NA	NA	NA	NA	NA
VEA98994.1|1545466_1548610_-	multidrug efflux system subunit MdtB	NA	NA	NA	NA	NA
VEA98996.1|1548609_1549944_-	multidrug efflux system subunit MdtA	NA	NA	NA	NA	NA
VEA98997.1|1550227_1550584_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA98999.1|1550955_1552308_-	chaperone	NA	NA	NA	NA	NA
VEA99001.1|1552401_1553064_-	putative sensor protein	NA	NA	NA	NA	NA
VEA99003.1|1553182_1553995_-	phosphate ABC transporter ATPase	NA	W8CYL7	Bacillus_phage	31.7	1.5e-15
VEA99006.1|1554023_1555688_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
VEA99010.1|1555687_1557874_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
VEA99013.1|1558119_1560189_+	polyphosphate kinase	NA	NA	NA	NA	NA
VEA99016.1|1560175_1561756_+	exopolyphosphatase	NA	NA	NA	NA	NA
VEA99019.1|1561818_1562010_+	Protein of uncharacterised function (DUF2633)	NA	NA	NA	NA	NA
VEA99022.1|1562057_1563533_+	putative divalent cation transport protein	NA	NA	NA	NA	NA
VEA99027.1|1563704_1567613_+	putative sensor protein	NA	A0A127AWB9	Bacillus_phage	36.9	6.5e-21
VEA99031.1|1568045_1568591_-	spermidine acetyltransferase	NA	NA	NA	NA	NA
VEA99036.1|1568726_1569458_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.7	2.3e-28
VEA99041.1|1569405_1570449_-	phosphoribosylaminoimidazole synthetase	NA	A0A1D7SE90	Cyanophage	41.0	7.7e-70
VEA99045.1|1570682_1571309_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
VEA99049.1|1571389_1572691_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	37.6	2.8e-61
VEA99052.1|1572816_1573524_+	DNA replication initiation factor	NA	NA	NA	NA	NA
VEA99057.1|1573571_1573925_-	putative arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	1.9e-20
VEA99060.1|1573936_1575463_-|protease	exported zinc metalloprotease YfgC	protease	NA	NA	NA	NA
>prophage 4
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	1581527	1618676	4548019	transposase,protease,bacteriocin	Salmonella_phage(33.33%)	41	NA	NA
VEA99089.1|1581527_1582397_+|protease	ypfj protein, zinc metalloprotease superfamily	protease	NA	NA	NA	NA
VEA99092.1|1582534_1582987_+	Protein of uncharacterised function (DUF441)	NA	NA	NA	NA	NA
VEA99097.1|1583021_1584995_+	putative acetyltransferase	NA	NA	NA	NA	NA
VEA99101.1|1585118_1585331_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA99105.1|1585683_1585851_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA99110.1|1586123_1586759_+	esterase YpfH	NA	NA	NA	NA	NA
VEA99112.1|1586860_1587010_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA99116.1|1587011_1587461_+	putative phage endopeptidase	NA	B0FEE8	Escherichia_phage	45.1	8.5e-26
VEA99121.1|1587862_1588237_+|transposase	putative IS110 Familly transposase	transposase	NA	NA	NA	NA
VEA99126.1|1588203_1588854_+|transposase	transposase	transposase	NA	NA	NA	NA
VEA99130.1|1589270_1589492_+	phage-like protein	NA	A0A2H4FQV0	Salmonella_phage	85.1	2.3e-24
VEA99134.1|1590144_1590681_+	attachment invasion locus protein	NA	A0A1B0VBR9	Salmonella_phage	38.8	1.9e-27
VEA99138.1|1590836_1591652_+|transposase	transposase for IS1668	transposase	A0A1X9I5T2	Streptococcus_phage	29.2	2.1e-22
VEA99142.1|1591701_1592010_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA99146.1|1592117_1592309_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA99151.1|1592343_1593054_-	D,D-carboxypeptidase family protein	NA	NA	NA	NA	NA
VEA99155.1|1593050_1594178_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
VEA99160.1|1594179_1594602_-	A glutathione-dependent thiol reductase	NA	NA	NA	NA	NA
VEA99165.1|1594764_1595238_-	Predicted O-linked N-acetylglucosamine transferase, SPINDLY family	NA	NA	NA	NA	NA
VEA99170.1|1595697_1596912_-|bacteriocin	bacteriocin biosynthesis docking scaffold, SagD family	bacteriocin	NA	NA	NA	NA
VEA99174.1|1596972_1597083_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA99177.1|1597349_1600481_-	aminoglycoside/multidrug efflux system	NA	NA	NA	NA	NA
VEA99180.1|1600690_1600969_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEA99184.1|1601007_1601637_-	nitrate/nitrite response regulator protein	NA	NA	NA	NA	NA
VEA99188.1|1602141_1602645_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
VEA99192.1|1602634_1602901_+	assembly protein for periplasmic nitrate reductase	NA	NA	NA	NA	NA
VEA99196.1|1602897_1605393_+	nitrate reductase catalytic subunit	NA	NA	NA	NA	NA
VEA99201.1|1605463_1605931_+	citrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
VEA99205.1|1605958_1606558_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
VEA99210.1|1606739_1607315_+	GDP-mannose pyrophosphatase YffH	NA	NA	NA	NA	NA
VEA99214.1|1607535_1609815_+	bifunctional malic enzyme oxidoreductase/phosphotransacetylase	NA	NA	NA	NA	NA
VEA99218.1|1610231_1611251_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEA99223.1|1611686_1612067_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEA99227.1|1612035_1612428_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEA99232.1|1612539_1612998_-	Uncharacterized BCR, YaiI/YqxD family COG1671	NA	NA	NA	NA	NA
VEA99236.1|1612997_1613939_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
VEA99239.1|1614169_1614595_+	putative acetyltransferase	NA	NA	NA	NA	NA
VEA99243.1|1614748_1615162_-	protein ygiW	NA	A0A1I9LJU6	Stx_converting_phage	40.1	6.0e-18
VEA99247.1|1615545_1616157_+	putative outer membrane lipoprotein YfeY	NA	NA	NA	NA	NA
VEA99250.1|1616332_1617238_+	putative iron-dependent peroxidase, Dyp-type family	NA	S4VVJ7	Pandoravirus	32.9	7.7e-26
VEA99254.1|1617656_1618676_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
>prophage 5
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	1937608	2006845	4548019	transposase,tRNA,protease	Bacillus_virus(12.5%)	57	NA	NA
VEB00295.1|1937608_1938628_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEB00298.1|1938865_1939000_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB00302.1|1939035_1940403_-	L-serine dehydratase 2	NA	NA	NA	NA	NA
VEB00305.1|1940548_1941844_-	serine transporter	NA	NA	NA	NA	NA
VEB00308.1|1943103_1943868_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
VEB00312.1|1944055_1944727_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
VEB00316.1|1945001_1945610_-	UDP pyrophosphate phosphatase	NA	NA	NA	NA	NA
VEB00321.1|1945606_1946377_-	membrane protein	NA	NA	NA	NA	NA
VEB00325.1|1946649_1948338_-	trka, Potassium channel-family protein	NA	NA	NA	NA	NA
VEB00329.1|1948747_1949011_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.0e-26
VEB00331.1|1949325_1949634_+	Protein of uncharacterised function (DUF1418)	NA	NA	NA	NA	NA
VEB00335.1|1949752_1950238_+	putative sensory transduction regulator	NA	NA	NA	NA	NA
VEB00341.1|1950683_1951793_+	putrescine ABC transporter periplasmic-binding protein	NA	NA	NA	NA	NA
VEB00345.1|1951959_1953093_+	putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	1.3e-30
VEB00348.1|1953114_1954080_+	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VEB00352.1|1954076_1954922_+	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VEB00355.1|1955071_1955548_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
VEB00360.1|1955636_1956764_+	23S rRNA methyluridine methyltransferase	NA	A0A1X9I6F4	Streptococcus_phage	27.9	3.8e-30
VEB00366.1|1956883_1957633_-	ABC transporter, periplasmic arginine-bindingprotein artI precursor	NA	NA	NA	NA	NA
VEB00370.1|1958317_1958986_-	arginine transporter permease subunit ArtM	NA	NA	NA	NA	NA
VEB00375.1|1958985_1959702_-	arginine transporter permease subunit ArtQ	NA	NA	NA	NA	NA
VEB00380.1|1959713_1960445_-	arginine-binding periplasmic protein 1	NA	NA	NA	NA	NA
VEB00384.1|1960465_1961245_-	arginine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	35.9	2.4e-28
VEB00389.1|1961617_1962193_-	putative lipoprotein	NA	NA	NA	NA	NA
VEB00393.1|1962261_1963272_-	putative nucleotide di-P-sugar epimerase or dehydratase	NA	NA	NA	NA	NA
VEB00398.1|1963403_1964861_-	NAD dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
VEB00403.1|1964857_1965877_-	L-threonine aldolase	NA	NA	NA	NA	NA
VEB00407.1|1966014_1966902_-	O-methyltransferase involved in polyketide biosynthesis	NA	NA	NA	NA	NA
VEB00411.1|1967133_1968855_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
VEB00415.1|1968954_1969977_-	HCP oxidoreductase	NA	NA	NA	NA	NA
VEB00420.1|1970075_1971728_-	hydroxylamine reductase	NA	NA	NA	NA	NA
VEB00423.1|1971924_1972824_-	putative surface protein	NA	NA	NA	NA	NA
VEB00428.1|1973074_1974739_+	putative OLD family ATP-dependent endonuclease	NA	NA	NA	NA	NA
VEB00431.1|1974735_1975719_-	putative virulence factor	NA	NA	NA	NA	NA
VEB00435.1|1975994_1977023_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
VEB00440.1|1977022_1978972_+	macrolide transporter ATP-binding /permease	NA	G9BWD6	Planktothrix_phage	38.1	4.7e-36
VEB00443.1|1979760_1980108_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.9e-15
VEB00446.1|1980133_1982410_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.5e-166
VEB00449.1|1982654_1982873_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
VEB00453.1|1983038_1983749_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
VEB00457.1|1983982_1985707_-	cysteine/glutathione ABC transporter membrane /ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.3	7.3e-17
VEB00461.1|1985709_1987476_-	cysteine/glutathione ABC transporter membrane /ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.6	1.4e-26
VEB00466.1|1987750_1988713_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	45.0	4.5e-64
VEB00470.1|1989153_1989324_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB00473.1|1989482_1989977_+	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VEB00477.1|1990098_1993713_+	putative cell division protein	NA	A0A218M9A2	Mycobacterium_phage	48.5	2.3e-89
VEB00481.1|1993942_1994554_+	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VEB00485.1|1994561_1995905_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	9.3e-76
VEB00487.1|1996076_1997369_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	2.0e-91
VEB00489.1|1997811_1998831_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEB00493.1|1998945_2000139_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	71.0	9.1e-75
VEB00495.1|2000457_2001606_+	putative MFS family transporter protein	NA	NA	NA	NA	NA
VEB00496.1|2001683_2002424_-	pyruvate formate lyase-activating enzyme 1	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	3.6e-21
VEB00498.1|2002502_2004785_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.1	1.1e-156
VEB00503.1|2004837_2005695_-	formate transporter	NA	NA	NA	NA	NA
VEB00507.1|2006132_2006267_-	Yersinia protein of uncharacterised function (DUF3831)	NA	NA	NA	NA	NA
VEB00511.1|2006542_2006845_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	2191711	2257645	4548019	transposase,tail,holin,plate,tRNA,integrase	Salmonella_phage(16.67%)	85	2189589:2189604	2247554:2247569
2189589:2189604	attL	TTTATTTCAGACAATA	NA	NA	NA	NA
VEB01152.1|2191711_2192905_+|transposase	transposase for IS1330	transposase	S5FM71	Shigella_phage	61.5	1.3e-137
VEB01157.1|2193040_2193370_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01160.1|2193373_2194441_-	HNH endonuclease domain-containing protein	NA	NA	NA	NA	NA
VEB01167.1|2195231_2196092_+	ferrous iron transport permease EfeU	NA	NA	NA	NA	NA
VEB01172.1|2196108_2197239_+	ferrous iron transport periplasmic protein EfeO,contains peptidase-M75 domain and (frequently) cupredoxin-like domain	NA	NA	NA	NA	NA
VEB01177.1|2197247_2198549_+	ferrous iron transport peroxidase EfeB	NA	NA	NA	NA	NA
VEB01182.1|2198750_2199350_-	TrpR binding protein WrbA	NA	NA	NA	NA	NA
VEB01186.1|2199519_2200002_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VEB01190.1|2200335_2201514_+	N-acetylneuraminic acid mutarotase	NA	NA	NA	NA	NA
VEB01194.1|2201721_2202312_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	86.8	4.3e-78
VEB01198.1|2202385_2203057_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	71.6	1.6e-81
VEB01204.1|2203127_2203676_-	4-hydroxyphenylacetate 3-monooxygenase coupling protein	NA	Q9KX93	Enterobacteria_phage	64.5	1.9e-27
VEB01206.1|2203725_2204316_-	putative reductase RutE in novel pyrimidine catabolism pathway	NA	NA	NA	NA	NA
VEB01210.1|2204327_2204471_-	putative hydrolase or acyltransferase RutD in novel pyrimidine catabolism pathway	NA	NA	NA	NA	NA
VEB01215.1|2204477_2205164_-	putative hydrolase	NA	NA	NA	NA	NA
VEB01219.1|2205196_2205583_-	putative ring-opening amidohydrolase RutC in novel pyrimidine catabolism pathway	NA	NA	NA	NA	NA
VEB01222.1|2205632_2206421_-	putative isochorismatase	NA	NA	NA	NA	NA
VEB01226.1|2206420_2206801_-	putative monooxygenase RutA in novel pyrimidine catabolism pathway	NA	NA	NA	NA	NA
VEB01231.1|2206975_2207644_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VEB01235.1|2207701_2209132_-	D-alanine/D-serine/glycine permease	NA	NA	NA	NA	NA
VEB01240.1|2209944_2210217_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VEB01245.1|2211216_2211951_-	biotin synthesis protein bioC	NA	A0A1X9I6N4	Streptococcus_phage	40.3	6.9e-49
VEB01248.1|2212354_2212852_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01252.1|2212933_2213263_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01256.1|2213407_2214907_+	alpha-amylase	NA	NA	NA	NA	NA
VEB01261.1|2215158_2215413_+	membrane protein	NA	NA	NA	NA	NA
VEB01265.1|2215443_2215782_-	GlpM protein	NA	NA	NA	NA	NA
VEB01269.1|2215892_2216117_-	Protein of uncharacterised function (DUF2594)	NA	NA	NA	NA	NA
VEB01272.1|2216810_2217467_+	response regulator	NA	NA	NA	NA	NA
VEB01276.1|2217459_2219292_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
VEB01279.1|2219350_2219899_+	phosphatidylglycerophosphate synthetase	NA	NA	NA	NA	NA
VEB01283.1|2220480_2221101_-|integrase	phage integrase family site specific recombinase	integrase	H9C152	Pectobacterium_phage	69.4	6.4e-80
VEB01287.1|2221468_2222245_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.2	1.1e-20
VEB01291.1|2222269_2223472_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	71.5	5.8e-77
VEB01296.1|2223680_2224277_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VEB01301.1|2224263_2224989_+	putative NTP-binding protein	NA	A0A059NT77	Lactococcus_phage	32.5	5.4e-30
VEB01305.1|2225077_2225188_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01309.1|2225651_2226599_-|transposase	putative transposase	transposase	Q2A0A7	Sodalis_phage	46.3	8.0e-74
VEB01313.1|2226741_2226918_-|transposase	transposase	transposase	NA	NA	NA	NA
VEB01316.1|2227359_2227680_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01320.1|2227669_2227876_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01322.1|2228017_2228185_+	Uncharacterised protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	48.0	1.2e-06
VEB01325.1|2228256_2228517_+	DinJ-like protein	NA	NA	NA	NA	NA
VEB01329.1|2228523_2228802_+	mRNA interferase YafQ	NA	NA	NA	NA	NA
VEB01333.1|2228854_2229118_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
VEB01336.1|2229110_2229467_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	43.9	6.3e-16
VEB01340.1|2229466_2230132_-|tail	variable tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.8	3.3e-34
VEB01346.1|2230186_2230759_-|tail	variable tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	48.3	4.7e-37
VEB01350.1|2230731_2231013_-|tail	putative variable tail fiber protein	tail	A0A2I8TVA9	Erwinia_phage	70.3	2.7e-30
VEB01354.1|2231009_2231552_-|tail	phage tail protein	tail	F1BUP2	Erwinia_phage	75.0	7.3e-80
VEB01358.1|2231544_2232453_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	74.5	1.3e-121
VEB01362.1|2232452_2232809_-|plate	phage baseplate assembly protein W	plate	F1BUP4	Erwinia_phage	60.0	4.4e-33
VEB01365.1|2232805_2233441_-|plate	baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.9	3.7e-67
VEB01369.1|2233577_2233850_+	Protein of uncharacterised function (DUF497)	NA	NA	NA	NA	NA
VEB01373.1|2233830_2234121_+	Uncharacterized protein conserved in bacteria	NA	K4NZP3	Burkholderia_phage	34.5	8.3e-06
VEB01376.1|2234186_2235248_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01379.1|2235286_2235733_-	Phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	48.0	9.4e-33
VEB01383.1|2235729_2236197_-|tail	P2 phage tail completion R family protein	tail	F1BUP9	Erwinia_phage	55.3	8.3e-40
VEB01388.1|2236298_2236724_-	putative regulatory protein	NA	E5G6N2	Salmonella_phage	46.1	3.0e-20
VEB01392.1|2236727_2237123_-	bacteriophage P7-like protein	NA	A9DET4	Yersinia_phage	71.8	9.1e-48
VEB01395.1|2237109_2237289_-|holin	Phage holin	holin	NA	NA	NA	NA
VEB01399.1|2237381_2237549_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01405.1|2238511_2239720_-	mxck	NA	NA	NA	NA	NA
VEB01409.1|2239822_2240740_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB01412.1|2241345_2241765_-	putative DNA-binding protein	NA	A0A0M4REM4	Salmonella_phage	31.1	1.3e-15
VEB01416.1|2242165_2242810_+	transferase hexapeptide repeat containing protein	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	31.3	8.0e-17
VEB01420.1|2242952_2243135_+	phage-like protein	NA	NA	NA	NA	NA
VEB01424.1|2243208_2243466_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01429.1|2243559_2243976_+	phage antitermination protein	NA	K7PGW2	Enterobacterial_phage	63.9	1.3e-39
VEB01434.1|2244152_2244329_-	Protein of uncharacterised function (DUF2566)	NA	NA	NA	NA	NA
VEB01438.1|2244561_2244732_+|holin	prophage Hp1 family holin	holin	B6SD15	Bacteriophage	60.7	2.2e-14
VEB01442.1|2244733_2245216_+	bacteriophage lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	63.8	5.5e-55
VEB01446.1|2245588_2246473_+	lipase	NA	NA	NA	NA	NA
VEB01450.1|2246774_2247431_+	putative inner membrane protein	NA	NA	NA	NA	NA
VEB01455.1|2247537_2248422_-	transcriptional activator protein	NA	NA	NA	NA	NA
2247554:2247569	attR	TTTATTTCAGACAATA	NA	NA	NA	NA
VEB01459.1|2248556_2249723_+	beta-lactamase	NA	NA	NA	NA	NA
VEB01463.1|2249869_2250961_-	GTP-dependent nucleic acid-binding protein EngD	NA	NA	NA	NA	NA
VEB01468.1|2251228_2251687_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01472.1|2251741_2252335_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
VEB01477.1|2252666_2252939_+	Protein of uncharacterised function (DUF2583)	NA	NA	NA	NA	NA
VEB01481.1|2253022_2253262_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB01486.1|2253425_2254373_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.2	2.7e-45
VEB01490.1|2254570_2255452_-	4-diphosphocytidyl-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
VEB01494.1|2255453_2256077_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
VEB01499.1|2256382_2257645_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 7
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	2725145	2732977	4548019	tRNA	Tupanvirus(33.33%)	8	NA	NA
VEB03228.1|2725145_2725442_+	Tfp pilus assembly protein, major pilin PilA	NA	M4ZS56	Bacillus_phage	68.8	6.2e-17
VEB03232.1|2725654_2725951_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
VEB03236.1|2725955_2728343_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
VEB03240.1|2728357_2729341_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
VEB03244.1|2729805_2730162_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
VEB03247.1|2730199_2730397_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
VEB03250.1|2730493_2730844_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.0	6.5e-05
VEB03254.1|2731048_2732977_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.8e-126
>prophage 8
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	2763517	2801474	4548019	transposase,tRNA,protease	Sphingobium_phage(25.0%)	36	NA	NA
VEB03389.1|2763517_2764279_+|transposase	transposase	transposase	NA	NA	NA	NA
VEB03392.1|2764217_2764520_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEB03395.1|2764957_2765809_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	29.5	4.3e-10
VEB03398.1|2766084_2766876_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
VEB03403.1|2767062_2768229_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
VEB03408.1|2768553_2769933_+	putative transport protein	NA	NA	NA	NA	NA
VEB03413.1|2770104_2770986_-	heat shock protein HtpX	NA	NA	NA	NA	NA
VEB03416.1|2771282_2773358_-|protease	carboxy-terminal protease	protease	A0A0R6PIZ1	Moraxella_phage	35.4	4.3e-88
VEB03422.1|2773377_2774106_-	putative solute/DNA competence effector	NA	NA	NA	NA	NA
VEB03425.1|2774201_2774699_-	gaf domain-containing protein	NA	NA	NA	NA	NA
VEB03427.1|2774953_2776201_+	PqiA family integral membrane protein	NA	NA	NA	NA	NA
VEB03432.1|2776169_2778800_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
VEB03436.1|2778812_2779733_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEB03440.1|2779861_2781286_+	putative membrane transport protein	NA	NA	NA	NA	NA
VEB03444.1|2781612_2782149_+	sigma-fimbriae subunit	NA	NA	NA	NA	NA
VEB03447.1|2782154_2782712_+	sigma-fimbriae subunit	NA	NA	NA	NA	NA
VEB03453.1|2782723_2783281_+	sigma-fimbriae subunit	NA	NA	NA	NA	NA
VEB03456.1|2783327_2784077_+	putative chaperone protein	NA	NA	NA	NA	NA
VEB03460.1|2784163_2786605_+	outer membrane usher protein	NA	NA	NA	NA	NA
VEB03464.1|2786635_2787646_+	sigma-fimbriae tip adhesin	NA	NA	NA	NA	NA
VEB03469.1|2787868_2789392_+	Predicted integral membrane sensor domain	NA	NA	NA	NA	NA
VEB03475.1|2789504_2789747_+	Protein of uncharacterised function (DUF1480)	NA	NA	NA	NA	NA
VEB03479.1|2789864_2790296_-	ASCH domain	NA	NA	NA	NA	NA
VEB03483.1|2790551_2790719_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB03488.1|2790976_2791210_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB03492.1|2791710_2792259_-	putative acetyl transferase	NA	NA	NA	NA	NA
VEB03495.1|2792327_2792906_-	putative transferase	NA	NA	NA	NA	NA
VEB03500.1|2793150_2794191_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEB03504.1|2794352_2794595_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB03509.1|2794680_2794878_+	integral membrane protein	NA	NA	NA	NA	NA
VEB03512.1|2795763_2795973_-|transposase	putative IS110 Familly transposase	transposase	NA	NA	NA	NA
VEB03515.1|2795972_2796125_-|transposase	putative IS110 Familly transposase	transposase	NA	NA	NA	NA
VEB03520.1|2796249_2797014_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
VEB03525.1|2797255_2797816_-	protein yecM	NA	NA	NA	NA	NA
VEB03528.1|2798183_2799914_+|tRNA	arginyl-tRNA synthetase	tRNA	A0A2K9L6Z2	Tupanvirus	35.1	1.0e-90
VEB03531.1|2800037_2801474_+|transposase	transposase for IS1668	transposase	A0A1X9I5T2	Streptococcus_phage	39.3	7.6e-84
>prophage 9
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	3616412	3657373	4548019	transposase,tRNA,protease	uncultured_Mediterranean_phage(37.5%)	36	NA	NA
VEB06698.1|3616412_3618767_-|protease	DNA-binding ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	53.7	1.4e-228
VEB06702.1|3618961_3620233_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.8	8.1e-130
VEB06706.1|3620438_3621062_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.4	4.5e-65
VEB06709.1|3621518_3622823_-	trigger factor	NA	NA	NA	NA	NA
VEB06715.1|3623238_3623571_-	transcriptional regulator BolA	NA	NA	NA	NA	NA
VEB06720.1|3623921_3624500_+	lipoprotein YajG	NA	NA	NA	NA	NA
VEB06724.1|3624577_3626056_+	muropeptide transporter	NA	NA	NA	NA	NA
VEB06728.1|3626320_3627100_+	Nucleoside-specific channel-forming protein, Tsx	NA	NA	NA	NA	NA
VEB06733.1|3627462_3628419_+	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
VEB06737.1|3628423_3630415_+	cytochrome O ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
VEB06740.1|3630404_3631019_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
VEB06744.1|3631018_3631366_+	cytochrome O ubiquinol oxidase subunit CyoD	NA	NA	NA	NA	NA
VEB06749.1|3631379_3632267_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
VEB06753.1|3632443_3633808_+	putative transporter	NA	NA	NA	NA	NA
VEB06758.1|3633861_3634353_-	putative nucleotide-binding protein	NA	NA	NA	NA	NA
VEB06762.1|3634562_3635474_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
VEB06767.1|3635436_3636027_+	DJ-1 family protein	NA	NA	NA	NA	NA
VEB06770.1|3636396_3637848_-	thiamine biosynthesis protein ThiI	NA	NA	NA	NA	NA
VEB06774.1|3638127_3638382_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
VEB06779.1|3638386_3639307_+	geranyltranstransferase	NA	NA	NA	NA	NA
VEB06784.1|3639360_3641220_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
VEB06788.1|3641617_3642637_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEB06792.1|3642791_3643289_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
VEB06796.1|3643281_3644271_-	thiamine monophosphate kinase	NA	NA	NA	NA	NA
VEB06801.1|3644350_3644767_-	transcription antitermination protein NusB	NA	NA	NA	NA	NA
VEB06803.1|3644792_3645263_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.3	2.1e-30
VEB06806.1|3645397_3646507_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A1V0SE20	Indivirus	34.0	3.2e-50
VEB06810.1|3646779_3647229_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
VEB06813.1|3647300_3648989_-	Permease of the major facilitator superfamily	NA	NA	NA	NA	NA
VEB06817.1|3649099_3649756_-	permeases of the major facilitator superfamily	NA	NA	NA	NA	NA
VEB06821.1|3650354_3651374_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEB06826.1|3651628_3652597_-	preprotein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.2	8.0e-45
VEB06829.1|3652607_3654422_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
VEB06831.1|3654482_3654815_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.3	4.9e-10
VEB06837.1|3654927_3655977_-|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.5	7.2e-84
VEB06840.1|3656353_3657373_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
>prophage 10
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	4088158	4149041	4548019	transposase,tail,holin,plate,head,tRNA,integrase,capsid,terminase	Erwinia_phage(42.86%)	65	4099274:4099323	4130760:4130809
VEB08407.1|4088158_4089397_+|tRNA	multifunctional tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	44.1	5.5e-83
VEB08411.1|4089635_4090454_-	undecaprenyl pyrophosphate phosphatase	NA	NA	NA	NA	NA
VEB08414.1|4090738_4091098_-	bifunctional dihydroneopterin aldolase/dihydroneopterin triphosphate 2'-epimerase	NA	NA	NA	NA	NA
VEB08418.1|4091205_4091859_+	putative glycerol-3-phosphate acyltransferase PlsY	NA	NA	NA	NA	NA
VEB08422.1|4092014_4093028_-	putative DNA-binding/iron metalloprotein/AP endonuclease	NA	A0A0R6PI74	Moraxella_phage	57.7	1.9e-105
VEB08425.1|4093401_4093617_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
VEB08429.1|4093753_4095502_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	1.1e-73
VEB08433.1|4095659_4097498_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
VEB08436.1|4097706_4098162_+|transposase	transposase	transposase	NA	NA	NA	NA
VEB08439.1|4098399_4098702_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
4099274:4099323	attL	GACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT	NA	NA	NA	NA
VEB08442.1|4099486_4099705_-	prophage p2 ogr protein	NA	Q37973	Salmonella_virus	72.2	7.0e-26
VEB08446.1|4099811_4100975_-	gene D protein	NA	A0A218M4J7	Erwinia_phage	65.9	5.1e-139
VEB08449.1|4100971_4101457_-|tail	phage-related tail protein	tail	A0A0F7LDE8	Escherichia_phage	60.5	1.3e-51
VEB08453.1|4101459_4103892_-	phage protein	NA	Q7Y4C8	Escherichia_virus	47.6	3.4e-161
VEB08457.1|4104039_4104351_-|tail	putative phage tail protein	tail	F1BUU0	Erwinia_phage	64.8	2.2e-25
VEB08461.1|4104405_4104921_-|tail	major tail tube protein	tail	S4TNZ0	Salmonella_phage	71.9	1.1e-66
VEB08464.1|4104934_4106104_-|tail	phage tail sheath monomer	tail	F1BUU3	Erwinia_phage	80.7	1.4e-184
VEB08469.1|4106257_4106440_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08473.1|4106450_4107890_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	70.2	3.9e-80
VEB08477.1|4107886_4108495_-|tail	phage tail fibers	tail	F1BUP2	Erwinia_phage	79.1	1.0e-90
VEB08481.1|4108487_4109396_-|plate	baseplate assembly protein J	plate	F1BUP3	Erwinia_phage	79.5	4.3e-125
VEB08485.1|4109400_4109751_-|plate	phage baseplate assembly protein	plate	F1BUP4	Erwinia_phage	66.4	2.2e-37
VEB08489.1|4109747_4110389_-|plate	baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	64.8	1.0e-72
VEB08494.1|4110543_4111269_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08498.1|4111270_4111813_+	Metallopeptidase immA	NA	Q854W5	Mycobacterium_virus	37.8	5.3e-14
VEB08503.1|4111875_4112844_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08505.1|4112829_4113453_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08509.1|4113574_4114024_-|tail	phage tail completion protein	tail	A0A0M3UL83	Salmonella_phage	64.6	3.7e-45
VEB08514.1|4114020_4114476_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	62.7	9.8e-46
VEB08518.1|4114571_4114976_-	putative regulatory protein	NA	F1BUQ1	Erwinia_phage	50.8	6.9e-27
VEB08523.1|4114989_4115496_-	prophage lysozyme; Phage lysin	NA	A0A218M4K3	Erwinia_phage	62.5	2.0e-55
VEB08528.1|4115479_4115689_-|holin	prophage Hp1 family holin	holin	NA	NA	NA	NA
VEB08532.1|4115691_4115895_-|tail	phage-related tail protein	tail	E5G6M9	Salmonella_phage	62.7	1.0e-18
VEB08536.1|4115894_4116368_-|head	phage head completion-stabilization protein	head	M1SNN6	Escherichia_phage	59.4	1.4e-42
VEB08541.1|4116467_4117127_-|terminase	phage terminase, endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	71.2	2.5e-82
VEB08545.1|4117130_4118351_-|capsid	major capsid protein	capsid	F1BUQ8	Erwinia_phage	74.9	2.3e-150
VEB08549.1|4118427_4119282_-|capsid	phage capsid scaffolding protein	capsid	Q01088	Escherichia_phage	61.4	2.2e-91
VEB08553.1|4119510_4121208_+|terminase	phage terminase, ATPase subunit	terminase	F1BUR2	Erwinia_phage	80.7	6.7e-273
VEB08556.1|4121204_4121969_+|terminase	phage terminase, ATPase subunit	terminase	O80303	Escherichia_phage	44.6	3.3e-54
VEB08561.1|4121965_4123003_+|capsid	phage-related capsid packaging protein	capsid	F1BUR7	Erwinia_phage	77.8	1.5e-158
VEB08564.1|4123004_4123394_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08566.1|4123757_4123940_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08567.1|4124147_4124507_-	putative GP46 protein	NA	H9C172	Pectobacterium_phage	44.3	6.2e-19
VEB08568.1|4124529_4126809_-	phage replication protein	NA	Q858T4	Yersinia_virus	57.1	3.9e-244
VEB08569.1|4126946_4127252_-	putative relication initiation protein	NA	NA	NA	NA	NA
VEB08570.1|4127251_4127524_-	Protein of uncharacterised function (DUF2732)	NA	A0A1S6L021	Salmonella_phage	54.4	1.6e-06
VEB08571.1|4127589_4127901_-	gpB bacteriophage P2	NA	NA	NA	NA	NA
VEB08572.1|4127912_4128098_-	Protein of uncharacterised function (DUF2724)	NA	NA	NA	NA	NA
VEB08573.1|4128107_4128617_-	regulatory protein CII	NA	A0A1S6L008	Salmonella_phage	51.2	4.6e-44
VEB08574.1|4128648_4128870_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VEB08575.1|4128987_4129563_+	CI repressor	NA	A0A218M4J1	Erwinia_phage	41.2	1.7e-31
VEB08576.1|4129632_4130688_+|integrase	putative bacteriophage integrase	integrase	F1BUS9	Erwinia_phage	61.3	1.5e-121
VEB08577.1|4130947_4132279_-	alternate gene name: yzbB	NA	NA	NA	NA	NA
4130760:4130809	attR	GACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT	NA	NA	NA	NA
VEB08578.1|4132331_4133417_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08579.1|4133434_4135306_-	glycosyl hydrolase family protein	NA	NA	NA	NA	NA
VEB08580.1|4135661_4136522_-	transcriptional regulator	NA	NA	NA	NA	NA
VEB08581.1|4136749_4137658_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
VEB08582.1|4137744_4139112_+	PTS system N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
VEB08583.1|4139174_4140119_-	glutaminase	NA	NA	NA	NA	NA
VEB08584.1|4140188_4141745_-	putative amino acid permease	NA	NA	NA	NA	NA
VEB08585.1|4141819_4143220_-	glutamate decarboxylase	NA	NA	NA	NA	NA
VEB08586.1|4144033_4144606_+	acid-resistance membrane protein	NA	NA	NA	NA	NA
VEB08587.1|4144758_4145565_+	permease of the drug/metabolite transporter (DMT) superfamily	NA	NA	NA	NA	NA
VEB08588.1|4145806_4147828_+	2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
VEB08589.1|4148021_4149041_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
>prophage 11
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	4191203	4241099	4548019	transposase,protease	uncultured_Mediterranean_phage(15.38%)	49	NA	NA
VEB08628.1|4191203_4192712_-|transposase	putative transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.6	8.7e-22
VEB08629.1|4192795_4193536_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08630.1|4193994_4194894_-	putative tetrapyrrole methylase	NA	M1PLC5	Streptococcus_phage	43.8	3.8e-49
VEB08631.1|4194956_4196918_+	lppc putative lipoprotein	NA	NA	NA	NA	NA
VEB08632.1|4197174_4197528_+	putative endonuclease distantly related to archaeal Holliday junction resolvase	NA	NA	NA	NA	NA
VEB08633.1|4197583_4198174_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.5	1.9e-12
VEB08634.1|4198184_4198760_+	hemolysin	NA	NA	NA	NA	NA
VEB08635.1|4198940_4199960_+|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEB08636.1|4200354_4201080_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
VEB08637.1|4201076_4201730_-	isoprenoid biosynthesis protein with amidotransferase-like domain	NA	NA	NA	NA	NA
VEB08638.1|4201970_4204307_-	aerobic respiration control sensor protein ArcB	NA	A0A1V0SGX0	Hokovirus	32.4	5.8e-41
VEB08639.1|4204399_4204717_-	putative radical SAM protein	NA	NA	NA	NA	NA
VEB08640.1|4204668_4205301_-	putative radical SAM protein	NA	NA	NA	NA	NA
VEB08641.1|4205997_4210458_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
VEB08642.1|4210467_4211886_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
VEB08643.1|4212339_4212825_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08644.1|4213066_4213582_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.8	9.8e-26
VEB08645.1|4213587_4214229_-	stringent starvation protein A	NA	NA	NA	NA	NA
VEB08646.1|4214623_4215016_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
VEB08647.1|4215030_4215459_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
VEB08648.1|4215791_4216919_-	ATPase	NA	NA	NA	NA	NA
VEB08649.1|4217142_4217547_+	cytochrome d ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
VEB08650.1|4218008_4219382_+|protease	protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	3.0e-21
VEB08651.1|4219470_4220559_+|protease	serine endoprotease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	33.8	1.4e-10
VEB08652.1|4220636_4221905_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
VEB08653.1|4222026_4222281_-	BolA-like protein	NA	NA	NA	NA	NA
VEB08654.1|4222455_4222797_-	putative anti-sigma B factor antagonist	NA	NA	NA	NA	NA
VEB08655.1|4222799_4223426_-	ABC transporter, auxiliary component YrbC	NA	NA	NA	NA	NA
VEB08656.1|4223438_4223999_-	ABC transporter, periplasmic component YrbD	NA	NA	NA	NA	NA
VEB08657.1|4224003_4224786_-	ABC transporter, permease component YrbE	NA	NA	NA	NA	NA
VEB08658.1|4224800_4225604_-	putative ABC transporter ATP-binding protein YrbF	NA	G3M9Y6	Bacillus_virus	31.7	1.3e-19
VEB08659.1|4226047_4227022_+	putative calcium/sodium:proton antiporter	NA	NA	NA	NA	NA
VEB08660.1|4227052_4228039_+	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	29.5	7.4e-38
VEB08661.1|4228052_4228616_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	A0A140XBD6	Dickeya_phage	80.0	5.3e-57
VEB08662.1|4228612_4229176_+	protein YrbK clustered with lipopolysaccharide transporters	NA	NA	NA	NA	NA
VEB08663.1|4229159_4229705_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
VEB08664.1|4229711_4230437_+	putative ABC transporter ATP-binding protein YhbG	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.3e-22
VEB08665.1|4230640_4232074_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
VEB08666.1|4232097_4232385_+	putative sigma(54) modulation protein	NA	NA	NA	NA	NA
VEB08667.1|4232555_4233038_+	PTS system nitrogen-specific IIA component, PtsN	NA	NA	NA	NA	NA
VEB08668.1|4233116_4233968_+	glmZ(sRNA)-inactivating NTPase	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.9e-05
VEB08669.1|4233968_4234241_+	phosphohistidinoprotein-hexose phosphotransferase component of N-regulated PTS system (Npr)	NA	NA	NA	NA	NA
VEB08670.1|4235018_4235147_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08671.1|4235362_4236298_+	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	40.2	2.1e-50
VEB08672.1|4236309_4236774_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
VEB08673.1|4237267_4237654_+	endoribonuclease L-PSP	NA	NA	NA	NA	NA
VEB08674.1|4237921_4239358_+	Domain of uncharacterised function (DUF404)	NA	NA	NA	NA	NA
VEB08675.1|4239351_4240281_+	Bacterial domain of uncharacterised function (DUF403)	NA	NA	NA	NA	NA
VEB08676.1|4240277_4241099_+|protease	protein containing transglutaminase-like domain,putative cysteine protease	protease	NA	NA	NA	NA
>prophage 12
LR134161	Yersinia enterocolitica subsp. enterocolitica strain NCTC13629 genome assembly, chromosome: 1	4548019	4392106	4465020	4548019	transposase	uncultured_Mediterranean_phage(20.0%)	57	NA	NA
VEB08795.1|4392106_4392322_-|transposase	transposase for insertion sequence element IS1328	transposase	NA	NA	NA	NA
VEB08796.1|4392279_4392471_-|transposase	IS3 family transposase, orfA	transposase	NA	NA	NA	NA
VEB08797.1|4398365_4398485_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEB08798.1|4399032_4400622_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.9e-68
VEB08799.1|4400647_4401943_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
VEB08800.1|4402020_4402674_-	lipoprotein	NA	NA	NA	NA	NA
VEB08801.1|4402726_4403002_-	transcriptional regulator HU subunit alpha	NA	A7KV42	Bacillus_phage	55.6	6.2e-19
VEB08802.1|4403190_4403781_-	Protein of uncharacterised function (DUF416)	NA	NA	NA	NA	NA
VEB08803.1|4403826_4404531_-	endonuclease V	NA	NA	NA	NA	NA
VEB08804.1|4404554_4405622_-	uroporphyrinogen III decarboxylase	NA	NA	NA	NA	NA
VEB08805.1|4405702_4406488_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
VEB08806.1|4406579_4407083_+	anti-RNA polymerase sigma 70 factor	NA	NA	NA	NA	NA
VEB08807.1|4407498_4409466_+	thiamine biosynthesis protein ThiC	NA	NA	NA	NA	NA
VEB08808.1|4409452_4410124_+	thiamine-phosphate pyrophosphorylase	NA	NA	NA	NA	NA
VEB08809.1|4410116_4410917_+	thiamine biosynthesis protein	NA	NA	NA	NA	NA
VEB08810.1|4410913_4411114_+	sulfur transfer protein involved in thiamine biosynthesis	NA	NA	NA	NA	NA
VEB08811.1|4411115_4411904_+	thiazole synthase	NA	NA	NA	NA	NA
VEB08812.1|4411896_4413027_+	thiamine biosynthesis protein ThiH	NA	NA	NA	NA	NA
VEB08813.1|4413449_4414469_-|transposase	putative transposase for IS1667	transposase	NA	NA	NA	NA
VEB08814.1|4414680_4418901_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
VEB08815.1|4419037_4423066_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
VEB08816.1|4423409_4423778_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
VEB08817.1|4423846_4424350_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
VEB08818.1|4424723_4425428_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
VEB08819.1|4425431_4425860_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
VEB08820.1|4426053_4426599_-	transcription antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
VEB08821.1|4426600_4426984_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
VEB08822.1|4427223_4428408_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	2.6e-13
VEB08823.1|4429574_4430027_+	putative acetyltransferase	NA	NA	NA	NA	NA
VEB08824.1|4430010_4430124_+	putative acetyltransferase	NA	NA	NA	NA	NA
VEB08825.1|4430333_4431284_+	pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	1.6e-29
VEB08826.1|4431323_4432283_-	biotin--protein ligase	NA	NA	NA	NA	NA
VEB08827.1|4432279_4433317_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
VEB08828.1|4433677_4434235_-|transposase	transposase	transposase	NA	NA	NA	NA
VEB08829.1|4434390_4434651_-|transposase	IS3 family transposase, orfA	transposase	NA	NA	NA	NA
VEB08830.1|4440831_4441365_-	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
VEB08831.1|4441386_4442838_-	potassium transporter	NA	NA	NA	NA	NA
VEB08832.1|4442874_4443489_-	protein co-occurring with transport systems (COG1739)	NA	A0A1X9I5T8	Streptococcus_phage	45.9	3.8e-24
VEB08833.1|4443488_4444820_-	proline dipeptidase	NA	NA	NA	NA	NA
VEB08834.1|4445147_4447337_+	multifunctional fatty acid oxidation complex subunit alpha	NA	NA	NA	NA	NA
VEB08835.1|4447348_4448512_+	3-ketoacyl-CoA thiolase	NA	NA	NA	NA	NA
VEB08836.1|4448611_4449313_-	FMN reductase	NA	NA	NA	NA	NA
VEB08837.1|4449367_4450888_-	3-octaprenyl-4-hydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
VEB08838.1|4451128_4451617_+	transcriptional activator RfaH	NA	NA	NA	NA	NA
VEB08839.1|4451705_4452728_-	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
VEB08840.1|4452742_4453525_-	DNase TatD	NA	NA	NA	NA	NA
VEB08841.1|4453580_4454360_-	twin-arginine protein translocation system subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.6	2.1e-27
VEB08842.1|4454362_4455019_-	Sec-independent protein translocase protein TatB	NA	NA	NA	NA	NA
VEB08843.1|4455022_4455289_-	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
VEB08844.1|4455489_4457121_-	putative ubiquinone biosynthesis protein UbiB	NA	G9E4X0	Ostreococcus_lucimarinus_virus	29.5	3.1e-41
VEB08845.1|4457117_4457771_-	protein YigP (COG3165) clustered with ubiquinone biosynthetic genes	NA	NA	NA	NA	NA
VEB08846.1|4457784_4458540_-	ubiquinone/menaquinone biosynthesis methyltransferase	NA	NA	NA	NA	NA
VEB08847.1|4458673_4460200_-	putative DNA recombination protein	NA	NA	NA	NA	NA
VEB08848.1|4460400_4460931_-	DedA family protein	NA	NA	NA	NA	NA
VEB08849.1|4461059_4462871_-	putative carbon starvation protein	NA	NA	NA	NA	NA
VEB08850.1|4463214_4464012_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
VEB08851.1|4464258_4465020_+|transposase	transposase	transposase	NA	NA	NA	NA
