The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	139357	146289	4600697		Prochlorococcus_phage(16.67%)	7	NA	NA
VEA10191.1|139357_140290_-	ADP-L-Glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	8.5e-36
VEA10192.1|140492_141689_+	2-amino-3-ketobutyrate coenzyme A ligase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
VEA10193.1|141698_142283_+	threonine 3-dehydrogenase	NA	K7Z7U2	Megavirus	34.1	4.9e-05
VEA10194.1|142230_142725_+	threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	1.0e-19
VEA10195.1|143018_144053_+	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	30.4	4.1e-07
VEA10196.1|144039_145002_-	Putative periplasmic protein YibQ -like protein with nucleoside di phosphatase and polysaccharide deacetylase	NA	NA	NA	NA	NA
VEA10197.1|145005_146289_-	Periplasmic septal ring factor with murein hydrolase activity EnvC/YibP	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
>prophage 2
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	1063867	1128870	4600697	tail,tRNA,transposase,integrase	Escherichia_phage(29.41%)	59	1077898:1077913	1132001:1132016
VEA11093.1|1063867_1066498_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
VEA11094.1|1066732_1066918_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
VEA11095.1|1068040_1068607_+	Phosphatase YqaB	NA	NA	NA	NA	NA
VEA11096.1|1068603_1069029_+	membrane protein	NA	NA	NA	NA	NA
VEA11097.1|1069105_1070662_+	gamma-glutamylcysteine synthetase	NA	NA	NA	NA	NA
VEA11098.1|1070811_1071327_+	autoinducer-2 production protein LuxS	NA	NA	NA	NA	NA
VEA11099.1|1071470_1073009_-	multidrug resistance protein B	NA	NA	NA	NA	NA
VEA11100.1|1073025_1074198_-	multidrug resistance secretion protein	NA	NA	NA	NA	NA
VEA11101.1|1074324_1074855_-	transcriptional regulator	NA	NA	NA	NA	NA
VEA11102.1|1075351_1076536_-	transmembrane transport protein	NA	NA	NA	NA	NA
VEA11103.1|1076700_1077696_-	glycine betaine-binding periplasmic protein	NA	NA	NA	NA	NA
VEA11104.1|1077765_1078830_-	glycine betaine/L-proline transporter permease P	NA	NA	NA	NA	NA
1077898:1077913	attL	GACGCCGCCGACGGTT	NA	NA	NA	NA
VEA11105.1|1078822_1080025_-	glycine betaine/L-proline transport ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
VEA11106.1|1080379_1081339_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	1.8e-129
VEA11107.1|1081349_1083467_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A8E2R1	Enterococcus_phage	48.3	2.4e-195
VEA11108.1|1083466_1083877_-	ribonucleotide reductase stimulatory protein	NA	A0A142F1R4	Bacillus_phage	41.0	1.6e-15
VEA11109.1|1083873_1084119_-	glutaredoxin-like protein	NA	NA	NA	NA	NA
VEA11110.1|1084390_1084822_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
VEA11111.1|1084910_1086245_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
VEA11112.1|1086328_1086655_-	protein ygaM	NA	NA	NA	NA	NA
VEA11113.1|1086816_1087167_+	YgaC	NA	NA	NA	NA	NA
VEA11114.1|1087201_1087651_-	Putative inner membrane protein	NA	NA	NA	NA	NA
VEA11115.1|1088549_1088951_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
VEA11116.1|1089040_1089220_-	Uncharacterised protein	NA	NA	NA	NA	NA
VEA11117.1|1089298_1089826_-	membrane transport protein	NA	NA	NA	NA	NA
VEA11118.1|1089835_1090135_-	ArsR family regulatory protein	NA	NA	NA	NA	NA
VEA11119.1|1090317_1090476_+	Uncharacterized homolog of Blt101	NA	NA	NA	NA	NA
VEA11120.1|1090575_1091025_+	LysM domain/BON superfamily protein	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
VEA11121.1|1091046_1091724_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
VEA11122.1|1091765_1093166_-	GabA permease	NA	NA	NA	NA	NA
VEA11123.1|1093295_1094579_-	4-aminobutyrate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	31.1	4.6e-32
VEA11124.1|1094593_1096042_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VEA11125.1|1096063_1097332_-	GAB DTP gene cluster repressor	NA	NA	NA	NA	NA
VEA11126.1|1097357_1098335_-	Protein CsiD	NA	NA	NA	NA	NA
VEA11127.1|1098637_1100152_-	tricarboxylic transport	NA	NA	NA	NA	NA
VEA11128.1|1100162_1100594_-	tricarboxylic transport	NA	NA	NA	NA	NA
VEA11129.1|1100608_1101586_-	tricarboxylic transport	NA	NA	NA	NA	NA
VEA11130.1|1101740_1102415_+	transcriptional regulator	NA	NA	NA	NA	NA
VEA11131.1|1102401_1103817_+	tricarboxylic transport: regulatory protein	NA	NA	NA	NA	NA
VEA11132.1|1103949_1104963_+	cation transporter	NA	NA	NA	NA	NA
VEA11133.1|1105054_1105168_-	membrane protein	NA	NA	NA	NA	NA
VEA11134.1|1105638_1106535_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
VEA11135.1|1106830_1107760_-	VirG localization protein VirK	NA	NA	NA	NA	NA
VEA11136.1|1108153_1109206_+	effector protein pipB2	NA	NA	NA	NA	NA
VEA11137.1|1109291_1109582_+|transposase	transposase	transposase	Q9MCT5	Escherichia_phage	82.7	1.1e-29
VEA11138.1|1109904_1110045_+|transposase	transposase	transposase	Q9MCT5	Escherichia_phage	95.7	5.0e-17
VEA11139.1|1110620_1112801_+	outer membrane receptor FepA	NA	NA	NA	NA	NA
VEA11140.1|1112842_1113790_-	hydrolase	NA	NA	NA	NA	NA
VEA11141.1|1113823_1115068_-	enterochelin esterase	NA	NA	NA	NA	NA
VEA11142.1|1115177_1118834_-	ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	1.5e-43
VEA11143.1|1118914_1120030_-	Glycosyltransferase IroB	NA	NA	NA	NA	NA
VEA11144.1|1120510_1121014_+|integrase	prophage integrase	integrase	A0A1B5FPC6	Escherichia_phage	82.0	2.4e-53
VEA11145.1|1121041_1121341_+|transposase	IS3 transposase	transposase	NA	NA	NA	NA
VEA11146.1|1121337_1122204_+	Transposase for insertion sequence element IS904	NA	U5P429	Shigella_phage	42.6	1.8e-51
VEA11147.1|1122506_1123694_+	Uncharacterized protein conserved in bacteria	NA	A0A088CPR9	Enterobacteria_phage	31.8	1.0e-33
VEA11148.1|1123704_1124073_-|tail	Caudovirales tail fibre assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.6	5.5e-31
VEA11149.1|1124074_1124920_-|integrase	prophage integrase	integrase	A0A1B5FPC6	Escherichia_phage	94.7	1.1e-10
VEA11150.1|1125518_1126709_-	Putative HlyD family secretion protein	NA	NA	NA	NA	NA
VEA11151.1|1126689_1128870_-	type I secretion protein, ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
1132001:1132016	attR	GACGCCGCCGACGGTT	NA	NA	NA	NA
>prophage 3
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	1232830	1242778	4600697		Organic_Lake_phycodnavirus(33.33%)	15	NA	NA
VEA11243.1|1232830_1233667_-	Predicted esterase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.0	5.3e-13
VEA11244.1|1233811_1234615_-	extragenic suppressor protein SuhB	NA	NA	NA	NA	NA
VEA11245.1|1234733_1235465_+	RNA methyltransferase	NA	NA	NA	NA	NA
VEA11246.1|1235659_1236154_+	Iron-sulfur cluster regulator IscR	NA	NA	NA	NA	NA
VEA11247.1|1236334_1237549_+	L-cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
VEA11248.1|1237576_1237963_+	NifU-like protein	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
VEA11249.1|1237991_1238315_+	Iron binding protein IscA for iron-sulfur cluster assembly	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
VEA11250.1|1238510_1239026_+	chaperone protein HscB	NA	NA	NA	NA	NA
VEA11251.1|1239038_1239389_+	chaperone protein HscA	NA	A0A2K9L0P4	Tupanvirus	40.0	2.2e-05
VEA11252.1|1239385_1239739_+	chaperone protein HscA	NA	F2Y0P3	Organic_Lake_phycodnavirus	55.7	5.1e-26
VEA11253.1|1239713_1240079_+	chaperone protein HscA	NA	F2Y0P3	Organic_Lake_phycodnavirus	26.3	8.8e-05
VEA11254.1|1240133_1240892_+	chaperone protein HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	45.9	1.1e-33
VEA11255.1|1240893_1241229_+	ferredoxin	NA	NA	NA	NA	NA
VEA11256.1|1241240_1241441_+	FeS assembly protein IscX	NA	NA	NA	NA	NA
VEA11257.1|1241494_1242778_+	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.2e-35
>prophage 4
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	1627159	1636331	4600697	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
VEA11632.1|1627159_1628107_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
VEA11633.1|1628090_1628708_+	putative permease transmembrane component	NA	NA	NA	NA	NA
VEA11634.1|1628803_1628911_-	membrane protein	NA	NA	NA	NA	NA
VEA11635.1|1628970_1629702_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
VEA11636.1|1629822_1631610_+	putative sensor kinase	NA	B6DZC2	Enterobacteria_phage	91.0	1.1e-281
VEA11637.1|1631606_1632326_+	two-component system response regulator	NA	NA	NA	NA	NA
VEA11638.1|1632372_1632840_+	Protein of uncharacterised function (DUF1456)	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
VEA11639.1|1633055_1633427_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	38.1	1.9e-10
VEA11640.1|1633598_1634057_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
VEA11641.1|1634297_1636331_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	1706145	1713282	4600697		Enterobacteria_phage(33.33%)	7	NA	NA
VEA11704.1|1706145_1707039_+	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
VEA11705.1|1707415_1708501_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
VEA11706.1|1708500_1709400_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	3.9e-30
VEA11707.1|1709447_1710326_+	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	64.5	1.1e-106
VEA11708.1|1710330_1710864_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.2	4.1e-51
VEA11709.1|1710887_1712147_+	Putative O-antigen transporter	NA	NA	NA	NA	NA
VEA11710.1|1712196_1713282_+	UDP-N-acetyl-D-glucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	28.9	4.9e-27
>prophage 6
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	2121714	2128650	4600697	transposase	Escherichia_phage(50.0%)	7	NA	NA
VEA12116.1|2121714_2122929_-	dimethyl sulfoxide reductase subunit	NA	A0A077SK59	Escherichia_phage	33.5	1.2e-21
VEA12117.1|2122930_2123548_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
VEA12118.1|2123558_2125988_-	dimethyl sulfoxide reductase subunit	NA	A0A077SK27	Escherichia_phage	47.0	7.5e-201
VEA12119.1|2126347_2126572_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VEA12120.1|2126809_2127088_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	92.5	2.6e-33
VEA12121.1|2127144_2127957_+|transposase	transposase IS3	transposase	U5P429	Shigella_phage	92.2	3.9e-146
VEA12122.1|2127975_2128650_+	3-ketoacyl-ACP reductase	NA	A0A0M4JSW6	Mollivirus	33.6	2.7e-07
>prophage 7
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	2313710	2323384	4600697		Escherichia_phage(66.67%)	10	NA	NA
VEA12300.1|2313710_2314925_-	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.7	3.4e-45
VEA12301.1|2315046_2315382_-	UPF0060 membrane protein CKO_01576	NA	A0A218MNG8	uncultured_virus	51.4	1.0e-23
VEA12302.1|2315525_2315867_+	putative secreted protein	NA	NA	NA	NA	NA
VEA12303.1|2315902_2316463_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VEA12304.1|2316503_2317181_-	lipoprotein	NA	NA	NA	NA	NA
VEA12305.1|2317320_2317626_+	outer membrane protein	NA	NA	NA	NA	NA
VEA12306.1|2317782_2320221_+	dimethyl sulfoxide reductase, subunit A1	NA	A0A077SK27	Escherichia_phage	49.8	7.3e-220
VEA12307.1|2320346_2321528_+	dimethyl sulfoxide reductase subunit	NA	A0A077SK27	Escherichia_phage	50.3	5.1e-94
VEA12308.1|2321505_2322756_+	dimethyl sulfoxide reductase subunit	NA	A0A077SK27	Escherichia_phage	45.6	6.8e-97
VEA12309.1|2322766_2323384_+	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.6e-75
>prophage 8
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	3205337	3246966	4600697	capsid,head,tail,coat,holin,integrase,terminase,portal	Salmonella_phage(52.38%)	65	3204962:3205008	3246980:3247026
3204962:3205008	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
VEA13205.1|3205337_3205661_+	translocase	NA	I1TED9	Salmonella_phage	95.3	1.5e-51
VEA13206.1|3205657_3206569_+	bactoprenol glucosyl transferase	NA	U5P087	Shigella_phage	91.7	4.1e-160
VEA13207.1|3206595_3208101_+	GtrC	NA	A8CG94	Salmonella_phage	26.0	5.1e-30
VEA13208.1|3208156_3210019_-|tail	Bifunctional tail protein Includes: Tailspike-protein; TSP; Includes: RecName: Full=Endorhamnosidase;Endo-1,3-alpha-L-rhamnosidase	tail	A0A088CQ58	Enterobacteria_phage	84.9	1.2e-60
VEA13209.1|3210154_3210409_+	regulatory protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
VEA13210.1|3210448_3211306_-	prophage antirepressor	NA	H6WRU9	Salmonella_phage	66.1	1.5e-79
VEA13211.1|3211305_3211770_-	bacteriophage protein	NA	H6WRU8	Salmonella_phage	78.6	1.8e-63
VEA13212.1|3211760_3212027_-	bacteriophage protein	NA	H6WRU8	Salmonella_phage	75.4	1.7e-18
VEA13213.1|3212016_3212178_-	Uncharacterised protein	NA	A0A077KAX5	Edwardsiella_phage	96.2	7.7e-22
VEA13214.1|3212286_3212601_+	regulatory protein	NA	H6WRU6	Salmonella_phage	64.4	8.0e-31
VEA13215.1|3212657_3213152_+	Uncharacterised protein	NA	A8CGD7	Salmonella_phage	100.0	3.8e-83
VEA13216.1|3213174_3215004_-	TPA: injection protein	NA	A0A192Y934	Salmonella_phage	99.3	0.0e+00
VEA13217.1|3215003_3216374_-	DNA transfer protein	NA	A0A1R3Y5Q4	Salmonella_virus	96.7	1.4e-241
VEA13218.1|3216383_3217073_-	DNA transfer protein gp7	NA	B9UDK9	Salmonella_phage	92.1	1.2e-92
VEA13219.1|3217075_3217531_-|capsid	Phage capsid and scaffold protein	capsid	A0A1R3Y5P3	Salmonella_virus	100.0	1.8e-87
VEA13220.1|3217530_3218232_-|head	head completion protein	head	A0A192Y6T9	Salmonella_phage	97.0	1.7e-73
VEA13221.1|3218235_3219654_-	DNA stabilization protein	NA	I1TEJ1	Salmonella_phage	98.1	1.4e-271
VEA13222.1|3219613_3220114_-	Gp4	NA	Q76H19	Enterobacteria_phage	98.8	5.5e-90
VEA13223.1|3220097_3220307_-	Phage protein	NA	A0A192Y697	Salmonella_phage	98.6	6.3e-32
VEA13224.1|3220345_3221638_-|coat	coat protein	coat	A0A075B8L2	Enterobacteria_phage	99.3	1.2e-242
VEA13225.1|3221637_3222549_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	1.1e-160
VEA13226.1|3222562_3224740_-|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	99.4	0.0e+00
VEA13227.1|3224739_3226239_-|terminase	putative terminase large subunit	terminase	A0A1R3Y5N2	Salmonella_virus	99.6	2.4e-306
VEA13228.1|3226216_3226705_-|terminase	terminase small subunit	terminase	O80290	Bacteriophage	100.0	2.9e-88
VEA13229.1|3226728_3226908_-	Uncharacterised protein	NA	Q9AZ02	Salmonella_phage	93.2	1.0e-22
VEA13230.1|3226909_3227308_-	Orf80	NA	A5VW77	Enterobacteria_phage	98.8	2.1e-36
VEA13231.1|3227288_3227435_-	Terminase small subunit	NA	I6PDJ6	Cronobacter_phage	85.3	1.7e-07
VEA13232.1|3227679_3228204_-	antirepressor	NA	G8C7W4	Escherichia_phage	72.8	4.3e-69
VEA13233.1|3228473_3228659_-	Lipoprotein Rz1 precursor	NA	G8C7N6	Escherichia_phage	98.4	4.3e-24
VEA13234.1|3228854_3229292_-	phage lysozyme	NA	Q5G8R3	Enterobacteria_phage	98.6	2.8e-74
VEA13235.1|3229275_3229602_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
VEA13236.1|3229722_3230010_-	epsilon34 gp6	NA	M1E3N9	Enterobacteria_phage	96.4	7.1e-26
VEA13237.1|3230045_3230810_-	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	100.0	1.0e-143
VEA13238.1|3230806_3230986_-	protein Niprotein NZ	NA	A0A0M4QWY9	Salmonella_phage	98.3	2.7e-23
VEA13239.1|3230966_3231170_-	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	98.5	2.7e-32
VEA13240.1|3231166_3231775_-	protein ninG	NA	I6S604	Salmonella_phage	95.0	6.4e-93
VEA13241.1|3231749_3231929_-	NinF family protein	NA	I6R994	Salmonella_phage	96.6	3.6e-28
VEA13242.1|3232238_3232676_-	ninB protein	NA	C6ZR55	Salmonella_phage	98.6	4.2e-78
VEA13243.1|3232753_3234634_-	gp61	NA	Q5G8S8	Enterobacteria_phage	98.6	0.0e+00
VEA13244.1|3234630_3234738_-	Uncharacterised protein	NA	Q5G8S9	Enterobacteria_phage	91.2	5.3e-11
VEA13245.1|3234741_3235590_-	replication protein O	NA	C6ZR51	Salmonella_phage	94.7	1.0e-149
VEA13246.1|3235576_3235738_-	prophage protein	NA	Q5G8T1	Enterobacteria_phage	90.6	1.0e-18
VEA13247.1|3235772_3236054_-	regulatory protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
VEA13248.1|3236544_3237180_+	repressor protein cI	NA	Q76H56	Enterobacteria_phage	100.0	6.7e-117
VEA13249.1|3237211_3237448_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA13250.1|3237538_3237784_+	Uncharacterised protein	NA	NA	NA	NA	NA
VEA13251.1|3237822_3238032_-	prophage protein	NA	I6R0R9	Salmonella_phage	92.8	1.9e-28
VEA13252.1|3238395_3238698_+	antitermination protein	NA	I6S5Z3	Salmonella_phage	95.0	4.5e-47
VEA13253.1|3238776_3239361_+	effector protein PipB	NA	I6S1T3	Salmonella_phage	91.5	3.8e-42
VEA13254.1|3239360_3239591_+	Uncharacterised protein	NA	A0A1B0VMC0	Pseudomonas_phage	46.8	2.8e-09
VEA13255.1|3239798_3239945_+	regulatory protein	NA	E7C9Q3	Salmonella_phage	100.0	1.3e-20
VEA13256.1|3239937_3240051_+	Bacteriophage lambda Kil protein	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
VEA13257.1|3240244_3240952_+	recombinase	NA	E7C9Q0	Salmonella_phage	97.4	2.1e-135
VEA13258.1|3240951_3241236_+	anti-RecBCD	NA	E7C9P9	Salmonella_phage	95.7	2.8e-43
VEA13259.1|3241282_3241576_+	anti-RecBCD protein 2	NA	A0A0N7CAQ6	Salmonella_phage	95.9	8.8e-48
VEA13260.1|3241586_3241874_+	gp83	NA	Q5G8U4	Enterobacteria_phage	96.8	3.4e-44
VEA13261.1|3241870_3242041_+	prophage protein	NA	Q5G8U5	Enterobacteria_phage	98.2	1.3e-24
VEA13262.1|3242028_3242628_+	Eae protein	NA	Q5G8U6	Enterobacteria_phage	41.4	2.0e-14
VEA13263.1|3242624_3242870_+	Uncharacterised protein	NA	A0A1V0E5L1	Salmonella_phage	93.7	7.1e-35
VEA13264.1|3242866_3243421_+	conserved hypothetical bacteriophage protein	NA	C6ZR30	Salmonella_phage	57.4	8.9e-41
VEA13265.1|3243404_3243878_+	Uncharacterised protein	NA	A0A075B8E3	Enterobacteria_phage	95.3	1.5e-25
VEA13266.1|3243881_3244583_+	Eaa protein	NA	A0A0M4RTV1	Salmonella_phage	54.1	9.8e-53
VEA13267.1|3244579_3245017_+	prophage protein	NA	C6ZR26	Salmonella_phage	41.3	1.9e-30
VEA13268.1|3245093_3245360_+	Uncharacterised protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
VEA13269.1|3245802_3246966_+|integrase	prophage DLP12 integrase	integrase	A0A0M4R586	Salmonella_phage	96.6	8.5e-219
3246980:3247026	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 9
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	3296347	3355666	4600697	tRNA,protease,transposase	Bacillus_phage(23.08%)	53	NA	NA
VEA13322.1|3296347_3297265_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VEA13323.1|3297261_3297714_+|protease	Putative activity regulator of membraneprotease YbbK	protease	NA	NA	NA	NA
VEA13324.1|3297714_3298119_-	copper efflux regulator	NA	NA	NA	NA	NA
VEA13325.1|3298241_3300743_+	Lead cadmium zinc and mercury transporting ATPase	NA	A0A218MNH6	uncultured_virus	37.4	1.8e-112
VEA13326.1|3300895_3301732_+	Secreted protein	NA	NA	NA	NA	NA
VEA13327.1|3302804_3303284_+|tRNA	Cys-tRNA(Pro) deacylase YbaK	tRNA	NA	NA	NA	NA
VEA13328.1|3303400_3305053_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
VEA13329.1|3305225_3306446_+	fosmidomycin resistance protein	NA	NA	NA	NA	NA
VEA13330.1|3306660_3308337_+	transport protein	NA	NA	NA	NA	NA
VEA13331.1|3308459_3309764_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
VEA13332.1|3309916_3310888_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	6.6e-15
VEA13333.1|3310884_3311847_-	ferrochelatase	NA	NA	NA	NA	NA
VEA13334.1|3312075_3312720_-	adenylate kinase	NA	NA	NA	NA	NA
VEA13335.1|3312961_3313696_-	chaperone protein HtpG	NA	NA	NA	NA	NA
VEA13336.1|3313643_3314837_-	chaperone protein HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	39.8	1.1e-75
VEA13337.1|3314947_3315553_-	recombination protein RecR	NA	NA	NA	NA	NA
VEA13338.1|3315552_3315882_-	DNA-binding protein, YbaB/EbfC family	NA	NA	NA	NA	NA
VEA13339.1|3317969_3318521_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	4.6e-29
VEA13340.1|3318673_3319051_-	Inner membrane protein YbaN	NA	NA	NA	NA	NA
VEA13341.1|3319131_3319647_+	Primosomal replication protein N prime prime	NA	NA	NA	NA	NA
VEA13342.1|3319660_3319828_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VEA13343.1|3319897_3320353_+	Transposase_31	NA	Q2A0A7	Sodalis_phage	53.5	7.5e-38
VEA13344.1|3320454_3320946_+|transposase	Putative transposase	transposase	Q2A0A7	Sodalis_phage	48.0	3.6e-17
VEA13345.1|3320987_3323258_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEA13346.1|3323254_3324046_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VEA13347.1|3324021_3325119_-	potential acrAB operon repressor	NA	NA	NA	NA	NA
VEA13348.1|3325260_3326454_+	acriflavin resistance protein A	NA	NA	NA	NA	NA
VEA13349.1|3326476_3329626_+	acriflavin resistance protein B	NA	NA	NA	NA	NA
VEA13350.1|3330121_3330496_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
VEA13351.1|3330523_3330742_+	hemolysin expression modulating protein	NA	NA	NA	NA	NA
VEA13352.1|3330920_3331472_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
VEA13353.1|3331589_3332060_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VEA13354.1|3332262_3332523_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
VEA13355.1|3332747_3334298_+	Uncharacterized protein ylaB	NA	NA	NA	NA	NA
VEA13356.1|3334606_3334918_+	methylated-DNA-[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
VEA13357.1|3334950_3335520_-	lipoprotein	NA	NA	NA	NA	NA
VEA13358.1|3335734_3336595_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
VEA13359.1|3336694_3337981_-	ammonium transporter	NA	NA	NA	NA	NA
VEA13360.1|3338012_3338351_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
VEA13361.1|3338563_3340345_-	Multidrug resistance-like ATP-binding protein mdlB	NA	W8CYL7	Bacillus_phage	26.9	4.1e-39
VEA13362.1|3340337_3342110_-	ABC transporter ATP-binding membrane protein	NA	W8CYL7	Bacillus_phage	29.8	6.1e-51
VEA13363.1|3342150_3342609_-	transcriptional regulator	NA	NA	NA	NA	NA
VEA13364.1|3342721_3343777_+	lyase	NA	NA	NA	NA	NA
VEA13365.1|3343825_3344644_-	HMP-PP phosphatase	NA	NA	NA	NA	NA
VEA13366.1|3344744_3346445_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VEA13367.1|3346509_3347205_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.2e-87
VEA13368.1|3347310_3347709_-	4-hydroxybenzoyl-CoA thio esterase family activesite	NA	NA	NA	NA	NA
VEA13369.1|3347812_3348187_-	competence protein ComEA	NA	NA	NA	NA	NA
VEA13370.1|3348336_3350208_-	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VEA13371.1|3350498_3350771_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
VEA13372.1|3350979_3353334_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.5	1.6e-224
VEA13373.1|3353519_3354791_-|protease	ATP-dependent clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
VEA13374.1|3355042_3355666_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 10
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	3470782	3477901	4600697	transposase,integrase	Shigella_phage(33.33%)	7	3472971:3472984	3485025:3485038
VEA13490.1|3470782_3471013_-|transposase	transposase IS3	transposase	U5P429	Shigella_phage	90.8	9.7e-34
VEA13491.1|3471301_3471919_-|transposase	transposase IS3	transposase	U5P429	Shigella_phage	84.5	1.8e-42
VEA13492.1|3471979_3472891_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3472971:3472984	attL	AATAGTGATAAAAT	NA	NA	NA	NA
VEA13493.1|3473205_3473859_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	57.5	1.2e-63
VEA13494.1|3474201_3475452_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	4.7e-98
VEA13495.1|3475463_3476567_-	Glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
VEA13496.1|3476848_3477901_+	outer membrane phosphoporin protein E	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3485025:3485038	attR	AATAGTGATAAAAT	NA	NA	NA	NA
>prophage 11
LR134143	Salmonella enterica subsp. enterica strain NCTC7411 genome assembly, chromosome: 1	4600697	4511319	4517436	4600697		Enterobacteria_phage(50.0%)	7	NA	NA
VEA14456.1|4511319_4512450_-	UDP-4-amino-4-deoxy-L-arabinose- oxoglutarateaminotransferase UDP-(beta-L-threo-pentapyranosyl-4''-ulose diphosphate) aminotransferase; UDP-Ara4O aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
VEA14457.1|4512454_4513132_-	TDP-D-fucosamine acetyltransferase	NA	NA	NA	NA	NA
VEA14458.1|4513109_4513697_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.1	9.4e-57
VEA14459.1|4513641_4513992_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	75.9	3.5e-43
VEA14460.1|4514024_4515092_-	UDP-N-acetylglucosamine epimerase	NA	I7HTA3	Enterobacteria_phage	52.8	4.0e-98
VEA14461.1|4515091_4516354_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	26.8	1.2e-24
VEA14462.1|4516350_4517436_-	UDP-N-acetyl-D-glucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	31.9	1.1e-26
