The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	23583	77458	4692802	transposase	Escherichia_phage(36.36%)	53	NA	NA
VEA79888.1|23583_24849_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.0	1.4e-206
VEA79889.1|25018_25366_+	inner membrane protein	NA	NA	NA	NA	NA
VEA79890.1|25355_25718_+	inner membrane protein	NA	NA	NA	NA	NA
VEA79891.1|25714_26212_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VEA79892.1|26219_27404_-	multidrug resistance protein D	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
VEA79893.1|27683_27773_-	toxic peptide TisB	NA	NA	NA	NA	NA
VEA79894.1|28541_30230_+	acetolactate synthase isozyme I large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
VEA79895.1|30233_30524_+	acetolactate synthase isozyme I small subunit	NA	NA	NA	NA	NA
VEA79896.1|30599_31190_+	two-component system response regulator	NA	NA	NA	NA	NA
VEA79897.1|31189_32692_+	sensory histidine kinase UhpB	NA	NA	NA	NA	NA
VEA79898.1|32701_34021_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEA79899.1|34158_35550_+	hexosephosphate transport protein	NA	NA	NA	NA	NA
VEA79900.1|35595_37362_-	adenine deaminase	NA	NA	NA	NA	NA
VEA79901.1|37537_38872_+	putative permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	9.6e-65
VEA79902.1|38924_39377_+	Protein of uncharacterised function (DUF1198)	NA	NA	NA	NA	NA
VEA79903.1|39539_40778_+	ribonucleoside transporter	NA	NA	NA	NA	NA
VEA79904.1|40912_41113_-	putative transport protein	NA	NA	NA	NA	NA
VEA79905.1|41334_42153_+	lipoprotein-28	NA	NA	NA	NA	NA
VEA79906.1|42156_43080_-	transport protein YicL	NA	NA	NA	NA	NA
VEA79907.1|43191_44376_-	sugar efflux transporter C	NA	NA	NA	NA	NA
VEA79908.1|45171_45399_-	aec79	NA	NA	NA	NA	NA
VEA79909.1|45405_45666_-	putative restriction methylase	NA	NA	NA	NA	NA
VEA79910.1|45608_46013_-	putative restriction methylase	NA	NA	NA	NA	NA
VEA79911.1|46106_46304_-	Aec78	NA	NA	NA	NA	NA
VEA79912.1|46315_46804_-	aec77	NA	NA	NA	NA	NA
VEA79913.1|46800_47178_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VEA79914.1|47267_47636_-	YagB/YeeU/YfjZ family protein	NA	NA	NA	NA	NA
VEA79915.1|47685_49812_-	putative antigen 43 precursor (fluffing protein)	NA	NA	NA	NA	NA
VEA79916.1|50183_51056_-	putative GTP-binding protein	NA	NA	NA	NA	NA
VEA79917.1|51165_51537_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA79918.1|51683_52184_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA79919.1|53673_54246_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA79920.1|54331_54538_-	putative phage-related regulatory protein	NA	NA	NA	NA	NA
VEA79921.1|54918_55710_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA79922.1|56594_56807_+	hemolysin expression modulating protein	NA	NA	NA	NA	NA
VEA79923.1|57038_57278_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA79924.1|58700_59660_+	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	36.2	3.9e-28
VEA79925.1|59619_60225_+	reverse transcriptase-like protein from prophage or plasmid	NA	NA	NA	NA	NA
VEA79926.1|60341_60788_+|transposase	transposase for IS629	transposase	A0A0N7C1X7	Escherichia_phage	99.3	3.5e-80
VEA79927.1|61180_61831_-	transcriptional regulator	NA	NA	NA	NA	NA
VEA79928.1|62136_62610_+	Deoxyribokinase	NA	NA	NA	NA	NA
VEA79929.1|62650_63058_+	Deoxyribokinase	NA	NA	NA	NA	NA
VEA79930.1|63085_64402_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEA79931.1|64413_65427_+	Deoxyribose specific mutarotase	NA	NA	NA	NA	NA
VEA79932.1|67008_67815_-	Putatve transcriptional regulator ykgA	NA	D0R0F8	Streptococcus_phage	31.6	3.8e-08
VEA79933.1|67949_68225_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VEA79934.1|68269_68638_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-65
VEA79935.1|68997_69864_+|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VEA79936.1|70023_70740_+	cfA/I fimbrial subunit A precursor (colonization factor antigen subunit A; putative chaperone)	NA	NA	NA	NA	NA
VEA79937.1|70779_71292_+	cfa/I fimbrial subunit B precursor (colonization factor antigen subunit B) (cfa/I pilin) (cfa/I antigen)	NA	NA	NA	NA	NA
VEA79938.1|71360_73961_+	fimbrial usher family protein	NA	NA	NA	NA	NA
VEA79939.1|73975_75070_+	cfa/I fimbrial subunit E (colonization factor antigen I subunit E; pilin subunit)	NA	NA	NA	NA	NA
VEA79940.1|76591_77458_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 2
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	97565	106408	4692802		Morganella_phage(33.33%)	13	NA	NA
VEA79957.1|97565_98189_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
VEA79958.1|98446_99220_+	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	21.5	7.8e-11
VEA79959.1|99206_100130_+	NAD-dependent DNA ligase LigB	NA	NA	NA	NA	NA
VEA79960.1|100126_100744_-	inner membrane protein	NA	NA	NA	NA	NA
VEA79961.1|101034_101859_-	DNA-damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
VEA79962.1|102236_102353_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA79963.1|102445_102556_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA79964.1|102555_102843_-	putative prophage regulatory protein	NA	NA	NA	NA	NA
VEA79965.1|103102_103558_+	prophage protein	NA	A0A1W6JPI4	Morganella_phage	67.2	2.9e-45
VEA79966.1|103637_103838_+	prophage protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
VEA79967.1|103907_104009_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA79968.1|104322_104718_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA79969.1|104737_106408_-	prophage protein	NA	A0A2D1GLK8	Escherichia_phage	57.4	2.1e-170
>prophage 3
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	196767	266383	4692802	tRNA,protease,transposase	Escherichia_phage(50.0%)	59	NA	NA
VEA80061.1|196767_197679_+|tRNA	glycine tRNA synthetase	tRNA	NA	NA	NA	NA
VEA80062.1|197688_199758_+|tRNA	glycine-tRNA synthetase, beta subunit	tRNA	NA	NA	NA	NA
VEA80063.1|200884_201406_-|transposase	transposase subunit	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
VEA80064.1|201485_201638_+	small toxic polypeptide	NA	NA	NA	NA	NA
VEA80065.1|202318_202609_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VEA80066.1|203042_203753_+	putative lipoprotein	NA	NA	NA	NA	NA
VEA80067.1|203802_204777_-	2-ketoaldonate reductase/glyoxylate reductase B	NA	NA	NA	NA	NA
VEA80068.1|204880_205540_-	putative outer membrane protein	NA	NA	NA	NA	NA
VEA80069.1|205692_208026_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
VEA80070.1|207994_208435_-	putative acetyltransferase	NA	NA	NA	NA	NA
VEA80071.1|208431_208995_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
VEA80072.1|209152_209851_+	lipase	NA	NA	NA	NA	NA
VEA80073.1|210079_211288_+	transporter	NA	NA	NA	NA	NA
VEA80074.1|211611_213303_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
VEA80075.1|214213_215821_+	dipeptide ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
VEA80076.1|216128_217148_+	dipeptide transporter permease DppB	NA	NA	NA	NA	NA
VEA80077.1|217157_218060_+	dipeptide ABC transporter permease	NA	NA	NA	NA	NA
VEA80078.1|218070_218607_+	dipeptide ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VEA80079.1|218557_219055_+	dipeptide ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VEA80080.1|219051_220056_+	dipeptide transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
VEA80081.1|220085_221357_-	transport protein YhjV	NA	NA	NA	NA	NA
VEA80082.1|221832_221940_+	toxic polypeptide	NA	NA	NA	NA	NA
VEA80083.1|222026_223706_-	cellulose biosynthesis endoglucanase	NA	NA	NA	NA	NA
VEA80084.1|223702_223894_-	membrane protein YhjT	NA	NA	NA	NA	NA
VEA80085.1|223890_224667_-|protease	cellulose biosynthesis protease	protease	NA	NA	NA	NA
VEA80086.1|224770_225451_-|protease	cellulose biosynthesis protease	protease	NA	NA	NA	NA
VEA80087.1|225735_225924_+	Protein of uncharacterised function (DUF2629)	NA	NA	NA	NA	NA
VEA80088.1|225935_226688_+	cell division protein	NA	NA	NA	NA	NA
VEA80089.1|226684_229303_+	cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
VEA80090.1|229349_230774_+	cellulose synthase regulator protein	NA	NA	NA	NA	NA
VEA80091.1|230787_231654_+	cellulose synthase regulator protein	NA	NA	NA	NA	NA
VEA80092.1|231660_232767_+	endo-1,4-D-glucanase	NA	NA	NA	NA	NA
VEA80093.1|232748_234377_+	cellulose synthase subunit BcsC	NA	NA	NA	NA	NA
VEA80094.1|234474_236223_+	cellulose synthase subunit BcsC	NA	NA	NA	NA	NA
VEA80095.1|236357_238295_+	putative diguanylate cyclase	NA	NA	NA	NA	NA
VEA80096.1|238477_239764_+	C4-dicarboxylate transport protein	NA	NA	NA	NA	NA
VEA80097.1|239984_240158_+|protease	putative protease	protease	NA	NA	NA	NA
VEA80098.1|240282_241482_+|protease	putative protease	protease	NA	NA	NA	NA
VEA80099.1|241577_242507_-	ketodeoxygluconokinase	NA	NA	NA	NA	NA
VEA80100.1|242738_243506_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
VEA80101.1|243575_245636_+	putative outer membrane assembly protein	NA	NA	NA	NA	NA
VEA80102.1|245817_247140_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEA80103.1|247550_248564_-|tRNA	tRNA-processing ribonuclease	tRNA	NA	NA	NA	NA
VEA80104.1|248612_249584_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEA80105.1|250031_250634_+	transcriptional regulator	NA	NA	NA	NA	NA
VEA80106.1|250684_251647_-	cytoplasmic trehalase	NA	NA	NA	NA	NA
VEA80107.1|251630_252335_-	cytoplasmic trehalase	NA	NA	NA	NA	NA
VEA80108.1|252738_254136_+	putative cytochrome C peroxidase	NA	NA	NA	NA	NA
VEA80109.1|254346_255747_+	glutamate decarboxylase beta	NA	NA	NA	NA	NA
VEA80110.1|256116_256941_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VEA80111.1|257308_258037_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VEA80112.1|258399_261513_-	multidrug resistance protein	NA	NA	NA	NA	NA
VEA80113.1|261537_262695_-	multidrug resistance protein	NA	NA	NA	NA	NA
VEA80114.1|262754_263033_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA80115.1|263033_263561_-	DNA-binding transcriptional activator	NA	NA	NA	NA	NA
VEA80116.1|264359_264932_-	putative acid resistance protein	NA	NA	NA	NA	NA
VEA80117.1|265186_265519_+	putative periplasmic acid stress chaperone	NA	NA	NA	NA	NA
VEA80118.1|265622_265961_+	acid-resistance protein	NA	NA	NA	NA	NA
VEA80119.1|266107_266383_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.5e-46
>prophage 4
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	441211	449772	4692802	tRNA	uncultured_Caudovirales_phage(33.33%)	10	NA	NA
VEA80290.1|441211_441598_+|tRNA	tRNA 2-thiouridine synthesizin protein D (sulfurtransferase)	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
VEA80291.1|441597_441957_+|tRNA	tRNA 2-thiouridine synthesizing protein c	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
VEA80292.1|441964_442252_+|tRNA	tRNA 2-thiouridine synthesizing protein B	tRNA	NA	NA	NA	NA
VEA80293.1|442377_442752_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
VEA80294.1|442848_443319_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
VEA80295.1|443415_443697_+	translation elongation factor G	NA	A0A1B0RXH7	Streptococcus_phage	46.2	2.2e-11
VEA80296.1|443722_444139_+	translation elongation factor G	NA	NA	NA	NA	NA
VEA80297.1|444116_445532_+	translation elongation factor G	NA	A0A2K9L2P9	Tupanvirus	24.7	3.3e-23
VEA80298.1|445602_446787_+	protein chain elongation factor EF-Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
VEA80299.1|447078_449772_+	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
>prophage 5
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	837949	844988	4692802	tRNA,transposase	Shigella_phage(33.33%)	8	NA	NA
VEA80697.1|837949_838201_+|transposase	putative transposase	transposase	Q76S41	Shigella_phage	70.8	1.1e-17
VEA80698.1|838202_838997_-|transposase	transposase insF for insertion sequence IS3A/B/C/D/E/fA	transposase	U5P429	Shigella_phage	91.2	2.4e-140
VEA80699.1|839148_840072_-|transposase	transposase, IS903.B	transposase	Q1MVF0	Enterobacteria_phage	92.8	3.0e-166
VEA80700.1|840291_841740_+	purine permease ygfU	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
VEA80701.1|841741_841867_+	small predicted membrane protein	NA	NA	NA	NA	NA
VEA80702.1|841988_842537_+	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
VEA80703.1|842579_844097_-|tRNA	lysyl-tRNA synthetase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
VEA80704.1|844106_844988_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.5e-05
>prophage 6
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	1034967	1048148	4692802	tRNA	Escherichia_phage(50.0%)	13	NA	NA
VEA80886.1|1034967_1035729_+	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
VEA80887.1|1035722_1036349_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
VEA80888.1|1036488_1037628_+	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
VEA80889.1|1037690_1038683_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	3.9e-31
VEA80890.1|1038776_1039910_-	inner membrane permease YgbN	NA	NA	NA	NA	NA
VEA80891.1|1039872_1040139_-	inner membrane permease YgbN	NA	NA	NA	NA	NA
VEA80892.1|1040227_1041004_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
VEA80893.1|1041008_1041647_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
VEA80894.1|1041643_1042906_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
VEA80895.1|1042902_1043811_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
VEA80896.1|1044006_1044774_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
VEA80897.1|1044824_1045481_-	serine/threonine-specific protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
VEA80898.1|1045586_1048148_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
>prophage 7
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	1228505	1276924	4692802	protease,tRNA,lysis,tail,holin,integrase	Escherichia_phage(55.56%)	52	1249825:1249841	1275070:1275086
VEA81081.1|1228505_1230557_+|protease	putative protease inhibitor	protease	NA	NA	NA	NA
VEA81082.1|1230762_1231206_+|protease	putative protease inhibitor	protease	NA	NA	NA	NA
VEA81083.1|1231159_1233469_+|protease	putative protease inhibitor	protease	NA	NA	NA	NA
VEA81084.1|1233508_1235782_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
VEA81085.1|1235931_1236363_+	nucleoside diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
VEA81086.1|1236512_1237667_+	radical SAM protein	NA	NA	NA	NA	NA
VEA81087.1|1237951_1238917_+	putative regulatory protein	NA	NA	NA	NA	NA
VEA81088.1|1240221_1241496_+|tRNA	histidyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VEA81089.1|1241513_1242134_+	conserved protein, UPF0070 family	NA	NA	NA	NA	NA
VEA81090.1|1242144_1243323_+	putative dehydrogenase	NA	NA	NA	NA	NA
VEA81091.1|1243440_1244913_+	GTP-binding protein EngA	NA	NA	NA	NA	NA
VEA81092.1|1244982_1245198_+	protein	NA	NA	NA	NA	NA
VEA81093.1|1245194_1246565_-	exodeoxyribonuclease 7 large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
VEA81094.1|1246726_1248193_+	inosine 5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
VEA81095.1|1248261_1249839_+	bifunctional GMP synthase/glutamine amidotransferase protein	NA	NA	NA	NA	NA
1249825:1249841	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
VEA81096.1|1250031_1251282_+|integrase	integrase-like protein	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	98.8	8.8e-238
VEA81097.1|1251285_1251480_-	phage protein	NA	G9L698	Escherichia_phage	100.0	1.9e-27
VEA81098.1|1251476_1252127_-	putative adenine methylase from phage origin	NA	A0A2R9YJG0	Escherichia_phage	98.6	5.6e-127
VEA81099.1|1252119_1252371_-	putative transcriptional activator from phage origin	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
VEA81100.1|1252528_1252777_-	phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
VEA81101.1|1252826_1253768_-	putative enterohemolysin	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.4	1.1e-176
VEA81102.1|1253764_1254586_-	putative exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	98.9	5.2e-162
VEA81103.1|1254582_1254882_-	Uncharacterised protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.7e-46
VEA81104.1|1254884_1255037_-	Uncharacterised protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
VEA81105.1|1255190_1255484_-	repressor protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.0	4.8e-46
VEA81106.1|1255928_1256159_+	putative phage related protein	NA	G9L6A7	Escherichia_phage	97.4	2.9e-38
VEA81107.1|1256309_1256510_+	Uncharacterised protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
VEA81108.1|1256525_1257341_+	putative primosomal protein from phage	NA	Q286X4	Escherichia_phage	96.4	3.2e-119
VEA81109.1|1257337_1258123_+	putative phage replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
VEA81110.1|1258334_1258553_+	phage protein	NA	G9L6C1	Escherichia_phage	98.4	1.9e-07
VEA81111.1|1258567_1259593_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	91.6	1.9e-166
VEA81112.1|1259834_1262348_+	phage protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.7	0.0e+00
VEA81113.1|1262344_1264147_+	phage protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
VEA81114.1|1264152_1266627_+	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	96.5	0.0e+00
VEA81115.1|1266763_1267120_+	Uncharacterised protein	NA	A0A2R9YJP3	Escherichia_phage	99.0	3.9e-50
VEA81116.1|1267151_1267313_-	putative transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
VEA81117.1|1267406_1267850_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81118.1|1267870_1268038_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81119.1|1268131_1268686_-	Anti-repressor protein	NA	G9L6E2	Escherichia_phage	89.8	1.4e-89
VEA81120.1|1268741_1269026_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
VEA81121.1|1269218_1269947_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81122.1|1269969_1270227_-	Putative anti-repressor protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
VEA81123.1|1270422_1270542_+|tail	phage tail-fiber protein	tail	A0A2I6TCF2	Escherichia_phage	90.0	1.2e-08
VEA81124.1|1270529_1273022_+	Putative eliminase	NA	G9L6E4	Escherichia_phage	58.5	8.7e-35
VEA81125.1|1273169_1273574_+	integral membrane protein	NA	G9L6E6	Escherichia_phage	91.0	2.0e-58
VEA81126.1|1273560_1273869_+|holin	holin	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
VEA81127.1|1273858_1274488_+	endolysin	NA	G9L6E8	Escherichia_phage	97.1	2.0e-113
VEA81128.1|1274484_1274982_+|lysis	phage lysis protein	lysis	A0A193GYU6	Enterobacter_phage	65.8	2.3e-48
VEA81129.1|1275176_1275716_-	Uncharacterised protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
1275070:1275086	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
VEA81130.1|1275731_1276247_-	putative lipoprotein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
VEA81131.1|1276562_1276736_-	protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
VEA81132.1|1276771_1276924_+	Uncharacterised protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 8
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	1444256	1466579	4692802	tRNA,integrase,tail	Enterobacteria_phage(83.33%)	30	1450181:1450200	1465446:1465465
VEA81294.1|1444256_1446263_-|tRNA	tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC	tRNA	NA	NA	NA	NA
VEA81295.1|1446421_1447642_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
VEA81296.1|1447907_1449086_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEA81297.1|1449082_1449634_-	cell division protein	NA	NA	NA	NA	NA
VEA81298.1|1449839_1450079_-	cell division protein	NA	NA	NA	NA	NA
1450181:1450200	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
VEA81299.1|1451243_1451576_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81300.1|1451753_1451894_-	small toxic polypeptide	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
VEA81301.1|1452084_1452345_-	DNA-binding transcriptional regulator prophage remnant	NA	NA	NA	NA	NA
VEA81302.1|1452387_1453497_-	Gene late control D protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	4.8e-195
VEA81303.1|1453654_1454839_+|tail	Major tail sheath protein FI	tail	A0A0A7NV69	Enterobacteria_phage	98.2	5.8e-223
VEA81304.1|1454838_1455351_+|tail	Major tail tube protein FII	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
VEA81305.1|1455405_1455771_+|tail	phage tail E family protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
VEA81306.1|1455921_1457283_+|tail	tail protein (modular protein)	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	7.4e-206
VEA81307.1|1457236_1458241_+|tail	tail protein (modular protein)	tail	A0A0A7NRZ9	Enterobacteria_phage	92.9	8.3e-162
VEA81308.1|1458206_1458731_+|tail	tail fiber protein of prophage CP-933T	tail	A0A0A7NRZ9	Enterobacteria_phage	89.9	6.2e-76
VEA81309.1|1458743_1459232_+|tail	tail fiber protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
VEA81310.1|1459394_1459958_+	putative acetyltransferase with hexapeptide repeats	NA	NA	NA	NA	NA
VEA81311.1|1460538_1461411_-	Capsid scaffolding protein O	NA	A0A0A7NRY7	Enterobacteria_phage	100.0	1.0e-59
VEA81312.1|1461618_1461882_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81313.1|1461971_1462085_-	Uncharacterised protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	2.8e-10
VEA81314.1|1462081_1462324_-	Uncharacterised protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
VEA81315.1|1462335_1462623_-	Uncharacterised protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
VEA81316.1|1462633_1462975_-	Uncharacterised protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
VEA81317.1|1462976_1463084_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81318.1|1463080_1463188_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81319.1|1463227_1463434_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81320.1|1463440_1463728_-	putative regulatory protein Cox	NA	A0A0M4RCW1	Salmonella_phage	53.7	1.1e-23
VEA81321.1|1463841_1464162_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
VEA81322.1|1464258_1465263_+|integrase	integrase/recombinase, phage integrase family	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
VEA81323.1|1465421_1466579_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
1465446:1465465	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
>prophage 9
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	1684629	1694073	4692802		Enterobacteria_phage(85.71%)	11	NA	NA
VEA81537.1|1684629_1685556_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
VEA81538.1|1685560_1686178_+	ABC transporter permease	NA	NA	NA	NA	NA
VEA81539.1|1686273_1686381_-	putative inner membrane protein	NA	NA	NA	NA	NA
VEA81540.1|1686440_1687172_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VEA81541.1|1687394_1689080_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VEA81542.1|1689076_1689328_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEA81543.1|1689281_1689797_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VEA81544.1|1689843_1690314_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
VEA81545.1|1690353_1690815_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VEA81546.1|1690939_1692940_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
VEA81547.1|1692936_1694073_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 10
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	1705704	1754493	4692802	tRNA,protease,transposase	Stx2-converting_phage(25.0%)	47	NA	NA
VEA81553.1|1705704_1707738_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
VEA81554.1|1707869_1708979_+	ATPase	NA	NA	NA	NA	NA
VEA81555.1|1709241_1709523_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
VEA81556.1|1709815_1710358_+	fimbrial protein	NA	NA	NA	NA	NA
VEA81557.1|1710322_1710463_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81558.1|1710469_1710934_+	putative periplasmic pilin chaperone	NA	NA	NA	NA	NA
VEA81559.1|1710905_1711112_+	putative periplasmic pilin chaperone	NA	NA	NA	NA	NA
VEA81560.1|1711127_1713608_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEA81561.1|1713623_1714658_+	putative fimbrial adhesin	NA	NA	NA	NA	NA
VEA81562.1|1714739_1715078_-	periplasmic modulator of Ni and Co efflux	NA	NA	NA	NA	NA
VEA81563.1|1715296_1716121_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
VEA81564.1|1716241_1716514_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
VEA81565.1|1716736_1717525_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
VEA81566.1|1717521_1718322_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VEA81567.1|1718386_1719112_+	1,4-beta-N-acetylmuramidase	NA	D0R7H8	Paenibacillus_phage	36.7	1.6e-10
VEA81568.1|1719069_1719204_+	1,4-beta-N-acetylmuramidase	NA	NA	NA	NA	NA
VEA81569.1|1719255_1720002_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEA81570.1|1719975_1720941_-	putative carbohydrate/pyrimidine kinase	NA	NA	NA	NA	NA
VEA81571.1|1720937_1721942_-	putative ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	28.7	6.4e-13
VEA81572.1|1721938_1723216_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEA81573.1|1723472_1724525_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
VEA81574.1|1724581_1724995_-	putative ribitol transporter	NA	NA	NA	NA	NA
VEA81575.1|1725168_1725378_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
VEA81576.1|1725589_1725865_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.5e-46
VEA81577.1|1725898_1726630_-	putative ribitol transporter	NA	NA	NA	NA	NA
VEA81578.1|1726731_1727418_-	Ribitol kinase	NA	NA	NA	NA	NA
VEA81579.1|1727392_1728337_-	Ribitol kinase	NA	NA	NA	NA	NA
VEA81580.1|1728347_1729097_-	Ribitol 2-dehydrogenase	NA	NA	NA	NA	NA
VEA81581.1|1729258_1729537_+	putative DNA-binding transcriptional repressor	NA	NA	NA	NA	NA
VEA81582.1|1729623_1730292_+	putative DNA-binding transcriptional repressor	NA	NA	NA	NA	NA
VEA81583.1|1730294_1731236_-	putative transcriptional repressor	NA	NA	NA	NA	NA
VEA81584.1|1731448_1732816_+	D-arabinitol 4-dehydrogenase	NA	NA	NA	NA	NA
VEA81585.1|1732829_1734293_+	xylulokinase	NA	NA	NA	NA	NA
VEA81586.1|1734361_1735639_+	Ribitol transporter	NA	NA	NA	NA	NA
VEA81587.1|1735683_1736337_+	phosphoglycolate phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	24.8	9.0e-08
VEA81588.1|1736410_1737310_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
VEA81589.1|1738064_1739426_-|protease	putative protease	protease	Q6DW11	Phage_TP	99.7	1.9e-217
VEA81590.1|1739572_1739905_-	protein	NA	NA	NA	NA	NA
VEA81591.1|1740095_1740818_-	two-component response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
VEA81592.1|1740814_1742218_-	two-component sensor kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
VEA81593.1|1742214_1743630_-	putative multidrug resistance protein	NA	NA	NA	NA	NA
VEA81594.1|1743630_1746708_-	multidrug resistance protein	NA	NA	NA	NA	NA
VEA81595.1|1746708_1749831_-	multidrug resistance protein	NA	NA	NA	NA	NA
VEA81596.1|1749830_1751198_-	multidrug efflux system subunit MdtA	NA	NA	NA	NA	NA
VEA81597.1|1751907_1753479_-|transposase	IS66 family transposase orfB	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
VEA81598.1|1753498_1753846_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
VEA81599.1|1753845_1754493_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
>prophage 11
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	1825500	1851032	4692802	integrase,transposase	Escherichia_phage(50.0%)	29	1843310:1843324	1851450:1851464
VEA81664.1|1825500_1825866_-|transposase	transposase	transposase	Q76S41	Shigella_phage	99.2	6.2e-59
VEA81665.1|1825876_1827103_+	penicillin-binding protein 6B	NA	B6DZZ7	Stx2-converting_phage	98.7	1.0e-222
VEA81666.1|1827221_1827695_+	DNA gyrase inhibitory protein	NA	NA	NA	NA	NA
VEA81667.1|1827892_1828951_+	inner membrane protein	NA	NA	NA	NA	NA
VEA81668.1|1829122_1829452_+	putative alpha helix protein	NA	NA	NA	NA	NA
VEA81669.1|1830349_1830544_-	CP4-44 prophage	NA	NA	NA	NA	NA
VEA81670.1|1830650_1830914_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VEA81671.1|1831002_1831371_-	antitoxin of the YeeV-YeeU toxin-antitoxin system; CP4-44 prophage	NA	NA	NA	NA	NA
VEA81672.1|1831444_1831666_-	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
VEA81673.1|1831728_1832205_-	putative DNA repair protein	NA	NA	NA	NA	NA
VEA81674.1|1832220_1832700_-	anti-restriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
VEA81675.1|1832781_1833603_-	CP4-57 prophage protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
VEA81676.1|1833811_1833994_+|transposase	transposase, IS4 family protein	transposase	NA	NA	NA	NA
VEA81677.1|1834445_1834931_+	bifunctional adenosylcobalamin biosynthesis protein [includes adenosylcobinamide kinase; adenosylcobinamide-phosphate guanylyltransferase]	NA	NA	NA	NA	NA
VEA81678.1|1834927_1835671_+	cobalamin synthase	NA	NA	NA	NA	NA
VEA81679.1|1835682_1836762_+	Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
VEA81680.1|1836823_1837759_+	ErfK/YbiS/YcfS/YnhG family protein	NA	NA	NA	NA	NA
VEA81681.1|1838215_1839133_+	Nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
VEA81682.1|1839234_1840185_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEA81683.1|1840491_1841946_+	multidrug efflux system	NA	NA	NA	NA	NA
VEA81684.1|1842575_1843292_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
1843310:1843324	attL	AAATTTATTTACATT	NA	NA	NA	NA
VEA81685.1|1843634_1845089_-	AMP nucleosidase	NA	NA	NA	NA	NA
VEA81686.1|1845190_1846507_-	shikimate transporter	NA	NA	NA	NA	NA
VEA81687.1|1846567_1846945_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEA81688.1|1846989_1847265_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	96.7	2.7e-46
VEA81689.1|1847293_1848073_-|integrase	phage integrase	integrase	A0A1B5FPC6	Escherichia_phage	34.7	1.9e-28
VEA81690.1|1848629_1849427_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
VEA81691.1|1850179_1850635_-	cytochrome	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.6e-56
VEA81692.1|1850654_1851032_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	3.8e-67
1851450:1851464	attR	AATGTAAATAAATTT	NA	NA	NA	NA
>prophage 12
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	1884332	1913740	4692802	integrase,transposase	Escherichia_phage(25.0%)	37	1893915:1893929	1915144:1915158
VEA81734.1|1884332_1884620_-|transposase	transposase, C-ter fragment, truncated protein	transposase	A0A1S5RHE3	Helicobacter_phage	66.7	3.1e-29
VEA81735.1|1884687_1885836_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	97.4	3.1e-205
VEA81736.1|1885875_1886547_-	Uncharacterised ACR, COG2135	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
VEA81737.1|1886655_1886889_-	SirA family protein	NA	NA	NA	NA	NA
VEA81738.1|1886885_1888091_-	inner membrane protein	NA	NA	NA	NA	NA
VEA81739.1|1888277_1888691_+	putative lipoprotein	NA	NA	NA	NA	NA
VEA81740.1|1888724_1890212_-	alpha-amylase	NA	NA	NA	NA	NA
VEA81741.1|1890289_1890655_-	flagellar protein FliT	NA	NA	NA	NA	NA
VEA81742.1|1890654_1891065_-	flagellar protein FliS	NA	NA	NA	NA	NA
VEA81743.1|1891079_1892492_-	flagellar capping protein	NA	NA	NA	NA	NA
VEA81744.1|1892672_1892948_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.5e-46
VEA81745.1|1893076_1893370_+	IS1 protein InsB	NA	NA	NA	NA	NA
VEA81746.1|1893523_1893985_+	flagellin	NA	NA	NA	NA	NA
1893915:1893929	attL	AATTTAATGGTGTAA	NA	NA	NA	NA
VEA81747.1|1893968_1895099_+	flagellin	NA	NA	NA	NA	NA
VEA81748.1|1895263_1895983_+	RNA polymerase sigma factor for flagellar operon	NA	NA	NA	NA	NA
VEA81749.1|1896028_1896580_+	FliZ protein	NA	NA	NA	NA	NA
VEA81750.1|1896610_1896760_+	cystine transporter subunit	NA	NA	NA	NA	NA
VEA81751.1|1896869_1897469_+	cystine transporter subunit	NA	NA	NA	NA	NA
VEA81752.1|1897573_1898560_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
VEA81753.1|1898574_1899243_+	putative amino acid transport protein ABC superfamily	NA	NA	NA	NA	NA
VEA81754.1|1899239_1899992_+	putative cystine ABC-transporter, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
VEA81755.1|1900221_1900944_+	DNA-binding transcriptional activator SdiA	NA	NA	NA	NA	NA
VEA81756.1|1901011_1901236_-	conserved protein, DUF2594 family	NA	NA	NA	NA	NA
VEA81757.1|1901694_1902351_+	response regulator UvrY	NA	NA	NA	NA	NA
VEA81758.1|1902347_1904180_+	UvrABC system protein C	NA	NA	NA	NA	NA
VEA81759.1|1904236_1904785_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
VEA81760.1|1905339_1906221_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81761.1|1906301_1907171_+|integrase	integrase	integrase	NA	NA	NA	NA
VEA81762.1|1907540_1907777_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81763.1|1907872_1908244_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81764.1|1908269_1908803_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81765.1|1908875_1909310_+	Protein of uncharacterised function (DUF2787)	NA	NA	NA	NA	NA
VEA81766.1|1909920_1910739_-	Protein of uncharacterised function (DUF726)	NA	NA	NA	NA	NA
VEA81767.1|1910800_1911667_-	putative transcriptional regulator, HTH	NA	A0A0R6PH67	Moraxella_phage	31.3	2.5e-34
VEA81768.1|1911731_1912007_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.5e-46
VEA81769.1|1912135_1912429_+	IS1 protein InsB	NA	NA	NA	NA	NA
VEA81770.1|1912609_1913740_-|integrase	phage integrase	integrase	A0A221SAN4	Ralstonia_phage	27.6	2.6e-15
1915144:1915158	attR	AATTTAATGGTGTAA	NA	NA	NA	NA
>prophage 13
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	1924604	1971484	4692802	tRNA,integrase,transposase	Escherichia_phage(25.0%)	45	1915542:1915556	1948278:1948292
1915542:1915556	attL	AATAATGCCTTCCGC	NA	NA	NA	NA
VEA81778.1|1924604_1924880_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	5.0e-45
VEA81779.1|1924944_1925151_+|transposase	transposase (partial)	transposase	Q716C2	Shigella_phage	92.6	1.3e-32
VEA81780.1|1925175_1926198_+	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VEA81781.1|1926181_1926628_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81782.1|1926620_1928663_+	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VEA81783.1|1928850_1929234_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA81784.1|1929243_1930023_-	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
VEA81785.1|1930022_1931045_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
VEA81786.1|1931103_1936545_+	putative UvrD/REP helicase-like protein	NA	NA	NA	NA	NA
VEA81787.1|1936765_1937140_-|integrase	integrase catalytic subunit	integrase	U5P429	Shigella_phage	59.2	9.9e-36
VEA81788.1|1937304_1938828_-	reverse transcriptase-like protein from prophage or plasmid	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
VEA81789.1|1939419_1939845_-|transposase	transposase	transposase	NA	NA	NA	NA
VEA81790.1|1939844_1940171_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
VEA81791.1|1940704_1941370_+	metal-binding protein	NA	NA	NA	NA	NA
VEA81792.1|1941431_1942643_-	tyrosine-specific transport protein	NA	NA	NA	NA	NA
VEA81793.1|1942833_1943073_+	protein	NA	NA	NA	NA	NA
VEA81794.1|1943110_1943608_-	ferritin	NA	NA	NA	NA	NA
VEA81795.1|1943778_1944102_-	protein	NA	NA	NA	NA	NA
VEA81796.1|1944565_1944817_+	protein	NA	NA	NA	NA	NA
VEA81797.1|1944895_1945399_-	ferritin-like protein 2	NA	NA	NA	NA	NA
VEA81798.1|1946195_1947185_+	L-arabinose-binding periplasmic protein	NA	NA	NA	NA	NA
VEA81799.1|1947254_1948442_+	L-arabinose transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	5.8e-13
1948278:1948292	attR	GCGGAAGGCATTATT	NA	NA	NA	NA
VEA81800.1|1948444_1948768_+	L-arabinose transporter ATP-binding protein	NA	NA	NA	NA	NA
VEA81801.1|1948782_1949466_+	L-arabinose ABC transporter, permease protein	NA	NA	NA	NA	NA
VEA81802.1|1949508_1949769_+	L-arabinose ABC transporter, permease protein	NA	NA	NA	NA	NA
VEA81803.1|1949935_1950736_+	trehalose-6-phosphate phosphatase	NA	NA	NA	NA	NA
VEA81804.1|1950710_1952135_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
VEA81805.1|1952141_1952570_-	universal stress protein UspC	NA	NA	NA	NA	NA
VEA81806.1|1953348_1953699_+	transcriptional activator FlhD	NA	NA	NA	NA	NA
VEA81807.1|1953701_1954280_+	flagellar transcriptional activator	NA	NA	NA	NA	NA
VEA81808.1|1954406_1955294_+	chemotaxis protein MotA (motility protein A)	NA	NA	NA	NA	NA
VEA81809.1|1955290_1956217_+	chemotaxis protein MotB (motility protein B)	NA	NA	NA	NA	NA
VEA81810.1|1956221_1958186_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
VEA81811.1|1958206_1958710_+	chemotaxis protein	NA	NA	NA	NA	NA
VEA81812.1|1958854_1960516_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
VEA81813.1|1960561_1962163_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
VEA81814.1|1962181_1963042_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
VEA81815.1|1963044_1964094_+	Chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
VEA81816.1|1964108_1964498_+	Chemotaxis protein cheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.0e-06
VEA81817.1|1964508_1965153_+	chemotaxis regulator CheZ	NA	NA	NA	NA	NA
VEA81818.1|1965354_1966503_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
VEA81819.1|1966495_1968574_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
VEA81820.1|1968573_1968966_+	flagellar protein FlhE	NA	NA	NA	NA	NA
VEA81821.1|1969085_1969574_-	protein	NA	NA	NA	NA	NA
VEA81822.1|1969750_1971484_-|tRNA	arginyl-tRNA synthetase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 14
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	2261198	2331135	4692802	protease,portal,lysis,terminase,transposase,tail,integrase	Escherichia_phage(31.43%)	86	2288431:2288447	2344025:2344041
VEA82140.1|2261198_2262020_-|protease	putative protease	protease	NA	NA	NA	NA
VEA82141.1|2262295_2262592_-	acid shock protein	NA	NA	NA	NA	NA
VEA82142.1|2263015_2264269_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEA82143.1|2264375_2265269_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEA82144.1|2265403_2266624_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VEA82145.1|2266748_2267444_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VEA82146.1|2267396_2268653_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VEA82147.1|2268847_2269462_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
VEA82148.1|2269504_2270359_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VEA82149.1|2270360_2270729_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.3	2.5e-39
VEA82150.1|2270856_2270979_-	Dimethyl sulfoxide reductase chain B	NA	A0A077SL61	Escherichia_phage	66.7	4.1e-07
VEA82151.1|2270989_2271298_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	61.4	8.2e-28
VEA82152.1|2271431_2271743_-	Dimethyl sulfoxide reductase chain A	NA	NA	NA	NA	NA
VEA82153.1|2271762_2272062_-	Dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	51.9	1.3e-14
VEA82154.1|2272451_2272850_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	51.3	8.4e-25
VEA82155.1|2272788_2273067_-	putative oxidoreductase major subunit	NA	A0A077SK27	Escherichia_phage	51.8	1.0e-13
VEA82156.1|2273237_2273423_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	NA	NA	NA	NA
VEA82157.1|2273508_2275911_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	48.6	3.1e-207
VEA82158.1|2276109_2276415_-	protein	NA	NA	NA	NA	NA
VEA82159.1|2276486_2277233_+	lipoprotein	NA	NA	NA	NA	NA
VEA82160.1|2277235_2277796_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VEA82161.1|2277830_2278172_-	protein	NA	NA	NA	NA	NA
VEA82162.1|2278839_2280054_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	4.1e-46
VEA82163.1|2280065_2281085_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
VEA82164.1|2281142_2281271_+	protein, truncated	NA	NA	NA	NA	NA
VEA82165.1|2281291_2281927_-|integrase	defective integrase; Qin prophage	integrase	A0A286S1S8	Klebsiella_phage	65.2	7.0e-74
VEA82166.1|2282205_2282556_-|integrase	defective integrase; Qin prophage	integrase	Q8W658	Enterobacteria_phage	67.7	3.0e-34
VEA82167.1|2282590_2282827_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VEA82168.1|2282914_2285149_-	exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	57.5	7.7e-59
VEA82169.1|2285245_2285380_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82170.1|2285442_2285742_+|transposase	transposase	transposase	NA	NA	NA	NA
VEA82171.1|2285738_2286605_+|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VEA82172.1|2286601_2287201_-	Uncharacterised protein	NA	NA	NA	NA	NA
2288431:2288447	attL	GCCGTCTTTGCCAGCAG	NA	NA	NA	NA
VEA82173.1|2288671_2289721_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
VEA82174.1|2289738_2290116_+	putative antitermination protein Q-like protein; DLP12 prophage	NA	Q777W5	Enterobacteria_phage	81.7	6.9e-53
VEA82175.1|2290271_2290796_-	lipoprotein	NA	A0A1W6JNX6	Morganella_phage	52.2	1.5e-45
VEA82176.1|2290988_2291222_+	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VEA82177.1|2291196_2291949_+	putative pathogenicity island protein	NA	NA	NA	NA	NA
VEA82178.1|2292355_2293069_+	putative AraC-type regulatory protein encoded in prophage	NA	NA	NA	NA	NA
VEA82179.1|2293259_2293475_+|lysis	lysis protein S from lambdoid prophage	lysis	A5LH82	Enterobacteria_phage	93.0	8.5e-32
VEA82180.1|2293479_2293791_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
VEA82181.1|2293787_2294321_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
VEA82182.1|2294317_2294815_+	Qin prophage protein	NA	NA	NA	NA	NA
VEA82183.1|2296066_2296240_+	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VEA82184.1|2296535_2296742_+	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
VEA82185.1|2297304_2297832_+|terminase	putative terminase small subunit	terminase	A5LH26	Enterobacteria_phage	99.4	2.8e-92
VEA82186.1|2297840_2299940_+|terminase	terminase large subunit	terminase	A5LH27	Enterobacteria_phage	96.3	0.0e+00
VEA82187.1|2299936_2300149_+	prophage protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
VEA82188.1|2300148_2300346_+|portal	portal protein	portal	A5LH29	Enterobacteria_phage	100.0	1.5e-27
VEA82189.1|2300338_2301745_+|tail	Qin prophage; side tail fiber assembly protein	tail	K7PKI9	Enterobacteria_phage	75.8	9.7e-68
VEA82190.1|2302755_2302971_-	Insertion element protein	NA	NA	NA	NA	NA
VEA82191.1|2303126_2303420_+	IS1 protein InsB	NA	NA	NA	NA	NA
VEA82192.1|2303413_2303785_-	putative DNA-invertase	NA	NA	NA	NA	NA
VEA82193.1|2304102_2304336_-	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VEA82194.1|2305121_2306405_+	metabolite transport protein YdfJ	NA	NA	NA	NA	NA
VEA82195.1|2306493_2307954_+	putative sugar dehydrogenase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
VEA82196.1|2308043_2308193_-	selenium carrying protein	NA	J9Q802	Salmonella_phage	62.8	2.1e-05
VEA82197.1|2308369_2309056_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEA82198.1|2309144_2309891_-	NADP-dependent L-serine/L-allo-threonine dehydrogenase	NA	NA	NA	NA	NA
VEA82199.1|2310027_2310264_+	dipeptidyl carboxypeptidase II	NA	NA	NA	NA	NA
VEA82200.1|2310260_2312072_+	dipeptidyl carboxypeptidase II	NA	NA	NA	NA	NA
VEA82201.1|2312115_2312634_-	competence damage-inducible protein A	NA	NA	NA	NA	NA
VEA82202.1|2312911_2313304_+	stress response protein	NA	NA	NA	NA	NA
VEA82203.1|2313558_2314449_+	putative signal transduction protein	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
VEA82204.1|2314889_2316077_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VEA82205.1|2316271_2317171_+	amino acid metabolite efflux	NA	NA	NA	NA	NA
VEA82206.1|2317201_2317420_-	multiple antibiotic resistance protein	NA	NA	NA	NA	NA
VEA82207.1|2317451_2317835_-	DNA-binding transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
VEA82208.1|2317855_2318290_-	multiple antibiotic resistance regulatory protein	NA	NA	NA	NA	NA
VEA82209.1|2318509_2318830_+	ybl68	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
VEA82210.1|2318819_2319104_+	phage N15 gp48-like protein	NA	NA	NA	NA	NA
VEA82211.1|2319224_2319890_+	multiple antibiotic resistance protein	NA	NA	NA	NA	NA
VEA82212.1|2319914_2321105_-	sugar efflux transporter	NA	NA	NA	NA	NA
VEA82213.1|2321565_2321781_-	Insertion element protein	NA	NA	NA	NA	NA
VEA82214.1|2321852_2322230_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEA82215.1|2322814_2323012_+	putative transcriptional regulator	NA	NA	NA	NA	NA
VEA82216.1|2323300_2323429_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82217.1|2323560_2323938_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEA82218.1|2324009_2324225_+	Insertion element protein	NA	NA	NA	NA	NA
VEA82219.1|2324286_2324718_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82220.1|2324932_2325148_+	transcriptional regulator	NA	NA	NA	NA	NA
VEA82221.1|2325350_2325785_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82222.1|2325784_2328151_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VEA82223.1|2328147_2329146_-	Integrase	NA	NA	NA	NA	NA
VEA82224.1|2329142_2329697_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82225.1|2329680_2331135_-|integrase	Phage integrase	integrase	NA	NA	NA	NA
2344025:2344041	attR	CTGCTGGCAAAGACGGC	NA	NA	NA	NA
>prophage 15
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	2432040	2482773	4692802	transposase	Escherichia_phage(35.71%)	59	NA	NA
VEA82318.1|2432040_2432718_-|transposase	IS3 element transposase	transposase	U5P429	Shigella_phage	53.0	7.8e-39
VEA82319.1|2432908_2433208_-|transposase	transposase	transposase	NA	NA	NA	NA
VEA82320.1|2433235_2433517_-	putative glutathione S-transferase	NA	NA	NA	NA	NA
VEA82321.1|2433783_2434032_+	L-asparagine permease	NA	NA	NA	NA	NA
VEA82322.1|2433991_2434315_+	L-asparagine permease	NA	NA	NA	NA	NA
VEA82323.1|2434256_2435285_+	L-asparagine permease	NA	NA	NA	NA	NA
VEA82324.1|2435397_2436459_-	putative receptor	NA	NA	NA	NA	NA
VEA82325.1|2436865_2437408_+	TonB-dependent receptor	NA	NA	NA	NA	NA
VEA82326.1|2437441_2437738_+	TonB-dependent receptor	NA	NA	NA	NA	NA
VEA82327.1|2438512_2438806_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	59.6	4.1e-13
VEA82328.1|2439287_2439398_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VEA82329.1|2439705_2439831_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82330.1|2439775_2440849_-	putative zinc-binding dehydrogenase	NA	NA	NA	NA	NA
VEA82331.1|2440951_2441470_+	acetyltransferase yncA	NA	NA	NA	NA	NA
VEA82332.1|2441466_2441916_+	inner membrane protein	NA	NA	NA	NA	NA
VEA82333.1|2441916_2442150_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEA82334.1|2442235_2442409_-	inner membrane protein	NA	NA	NA	NA	NA
VEA82335.1|2442795_2444220_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
VEA82336.1|2444241_2445036_-	transporter permease	NA	NA	NA	NA	NA
VEA82337.1|2445025_2445967_-	ABC transporter permease	NA	NA	NA	NA	NA
VEA82338.1|2445967_2446981_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
VEA82339.1|2446998_2448144_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEA82340.1|2448388_2449795_-	transcriptional regulator protein YdcR	NA	NA	NA	NA	NA
VEA82341.1|2449873_2450311_-	putative transcriptional regulator	NA	A0A0R6PH90	Moraxella_phage	51.1	5.0e-31
VEA82342.1|2450335_2450512_-	toxin of the HicA-HicB toxin-antitoxin system	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
VEA82343.1|2450793_2450964_+	protein	NA	NA	NA	NA	NA
VEA82344.1|2451055_2453059_-	putative peptidase	NA	Q6DW11	Phage_TP	28.3	3.6e-23
VEA82345.1|2453089_2453626_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VEA82346.1|2453717_2454893_+	putative benzoate transporter	NA	NA	NA	NA	NA
VEA82347.1|2454932_2456198_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.8	8.1e-207
VEA82348.1|2456671_2457340_-	putative lipoprotein	NA	NA	NA	NA	NA
VEA82349.1|2457642_2458236_-	tellurite resistance protein	NA	NA	NA	NA	NA
VEA82350.1|2458232_2459225_-	potassium-tellurite ethidium and proflavin transporter	NA	NA	NA	NA	NA
VEA82351.1|2459348_2460329_+	putative transferase	NA	NA	NA	NA	NA
VEA82352.1|2460320_2460860_-	ribosomal-protein-serine acetyltransferase	NA	NA	NA	NA	NA
VEA82353.1|2460922_2461147_-	protein	NA	NA	NA	NA	NA
VEA82354.1|2461286_2462906_-	glucans biosynthesis protein D	NA	NA	NA	NA	NA
VEA82355.1|2463159_2464509_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEA82356.1|2464725_2465649_+	transcriptional regulator	NA	NA	NA	NA	NA
VEA82357.1|2465686_2467327_-	methyl-accepting chemotaxis protein III (ribose an galactose chemoreceptor protein)	NA	NA	NA	NA	NA
VEA82358.1|2467686_2467815_-	Insertion element protein	NA	NA	NA	NA	NA
VEA82359.1|2467970_2468264_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	95.9	8.8e-48
VEA82360.1|2468722_2468896_-	Uncharacterised protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
VEA82361.1|2469140_2469440_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	47.3	2.8e-17
VEA82362.1|2469436_2469670_-	cytochrome b561	NA	NA	NA	NA	NA
VEA82363.1|2469858_2470236_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VEA82364.1|2470232_2470859_+	glyceraldehyde-3-phosphate dehydrogenase C GapC	NA	NA	NA	NA	NA
VEA82365.1|2470900_2471929_-	aldehyde dehydrogenase A	NA	NA	NA	NA	NA
VEA82366.1|2471904_2472189_-	aldehyde dehydrogenase A	NA	NA	NA	NA	NA
VEA82367.1|2472139_2472340_-	aldehyde dehydrogenase A	NA	NA	NA	NA	NA
VEA82368.1|2472536_2473337_-	conserved SAM-binding protein, DUF218 family	NA	NA	NA	NA	NA
VEA82369.1|2473608_2477511_-	ATP-dependent helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
VEA82370.1|2477711_2478317_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
VEA82371.1|2478367_2479375_-	dual specificity phosphatase, catalytic domain protein YnbD	NA	NA	NA	NA	NA
VEA82372.1|2479674_2481171_-	putative hydrolase	NA	NA	NA	NA	NA
VEA82373.1|2481261_2481477_-	Insertion element protein	NA	NA	NA	NA	NA
VEA82374.1|2481548_2481926_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	3.8e-67
VEA82375.1|2481860_2482208_-	putative hydrolase	NA	A0A2L1IV26	Escherichia_phage	100.0	9.0e-07
VEA82376.1|2482395_2482773_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	3.8e-67
>prophage 16
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	2492943	2500214	4692802	tRNA	Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	9	NA	NA
VEA82390.1|2492943_2494077_+	outer membrane protein N (porin)	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
VEA82391.1|2494217_2494652_+	putative universal stress protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
VEA82392.1|2494828_2494933_+|tRNA	C32 tRNA thiolase	tRNA	NA	NA	NA	NA
VEA82393.1|2494929_2495763_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	1.2e-129
VEA82394.1|2495891_2497025_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.4	1.9e-37
VEA82395.1|2496996_2497266_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	44.1	4.1e-07
VEA82396.1|2497295_2497469_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82397.1|2497743_2498727_-	zinc transport protein	NA	NA	NA	NA	NA
VEA82398.1|2498981_2500214_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 17
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	2704193	2717615	4692802	terminase	Enterobacteria_phage(38.46%)	19	NA	NA
VEA82603.1|2704193_2705057_+	spermidine/putrescine ABC transporter membrane protein	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
VEA82604.1|2705612_2706281_+	methylase	NA	NA	NA	NA	NA
VEA82605.1|2706728_2707943_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82606.1|2707894_2709445_-|terminase	DNA packaging protein of prophage (terminase large subunit)	terminase	A0A291AWY5	Escherichia_phage	99.7	1.3e-177
VEA82607.1|2709429_2709822_-|terminase	DNA packaging protein of prophage (terminase large subunit)	terminase	K7PH40	Enterobacteria_phage	96.5	6.3e-57
VEA82608.1|2709821_2710316_-	prophage protein	NA	A0A291AWV8	Escherichia_phage	99.4	2.2e-83
VEA82609.1|2710765_2711131_-	KilA-N domain-containing protein	NA	A0A220NRM9	Escherichia_phage	99.1	5.8e-57
VEA82610.1|2711152_2711620_-	Endopeptidase (Lysis protein) from bacteriophage origin	NA	A5LH84	Enterobacteria_phage	89.7	5.1e-66
VEA82611.1|2712018_2712171_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82612.1|2712322_2712856_-	membrane-associated lysozyme; Qin prophage	NA	K7PLY1	Enterobacteria_phage	97.2	1.1e-99
VEA82613.1|2712911_2713226_-	bacteriophage protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
VEA82614.1|2713230_2713410_-	Lysis protein S	NA	M1FN85	Enterobacteria_phage	97.9	6.2e-20
VEA82615.1|2714314_2715193_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82616.1|2715196_2715442_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82617.1|2715442_2715829_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82618.1|2715842_2716193_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.8	4.4e-54
VEA82619.1|2716182_2716554_-	holliday junction resolvase	NA	V5URS4	Shigella_phage	62.8	2.0e-36
VEA82620.1|2716566_2717025_-	putative prophage protein	NA	U5P0K4	Shigella_phage	67.8	2.6e-54
VEA82621.1|2716970_2717615_-	putative prophage protein	NA	S5FV02	Shigella_phage	47.4	1.1e-47
>prophage 18
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	2721697	2729449	4692802		Escherichia_phage(50.0%)	13	NA	NA
VEA82627.1|2721697_2722153_-	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	2.3e-63
VEA82628.1|2722193_2723264_-	replication protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
VEA82629.1|2723335_2723761_-	phage regulatory protein	NA	NA	NA	NA	NA
VEA82630.1|2723757_2724012_-	regulatory protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
VEA82631.1|2724091_2724511_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
VEA82632.1|2724726_2724963_+	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	1.4e-06
VEA82633.1|2724964_2725093_+	putative prophage protein	NA	NA	NA	NA	NA
VEA82634.1|2725122_2725341_+	putative prophage protein	NA	NA	NA	NA	NA
VEA82635.1|2725363_2725738_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82636.1|2725727_2725949_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82637.1|2726508_2726697_+	division inhibition protein	NA	NA	NA	NA	NA
VEA82638.1|2726693_2726885_+	putative prophage protein	NA	NA	NA	NA	NA
VEA82639.1|2726977_2729449_+	exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.9	1.6e-57
>prophage 19
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	2863774	2892276	4692802	protease,integrase,transposase,tail	Shigella_phage(25.0%)	36	2879875:2879934	2891351:2891415
VEA82779.1|2863774_2864278_-|transposase	transposase ORF B, IS1	transposase	U5P0U6	Shigella_phage	93.2	1.6e-84
VEA82780.1|2864729_2865035_+	inner membrane protein	NA	NA	NA	NA	NA
VEA82781.1|2865141_2865417_+	outer membrane lipoprotein	NA	NA	NA	NA	NA
VEA82782.1|2865386_2865785_+	outer membrane lipoprotein	NA	NA	NA	NA	NA
VEA82783.1|2865836_2866529_+	group 4 capsule (G4C) polysaccharide, YmcB	NA	NA	NA	NA	NA
VEA82784.1|2866528_2868625_+	putative lipoprotein	NA	NA	NA	NA	NA
VEA82785.1|2868670_2869810_+	polysaccharide export protein	NA	NA	NA	NA	NA
VEA82786.1|2869797_2870244_+	phosphotyrosine-protein phosphatase	NA	NA	NA	NA	NA
VEA82787.1|2870263_2872444_+	cryptic autophosphorylating protein tyrosine kinase Etk	NA	NA	NA	NA	NA
VEA82788.1|2872558_2873857_-	periplasmic AppA protein [includes: phosphoanhydrid phosphohydrolase and 4-phytase]	NA	NA	NA	NA	NA
VEA82789.1|2873936_2874029_-	small predicted membrane protein	NA	NA	NA	NA	NA
VEA82790.1|2874041_2875178_-	cytochrome bd-II oxidase subunit 2	NA	NA	NA	NA	NA
VEA82791.1|2875189_2876734_-	cytochrome bd-II oxidase subunit I	NA	NA	NA	NA	NA
VEA82792.1|2876867_2877725_-	hydrogenase-1 operon protein HyaF	NA	NA	NA	NA	NA
VEA82793.1|2877721_2878120_-	hydrogenase-1 operon protein	NA	NA	NA	NA	NA
VEA82794.1|2878116_2878428_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
VEA82795.1|2878424_2879420_-	hydrogenase 1, small subunit	NA	NA	NA	NA	NA
2879875:2879934	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
VEA82796.1|2880075_2880204_-|tail	putative phage tail fiber protein	tail	Q8W610	Enterobacteria_phage	75.7	6.6e-08
VEA82797.1|2880258_2880789_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	85.2	3.6e-84
VEA82798.1|2880803_2881913_-|tail	putative phage tail fiber protein	tail	Q8W613	Enterobacteria_phage	60.3	1.3e-110
VEA82799.1|2881943_2882252_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82800.1|2882251_2882590_-	replication protein	NA	A0A088CBP4	Shigella_phage	82.9	7.1e-49
VEA82801.1|2882596_2883562_-	ybl78	NA	U5P0A0	Shigella_phage	63.3	3.7e-58
VEA82802.1|2883586_2884012_-	phage regulatory CII	NA	NA	NA	NA	NA
VEA82803.1|2884008_2884224_-	putative antirepressor protein	NA	NA	NA	NA	NA
VEA82804.1|2884273_2884990_+	Putative SOS-response transcriptional repressor	NA	H9C160	Pectobacterium_phage	41.2	1.0e-49
VEA82805.1|2885177_2885414_+	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	3.6e-07
VEA82806.1|2885415_2885544_+	putative prophage protein	NA	NA	NA	NA	NA
VEA82807.1|2885573_2885792_+	putative prophage protein	NA	NA	NA	NA	NA
VEA82808.1|2885814_2886222_+	Uncharacterised protein	NA	A0A2R2Z306	Escherichia_phage	40.9	1.0e-09
VEA82809.1|2886199_2886433_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82810.1|2886962_2887151_+	cell division inhibition protein	NA	NA	NA	NA	NA
VEA82811.1|2887147_2887351_+	phage protein	NA	NA	NA	NA	NA
VEA82812.1|2887431_2889903_+	exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	58.8	3.8e-59
VEA82813.1|2890189_2891209_+|integrase	integrase from prophage	integrase	A0A192Y7M7	Salmonella_phage	49.4	6.4e-85
VEA82814.1|2891616_2892276_+	putative carrier/transport protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
2891351:2891415	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 20
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	2979007	3019207	4692802	tRNA,protease,tail	Enterobacteria_phage(48.65%)	46	NA	NA
VEA82903.1|2979007_2979625_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
VEA82904.1|2979635_2982080_-	anaerobic dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
VEA82905.1|2982379_2983372_-	Putative Integrase	NA	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
VEA82906.1|2983441_2983783_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
VEA82907.1|2983887_2984409_+	Cox protein	NA	NA	NA	NA	NA
VEA82908.1|2984413_2984836_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82909.1|2984842_2985034_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82910.1|2985171_2985522_+	Uncharacterised protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
VEA82911.1|2985532_2985811_+	Uncharacterised protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
VEA82912.1|2985822_2986065_+	Uncharacterised protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
VEA82913.1|2986061_2986175_+	Uncharacterised protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
VEA82914.1|2986268_2986667_+	Prophage protein	NA	A0A0A7NRY9	Enterobacteria_phage	97.4	7.3e-13
VEA82915.1|2986663_2987056_+	putative phage PS3	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	3.2e-69
VEA82916.1|2987052_2987568_+	phage protein	NA	Q08JA2	Stx2-converting_phage	94.9	8.2e-57
VEA82917.1|2987591_2988047_+|tail	Phage tail completion protein R	tail	A0A0A7NPU6	Enterobacteria_phage	94.4	1.3e-53
VEA82918.1|2988043_2988598_+|tail	phage tail protein S	tail	A0A0A7NV60	Enterobacteria_phage	100.0	1.0e-97
VEA82919.1|2988679_2989288_+	Tail protein I	NA	A0A0F7LA36	Escherichia_phage	74.9	4.5e-86
VEA82920.1|2989284_2989896_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	82.0	2.8e-80
VEA82921.1|2989882_2990815_+|tail	putative side tail fiber protein from lambdoid prophage	tail	M1TAS6	Escherichia_phage	75.3	2.0e-29
VEA82922.1|2990899_2991091_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA82923.1|2991141_2991372_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	63.9	2.3e-19
VEA82924.1|2991406_2991910_-|tail	putative phage tail fiber protein H	tail	K7P7Q7	Enterobacteria_phage	61.0	1.3e-17
VEA82925.1|2992206_2992599_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	89.5	7.9e-52
VEA82926.1|2992625_2992922_-|tail	tail fiber protein	tail	A0A0A7NV65	Enterobacteria_phage	96.9	1.1e-45
VEA82927.1|2992863_2993115_-|tail	tail fiber protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	4.2e-30
VEA82928.1|2993194_2994748_-|tail	tail protein (modular protein)	tail	A0A0A7NRZ9	Enterobacteria_phage	89.0	4.3e-250
VEA82929.1|2994786_2995932_-|tail	tail protein (modular protein)	tail	A0A0A7NRZ9	Enterobacteria_phage	95.7	4.2e-170
VEA82930.1|2995918_2996839_-|tail	Major tail sheath protein FI	tail	A0A0A7NV69	Enterobacteria_phage	97.9	7.6e-162
VEA82931.1|2996995_2997679_+	putative phage late gene regulator	NA	A0A0A7NQ97	Enterobacteria_phage	55.6	8.0e-92
VEA82932.1|2997719_2997980_+	DNA-binding transcriptional regulator prophage remnant	NA	NA	NA	NA	NA
VEA82933.1|2998171_2998312_+	small toxic polypeptide	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
VEA82934.1|2998616_2999909_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
VEA82935.1|2999999_3001343_-	putative ATPase	NA	G3MBE0	Bacillus_virus	40.8	2.8e-80
VEA82936.1|3001353_3001965_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VEA82937.1|3002119_3006148_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
VEA82938.1|3006282_3006777_-	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VEA82939.1|3007321_3008287_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
VEA82940.1|3008409_3010176_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
VEA82941.1|3010176_3011898_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
VEA82942.1|3011939_3012644_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VEA82943.1|3012928_3013147_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VEA82944.1|3014010_3015501_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	47.5	3.1e-128
VEA82945.1|3015484_3016288_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7SAX5	Vibrio_phage	35.3	4.4e-33
VEA82946.1|3016318_3016639_-|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
VEA82947.1|3016962_3017187_+	stationary phase/starvation inducible regulatory protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
VEA82948.1|3017197_3019207_-	macrolide export ATP-binding/permease protein	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 21
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	3118087	3147091	4692802	lysis,integrase,transposase,tail	Enterobacteria_phage(50.0%)	33	3132992:3133006	3147165:3147179
VEA83051.1|3118087_3118465_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
VEA83052.1|3118536_3118752_+	Insertion element protein	NA	NA	NA	NA	NA
VEA83053.1|3118835_3119540_-	membrane protein YbhM	NA	NA	NA	NA	NA
VEA83054.1|3119744_3120449_-	inner membrane protein	NA	NA	NA	NA	NA
VEA83055.1|3120585_3121038_-	molybdopterin converting factor subunit 2	NA	NA	NA	NA	NA
VEA83056.1|3121039_3121285_-	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
VEA83057.1|3121277_3121763_-	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
VEA83058.1|3121765_3122278_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
VEA83059.1|3123740_3124595_+	transferase with NAD(P)-binding Rossmann-fold domain; UPF0052 family	NA	A1IMD5	Streptococcus_phage	31.2	1.4e-24
VEA83060.1|3124786_3126808_-	UvrABC system protein B (excinuclease ABC subunit B)	NA	NA	NA	NA	NA
VEA83061.1|3127386_3128064_-	dithiobiotin synthetase	NA	NA	NA	NA	NA
VEA83062.1|3128056_3128812_-	biotin biosynthesis protein BioC	NA	NA	NA	NA	NA
VEA83063.1|3128798_3129953_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
VEA83064.1|3129949_3130990_-	biotin synthetase	NA	NA	NA	NA	NA
VEA83065.1|3131076_3132366_+	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
VEA83066.1|3132424_3132901_+	putative phosphatidylethanolamine-binding protein	NA	NA	NA	NA	NA
3132992:3133006	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
VEA83067.1|3133811_3134978_+	membrane protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.8e-20
VEA83068.1|3135343_3135433_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA83069.1|3135482_3136445_+	Mu prophage; Tail fiber protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
VEA83070.1|3136448_3136784_+|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	97.2	6.5e-55
VEA83071.1|3136752_3138585_-	Host specificity protein J of prophage	NA	A5LH43	Enterobacteria_phage	97.8	1.0e-274
VEA83072.1|3138722_3140147_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VEA83073.1|3140317_3140794_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	96.1	1.3e-72
VEA83074.1|3140778_3141276_-	phage lysozome	NA	A0A1B5FP97	Escherichia_phage	97.0	9.3e-90
VEA83075.1|3141275_3141491_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VEA83076.1|3141678_3142410_-	araC-type regulatory protein from bacteriophage origin	NA	NA	NA	NA	NA
VEA83077.1|3142761_3143514_-	putative pathogenicity island protein	NA	NA	NA	NA	NA
VEA83078.1|3143914_3144331_+	lipoprotein	NA	A0A1W6JNX6	Morganella_phage	58.9	2.5e-40
VEA83079.1|3144341_3144635_-	IS1 protein InsB	NA	NA	NA	NA	NA
VEA83080.1|3144763_3145039_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.5e-46
VEA83081.1|3145104_3145533_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA83082.1|3145616_3145784_+	Uncharacterised protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
VEA83083.1|3146398_3147091_+|integrase	phage integrase	integrase	Q9MCR4	Enterobacteria_phage	99.6	4.3e-125
3147165:3147179	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 22
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	3342242	3393485	4692802	protease,lysis,transposase,tail,integrase	Enterobacteria_phage(42.11%)	52	3375941:3375987	3389750:3389796
VEA83270.1|3342242_3342383_-|transposase	transposase	transposase	NA	NA	NA	NA
VEA83271.1|3342405_3343518_-|transposase	IS186, transposase	transposase	NA	NA	NA	NA
VEA83272.1|3344199_3345318_+	carboxylate-amine ligase	NA	NA	NA	NA	NA
VEA83273.1|3345383_3345632_+	membrane protein YbdJ	NA	NA	NA	NA	NA
VEA83274.1|3345696_3346065_+	putative cytoplasmic protein YjbR	NA	NA	NA	NA	NA
VEA83275.1|3346158_3346812_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
VEA83276.1|3346919_3348167_+	putative mechanosensitive ion channel protein	NA	NA	NA	NA	NA
VEA83277.1|3348234_3349647_-	phenylalanine transporter	NA	NA	NA	NA	NA
VEA83278.1|3349712_3352856_-	cation efflux system protein	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
VEA83279.1|3352867_3353122_-	cation efflux system protein	NA	NA	NA	NA	NA
VEA83280.1|3353090_3353444_-	cation efflux system protein	NA	NA	NA	NA	NA
VEA83281.1|3353448_3354093_-	cation efflux system protein	NA	NA	NA	NA	NA
VEA83282.1|3354108_3354441_-	cation efflux system protein	NA	NA	NA	NA	NA
VEA83283.1|3354597_3354942_-	copper/silver efflux system outer membrane protein CusC	NA	NA	NA	NA	NA
VEA83284.1|3355016_3355973_-	copper/silver efflux system outer membrane protein CusC	NA	NA	NA	NA	NA
VEA83285.1|3356129_3356813_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	35.1	6.0e-31
VEA83286.1|3356802_3357201_+	sensor kinase CusS	NA	NA	NA	NA	NA
VEA83287.1|3357197_3358250_+	sensor kinase CusS	NA	NA	NA	NA	NA
VEA83288.1|3358986_3360888_+	Rhs element Vgr protein	NA	A0A077K8Q4	Ralstonia_phage	25.5	3.3e-26
VEA83289.1|3360915_3361377_+	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VEA83290.1|3361396_3365650_+	Rhs core protein	NA	NA	NA	NA	NA
VEA83291.1|3365946_3366207_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA83292.1|3366206_3366494_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA83293.1|3366784_3366982_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA83294.1|3367458_3368595_+	H repeat-associated protein	NA	NA	NA	NA	NA
VEA83295.1|3368865_3370977_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
VEA83296.1|3371089_3374062_+	bacteriophage N4 receptor, outer membrane subunit	NA	NA	NA	NA	NA
VEA83297.1|3374062_3374953_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA83298.1|3375135_3375897_+	porin thermoregulatory protein	NA	NA	NA	NA	NA
3375941:3375987	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VEA83299.1|3376410_3377364_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VEA83300.1|3377723_3377939_-	Insertion element protein	NA	NA	NA	NA	NA
VEA83301.1|3378010_3378388_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	3.8e-67
VEA83302.1|3378398_3379139_-	DNA-binding transcriptional activator	NA	NA	NA	NA	NA
VEA83303.1|3380118_3380823_-	putative prophage protein	NA	A0A1X7QGH6	Escherichia_phage	61.1	3.0e-57
VEA83304.1|3380832_3381114_-	putative prophage protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
VEA83305.1|3381110_3381884_-|tail	Putative phage tail fiber protein	tail	A0A0E3M194	Enterobacteria_phage	39.2	1.7e-42
VEA83306.1|3382213_3382759_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
VEA83307.1|3383701_3383995_+	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
VEA83308.1|3384026_3384488_-	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	98.0	2.7e-75
VEA83309.1|3384484_3384982_-	phage lysozome	NA	A0A1B5FP97	Escherichia_phage	96.4	1.2e-89
VEA83310.1|3384981_3385197_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VEA83311.1|3385785_3386868_+	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	3.5e-166
VEA83312.1|3387057_3387441_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
VEA83313.1|3387663_3388026_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
VEA83314.1|3388095_3388374_+	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
VEA83315.1|3388572_3389736_+|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
VEA83316.1|3390070_3390703_+	two component transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
3389750:3389796	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VEA83317.1|3390705_3391221_-	fimbrial protein	NA	NA	NA	NA	NA
VEA83318.1|3391231_3391483_-	fimbrial protein	NA	NA	NA	NA	NA
VEA83319.1|3391534_3391828_-	IS1 protein InsB	NA	NA	NA	NA	NA
VEA83320.1|3391956_3392232_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.5e-46
VEA83321.1|3392618_3393485_+	5,10-methylene-tetrahydrofolate dehydrogenase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 23
LR134157	Escherichia coli strain NCTC11105 genome assembly, chromosome: 1	4692802	3596061	3674764	4692802	holin,integrase,transposase,tail	Shigella_phage(44.44%)	84	3658299:3658358	3670849:3670908
VEA83532.1|3596061_3596337_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.5e-46
VEA83533.1|3596472_3597522_-	putative zinc-binding dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
VEA83534.1|3597898_3599281_-	deaminase	NA	NA	NA	NA	NA
VEA83535.1|3599277_3600240_-	carbamate kinase-like protein	NA	NA	NA	NA	NA
VEA83536.1|3600315_3600636_-	protein	NA	NA	NA	NA	NA
VEA83537.1|3600661_3601753_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEA83538.1|3601759_3602080_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VEA83539.1|3602079_3603627_-	YahF/FdrA-like protein	NA	NA	NA	NA	NA
VEA83540.1|3603616_3604480_-	protein	NA	NA	NA	NA	NA
VEA83541.1|3604519_3605125_-	ankyrin	NA	NA	NA	NA	NA
VEA83542.1|3605382_3605880_+	inner membrane protein	NA	NA	NA	NA	NA
VEA83543.1|3605971_3606904_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEA83544.1|3606945_3608034_-	putative signal transduction protein	NA	NA	NA	NA	NA
VEA83545.1|3608550_3608766_-	Insertion element protein	NA	NA	NA	NA	NA
VEA83546.1|3608837_3609215_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.2	3.8e-67
VEA83547.1|3609479_3611513_-|holin	high-affinity choline transport protein (BCCT-family transporter)	holin	A0A2I7QNT1	Vibrio_phage	27.4	4.4e-21
VEA83548.1|3611641_3612229_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
VEA83549.1|3612242_3613715_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
VEA83550.1|3613728_3615399_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
VEA83551.1|3615611_3616280_+	inner membrane protein	NA	NA	NA	NA	NA
VEA83552.1|3616522_3617218_-	transporter	NA	NA	NA	NA	NA
VEA83553.1|3617210_3618638_-	putative electron transport protein YkgF	NA	NA	NA	NA	NA
VEA83554.1|3618648_3619368_-	hydroxyacid oxidoreductase (Fe-S centre)	NA	NA	NA	NA	NA
VEA83555.1|3619894_3620194_-	transcriptional regulator YkgD	NA	NA	NA	NA	NA
VEA83556.1|3620249_3620660_-	transcriptional regulator YkgD	NA	NA	NA	NA	NA
VEA83557.1|3620977_3622303_+	putative pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
VEA83558.1|3622659_3623253_+	inner membrane protein	NA	NA	NA	NA	NA
VEA83559.1|3623842_3624676_+	Putatve transcriptional regulator ykgA	NA	NA	NA	NA	NA
VEA83560.1|3624898_3625402_+|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	92.8	2.3e-88
VEA83561.1|3625427_3625586_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA83562.1|3625610_3625850_-	attaching and effacing protein, pathogenesis factor	NA	NA	NA	NA	NA
VEA83563.1|3625833_3629868_-	Ig domain-containing protein	NA	NA	NA	NA	NA
VEA83564.1|3630982_3631084_+	small predicted membrane protein	NA	NA	NA	NA	NA
VEA83565.1|3631444_3631711_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEA83566.1|3631710_3631851_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
VEA83567.1|3632935_3633478_+	putative fimbrial transcriptional regulator	NA	NA	NA	NA	NA
VEA83568.1|3633552_3634140_+	fimbrillin	NA	NA	NA	NA	NA
VEA83569.1|3634197_3634866_+	putative fimbrial protein	NA	NA	NA	NA	NA
VEA83570.1|3634891_3635410_+	putative fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEA83571.1|3635418_3637416_+	putative fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VEA83572.1|3637405_3639049_+	putative fimbrial protein	NA	NA	NA	NA	NA
VEA83573.1|3639017_3639728_+	putative fimbrial protein	NA	NA	NA	NA	NA
VEA83574.1|3640617_3640989_-	Inner membrane protein yagU	NA	NA	NA	NA	NA
VEA83575.1|3640979_3641231_-	integral membrane protein	NA	NA	NA	NA	NA
VEA83576.1|3641648_3642338_+	putative xanthine dehydrogenase, iron-sulfur binding subunit	NA	NA	NA	NA	NA
VEA83577.1|3642334_3643291_+	putative xanthine dehydrogenase, FAD-binding subunit	NA	NA	NA	NA	NA
VEA83578.1|3643287_3644121_+	putative xanthine dehydrogenase, molybdenum-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	28.8	2.6e-12
VEA83579.1|3644332_3645343_+	putative xanthine dehydrogenase, molybdenum-binding subunit	NA	NA	NA	NA	NA
VEA83580.1|3645339_3645486_+	putative xanthine dehydrogenase, molybdenum-binding subunit	NA	NA	NA	NA	NA
VEA83581.1|3645495_3646059_+	xanthine dehydrogenase accessory factor	NA	NA	NA	NA	NA
VEA83582.1|3646201_3646453_+	xanthine dehydrogenase accessory factor	NA	NA	NA	NA	NA
VEA83583.1|3646431_3646842_+	transcriptional regulator	NA	NA	NA	NA	NA
VEA83584.1|3647275_3647461_+	IS2 ORF2	NA	A0A1B0Z042	Pseudomonas_phage	70.9	3.6e-15
VEA83585.1|3647502_3648246_-	putative AraC-type regulatory protein encoded in prophage CP-933H	NA	NA	NA	NA	NA
VEA83586.1|3649073_3649847_+	Uncharacterised protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
VEA83587.1|3649828_3649957_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA83588.1|3649940_3650459_-	DNA invertase from prophage CP-933H	NA	A0A1S6L009	Salmonella_phage	86.0	1.8e-80
VEA83589.1|3651241_3651634_-|tail	tail fiber assembly protein from lambdoid prophage	tail	U5P0S4	Shigella_phage	72.0	1.5e-42
VEA83590.1|3652380_3652719_+	DNA invertase from prophage CP-933H	NA	M1T2R9	Escherichia_phage	92.7	4.4e-51
VEA83591.1|3653459_3654347_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA83592.1|3654387_3657915_+	Uncharacterised protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	6.5e-44
3658299:3658358	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAAG	NA	NA	NA	NA
VEA83593.1|3658358_3659192_-|integrase	phage integrase	integrase	Q9ZXG4	Shigella_phage	99.6	1.2e-161
VEA83594.1|3659402_3659729_-	putative LexA repressor	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
VEA83595.1|3659725_3660379_-	putative phage AdoMet-dependent methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
VEA83596.1|3660378_3660873_-	CPS-53 (KpLE1) prophage protein	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	7.3e-87
VEA83597.1|3660869_3661118_-	putative phage replication protein O	NA	U5P0A0	Shigella_phage	100.0	2.7e-37
VEA83598.1|3661176_3662199_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
VEA83599.1|3662198_3662978_+	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
VEA83600.1|3662987_3663770_-	phage O protein family	NA	U5P0A0	Shigella_phage	96.1	2.8e-109
VEA83601.1|3663779_3664118_-	Uncharacterised protein	NA	U5P0J9	Shigella_phage	96.4	1.7e-55
VEA83602.1|3664114_3664666_-	nucleic acid-binding protein; e14 prophage	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
VEA83603.1|3664658_3664919_-	putative lambda repressor-like DNA-binding domains	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
VEA83604.1|3665061_3665709_+	regulatory protein	NA	S5FUZ3	Shigella_phage	100.0	2.8e-118
VEA83605.1|3665986_3666283_+	Uncharacterised protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
VEA83606.1|3666200_3666446_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA83607.1|3666883_3667246_+	CPS-53 (KpLE1) prophage protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
VEA83608.1|3667311_3668136_+	CPS-53 (KpLE1) prophage protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
VEA83609.1|3668263_3668800_+	CPS-53 (KpLE1) prophage protein	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
VEA83610.1|3668790_3669153_+	CPS-53 (KpLE1) prophage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
VEA83611.1|3669152_3669458_+	CPS-53 (KpLE1) prophage protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
VEA83612.1|3669684_3670848_+|integrase	prophage integrase	integrase	U5P434	Shigella_phage	99.7	2.6e-228
VEA83613.1|3671052_3672306_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	9.8e-96
3670849:3670908	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
VEA83614.1|3672317_3673421_-	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
VEA83615.1|3673708_3674764_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
