The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	173506	184441	4839172		Escherichia_phage(75.0%)	15	NA	NA
VDZ94160.1|173506_174721_-	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	5.3e-46
VDZ94161.1|174842_175178_-	UPF0060 membrane protein CKO_01576	NA	A0A218MNG8	uncultured_virus	52.4	1.3e-23
VDZ94162.1|175320_175662_+	putative secreted protein	NA	NA	NA	NA	NA
VDZ94163.1|175697_176258_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VDZ94164.1|176298_176976_-	lipoprotein	NA	NA	NA	NA	NA
VDZ94165.1|177115_177217_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ94166.1|177173_177422_+	outer membrane protein	NA	NA	NA	NA	NA
VDZ94167.1|177578_179399_+	dimethyl sulfoxide reductase, subunit A1	NA	A0A077SK27	Escherichia_phage	49.8	9.7e-161
VDZ94168.1|179385_180018_+	dimethyl sulfoxide reductase, subunit A1	NA	A0A077SK27	Escherichia_phage	50.2	3.7e-51
VDZ94169.1|180175_181099_+	dimethyl sulfoxide reductase subunit	NA	A0A077SK27	Escherichia_phage	43.9	4.0e-54
VDZ94170.1|181338_181551_+	dimethyl sulfoxide reductase subunit	NA	NA	NA	NA	NA
VDZ94171.1|181615_182557_+	dimethyl sulfoxide reductase subunit	NA	A0A077SK27	Escherichia_phage	45.7	1.1e-70
VDZ94172.1|182567_183185_+	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	4.3e-76
VDZ94173.1|183186_184044_+	dimethyl sulfoxide reductase subunit H	NA	NA	NA	NA	NA
VDZ94174.1|184087_184441_+	Anaerobic dimethyl sulfoxide reductasechaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.8	7.2e-12
>prophage 2
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	589818	667372	4839172	tRNA,holin,head,terminase,protease,capsid,transposase,tail	Salmonella_phage(47.06%)	109	NA	NA
VDZ94726.1|589818_590148_+|tRNA	tRNA 2-thiouridine synthesizing protein E	tRNA	NA	NA	NA	NA
VDZ94727.1|590144_590426_-	acylphosphatase	NA	NA	NA	NA	NA
VDZ94728.1|590474_590840_-	Bacterial regulatory protein, AraC	NA	NA	NA	NA	NA
VDZ94729.1|590811_591264_-	transcriptional regulator	NA	NA	NA	NA	NA
VDZ94730.1|591280_591784_-	kinase inhibitor	NA	NA	NA	NA	NA
VDZ94731.1|592044_592491_+	LSU m5C1962 methyl transferase RlmI	NA	NA	NA	NA	NA
VDZ94732.1|592564_593257_+	LSU m5C1962 methyl transferase RlmI	NA	NA	NA	NA	NA
VDZ94733.1|593314_593632_+	hemimethylated DNA binding protein YccV	NA	NA	NA	NA	NA
VDZ94734.1|593676_594090_-	Succinyl-CoA synthetase alpha subunit-related enzyme	NA	NA	NA	NA	NA
VDZ94735.1|594263_594995_+	UPF0319 protein YccT precursor	NA	NA	NA	NA	NA
VDZ94736.1|595019_595478_+	methylglyoxal synthase	NA	NA	NA	NA	NA
VDZ94737.1|595513_596560_-	helicase IV	NA	A7KV33	Bacillus_phage	25.5	2.0e-09
VDZ94738.1|596546_597029_-	helicase IV	NA	NA	NA	NA	NA
VDZ94739.1|597048_597570_-	helicase IV	NA	NA	NA	NA	NA
VDZ94740.1|597694_597856_+	Inner membrane protein YccF	NA	NA	NA	NA	NA
VDZ94741.1|598498_598771_+	Putative efflux (PET) family inner membrane protein YccS	NA	NA	NA	NA	NA
VDZ94742.1|598909_600322_+	Putative efflux (PET) family inner membrane protein YccS	NA	NA	NA	NA	NA
VDZ94743.1|600308_600542_-	DNA transformation protein	NA	NA	NA	NA	NA
VDZ94744.1|600510_600915_-	DNA transformation protein TfoX	NA	NA	NA	NA	NA
VDZ94745.1|601131_601641_+	cell division inhibitor	NA	NA	NA	NA	NA
VDZ94746.1|601997_603050_+	outer membrane protein A	NA	NA	NA	NA	NA
VDZ94747.1|603121_603574_-	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
VDZ94748.1|603759_604650_+|protease	protease	protease	NA	NA	NA	NA
VDZ94749.1|604705_605521_+|protease	protease	protease	NA	NA	NA	NA
VDZ94750.1|605589_606108_+	3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase	NA	NA	NA	NA	NA
VDZ94751.1|606630_607194_-	lipoprotein	NA	NA	NA	NA	NA
VDZ94752.1|607190_608831_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
VDZ94753.1|608835_610089_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
VDZ94754.1|610103_612011_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
VDZ94755.1|612023_614132_-	23S rRNA (guanine-N-2-) -methyl transferase rlmL	NA	NA	NA	NA	NA
VDZ94756.1|614231_614552_+	Flavodoxin reductases (ferredoxin-NADPHreductases) family 1	NA	NA	NA	NA	NA
VDZ94757.1|614490_615342_+	Flavodoxin reductases (ferredoxin-NADPHreductases) family 1	NA	NA	NA	NA	NA
VDZ94758.1|615338_615881_-	Z-ring-associated protein C	NA	NA	NA	NA	NA
VDZ94759.1|616046_617057_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
VDZ94760.1|617264_619877_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
VDZ94761.1|620303_620495_+	Gifsy-2 prophage MsgA	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
VDZ94762.1|620765_621452_+	gifsy-2 prophage protein	NA	NA	NA	NA	NA
VDZ94763.1|621494_621743_+	hypothetical phage protein (pseudogene)	NA	NA	NA	NA	NA
VDZ94764.1|621811_622438_+	Uncharacterised ACR, COG2135	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	64.8	2.4e-66
VDZ94765.1|622569_622842_-|transposase	transposase (remnant)	transposase	A0A0P0ZBS5	Stx2-converting_phage	62.8	3.4e-09
VDZ94766.1|622952_623579_-	Fis family transcriptional regulator	NA	Q9MBL9	Phage_Gifsy-2	99.0	2.1e-110
VDZ94767.1|623538_623880_-	Fis family transcriptional regulator	NA	Q9MBL9	Phage_Gifsy-2	97.3	2.1e-61
VDZ94768.1|623974_624358_+|tail	phage tail-fiber asembly protein	tail	A0A1B0VCD0	Salmonella_phage	63.4	5.1e-19
VDZ94769.1|624500_624731_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ94770.1|625002_625521_-|tail	bacteriophage tail protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
VDZ94771.1|628267_628510_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ94772.1|628548_631155_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	67.8	8.7e-288
VDZ94773.1|632222_632693_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	67.0	2.6e-33
VDZ94774.1|632804_633320_-|tail	phage tail protein	tail	Q687F0	Enterobacteria_phage	73.5	3.0e-59
VDZ94775.1|633339_634035_-|tail	tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
VDZ94776.1|634124_634658_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
VDZ94777.1|634774_635272_-	attachment/invasion protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
VDZ94778.1|635370_635703_-|tail	tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
VDZ94779.1|635699_636311_-	gifsy-1 prophage VmtH	NA	A5LH38	Enterobacteria_phage	58.0	1.7e-53
VDZ94780.1|636298_636850_-	gifsy-1 prophage VmtH	NA	A5LH38	Enterobacteria_phage	59.0	6.5e-44
VDZ94781.1|636833_637322_-	gifsy-1 prophage VmtH	NA	A5LH38	Enterobacteria_phage	79.2	2.5e-15
VDZ94782.1|637318_638794_-	gifsy-1 prophage VmtH	NA	E4WL33	Enterobacteria_phage	54.4	2.6e-132
VDZ94783.1|638777_639038_-|tail	minor tail-like protein	tail	A5LH37	Enterobacteria_phage	55.3	1.7e-18
VDZ94784.1|639100_639319_-|tail	minor tail protein	tail	A5LH36	Enterobacteria_phage	56.9	2.0e-12
VDZ94785.1|639308_639491_-|tail	minor tail protein	tail	A5LH36	Enterobacteria_phage	61.5	5.5e-08
VDZ94786.1|639539_640292_-|tail	major tail protein	tail	A5LH35	Enterobacteria_phage	70.0	1.9e-94
VDZ94787.1|640304_640706_-|tail	phage minor tail protein U	tail	A0A291AWY2	Escherichia_phage	59.8	8.1e-44
VDZ94788.1|640705_641305_-|tail	prophage minor tail protein Z	tail	A0A291AWZ0	Escherichia_phage	68.7	8.3e-69
VDZ94789.1|641314_641671_-|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.8e-31
VDZ94790.1|641681_642056_-	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	34.9	4.8e-06
VDZ94791.1|642119_643148_-|capsid	phage major capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	58.4	2.4e-108
VDZ94792.1|643202_643550_-	Head decoration protein	NA	A0A2R9YJN3	Escherichia_phage	52.7	4.6e-19
VDZ94793.1|643549_645064_-|head,tail	Gifsy-1 prophage head-tail preconnector gp5	head,tail	A0A0K2FI53	Enterobacteria_phage	51.8	2.1e-100
VDZ94794.1|645053_646640_-|head,tail	Gifsy-1 prophage head-tail preconnector gp4	head,tail	K7P6U7	Enterobacteria_phage	60.5	3.2e-184
VDZ94795.1|646636_646840_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	80.0	1.0e-18
VDZ94796.1|646823_647408_-|terminase	phage terminase large subunit	terminase	A0A2I6TC92	Escherichia_phage	60.6	2.5e-49
VDZ94797.1|647349_647583_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	69.7	8.9e-27
VDZ94798.1|647632_648760_-|terminase	phage terminase large subunit	terminase	E4WL19	Enterobacteria_phage	71.0	1.7e-160
VDZ94799.1|648731_649277_-|terminase	terminase	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
VDZ94800.1|649745_650213_-	putative endopeptidase	NA	A0A0M4RD57	Salmonella_phage	90.2	7.7e-70
VDZ94801.1|650209_650509_-	Lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	9.9e-47
VDZ94802.1|650531_650663_-	Lysozyme	NA	A0A0M4R365	Salmonella_phage	100.0	7.2e-10
VDZ94803.1|650646_650982_-|holin	bacteriophage holin	holin	A0A0M3ULK9	Salmonella_phage	100.0	4.1e-57
VDZ94804.1|651464_651938_+	GogA	NA	Q9MBM0	Phage_Gifsy-2	100.0	9.1e-87
VDZ94805.1|651944_652082_-|holin	holin	holin	NA	NA	NA	NA
VDZ94806.1|652299_652665_+	Gifsy-2 prophage protein	NA	NA	NA	NA	NA
VDZ94807.1|652886_653012_-	Gifsy-2 prophage protein	NA	NA	NA	NA	NA
VDZ94808.1|653185_653404_-	Gifsy-2 prophage protein	NA	NA	NA	NA	NA
VDZ94809.1|653570_654368_-	molecular chaperone	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
VDZ94810.1|654357_654504_-	prophage protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
VDZ94811.1|654500_655112_-	bacteriophage Lambda NinG protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
VDZ94812.1|655114_655321_-	Phage protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
VDZ94813.1|655320_655923_-	bacteriophage protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
VDZ94814.1|656338_656572_-	Gifsy-1 prophage DinI	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
VDZ94815.1|656863_657133_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ94816.1|657231_657543_-	prophage protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
VDZ94817.1|657539_657887_-	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
VDZ94818.1|657897_658647_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
VDZ94819.1|658649_659549_-	regulatory protein	NA	H6WRX7	Salmonella_phage	100.0	4.5e-159
VDZ94820.1|659526_659628_-	prophage protein replication Protein O	NA	S4TNJ9	Salmonella_phage	96.4	2.1e-09
VDZ94821.1|659718_659925_-	CI-like protein	NA	H6WRX6	Salmonella_phage	100.0	4.0e-31
VDZ94822.1|660058_660298_-	phage regulatory protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
VDZ94823.1|660418_660829_+	regulatory protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
VDZ94824.1|661133_661292_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
VDZ94825.1|661376_661664_+	Gifsy-1 prophage protein	NA	H6WRX2	Salmonella_phage	98.9	8.6e-48
VDZ94826.1|661794_662283_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	100.0	7.8e-73
VDZ94827.1|662242_662602_+	Exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	96.3	7.0e-55
VDZ94828.1|662690_663239_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	98.4	6.6e-97
VDZ94829.1|663216_663462_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	97.4	2.0e-13
VDZ94830.1|663514_664555_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	93.4	8.6e-138
VDZ94831.1|664583_664727_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	100.0	3.8e-20
VDZ94832.1|664737_665847_+	Gifsy-2 prophage RecT	NA	H6WRX0	Salmonella_phage	100.0	7.1e-207
VDZ94833.1|666465_666957_+	Integrase	NA	S4TSP2	Salmonella_phage	98.1	2.0e-84
VDZ94834.1|667108_667372_+	Integrase	NA	S4TSP2	Salmonella_phage	100.0	4.7e-32
>prophage 3
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	717667	727528	4839172	tRNA	Escherichia_phage(42.86%)	9	NA	NA
VDZ94897.1|717667_718285_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
VDZ94898.1|718295_719942_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	51.3	9.7e-160
VDZ94899.1|720043_720742_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.3e-46
VDZ94900.1|720979_721840_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.6	5.0e-83
VDZ94901.1|721805_722273_-|tRNA	seryl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ94902.1|722531_723875_-	Holliday junction DNA helicase	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
VDZ94903.1|723884_724496_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VDZ94904.1|724638_725019_-	DNA translocase ftsK	NA	J7I0T4	Pseudomonas_phage	48.8	1.6e-12
VDZ94905.1|724957_727528_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	51.3	5.7e-82
>prophage 4
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	739971	746250	4839172	protease	Planktothrix_phage(33.33%)	6	NA	NA
VDZ94918.1|739971_742248_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
VDZ94919.1|742278_742599_-|protease	ATP-dependent clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
VDZ94920.1|742922_743144_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
VDZ94921.1|743273_744929_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	47.6	1.9e-22
VDZ94922.1|744916_745219_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	38.2	2.3e-06
VDZ94923.1|745215_746250_-	Macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.3e-08
>prophage 5
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	1147703	1184644	4839172	tRNA,transposase,protease	uncultured_virus(28.57%)	49	NA	NA
VDZ95446.1|1147703_1148798_+|tRNA	tRNA 2-selenouridine synthase	tRNA	NA	NA	NA	NA
VDZ95447.1|1148836_1149496_-	methionine ABC transporter permease	NA	NA	NA	NA	NA
VDZ95448.1|1149488_1149668_-	Methionine import ATP-binding protein MetN 2	NA	NA	NA	NA	NA
VDZ95449.1|1149618_1150059_-	Methionine import ATP-binding protein MetN 2	NA	NA	NA	NA	NA
VDZ95450.1|1150187_1150508_-	Methionine import ATP-binding protein MetN 2	NA	NA	NA	NA	NA
VDZ95451.1|1150544_1150763_-	methionine ABC transporter ATPase	NA	NA	NA	NA	NA
VDZ95452.1|1150999_1151251_-	methionine ABC transporter ATPase	NA	NA	NA	NA	NA
VDZ95453.1|1151638_1152601_-	membrane protein	NA	NA	NA	NA	NA
VDZ95454.1|1152597_1152771_-	membrane protein	NA	NA	NA	NA	NA
VDZ95455.1|1152855_1152960_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ95456.1|1152956_1154792_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
VDZ95457.1|1154778_1155141_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
VDZ95458.1|1155166_1155373_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
VDZ95459.1|1155634_1156057_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VDZ95460.1|1156323_1156644_+	acyl-CoA thioesterase I	NA	NA	NA	NA	NA
VDZ95461.1|1156798_1157569_+	Putative NAD(P)-dependent oxidoreductase EC-YbbO	NA	NA	NA	NA	NA
VDZ95462.1|1157628_1158483_+	Thioredoxin domain-containing protein EC-YbbN	NA	NA	NA	NA	NA
VDZ95463.1|1158569_1158752_-	YbbM seven transmembrane helix protein	NA	NA	NA	NA	NA
VDZ95464.1|1159125_1159353_-	YbbM seven transmembrane helix protein	NA	NA	NA	NA	NA
VDZ95465.1|1159339_1160017_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	5.1e-22
VDZ95466.1|1160163_1160397_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VDZ95467.1|1160380_1160668_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VDZ95468.1|1160676_1160916_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VDZ95469.1|1160924_1161080_+|protease	Putative stomatin/prohibitin-family membraneprotease subunit YbbK	protease	NA	NA	NA	NA
VDZ95470.1|1161076_1161529_+|protease	Putative activity regulator of membraneprotease YbbK	protease	NA	NA	NA	NA
VDZ95471.1|1161529_1161871_-	copper efflux regulator	NA	NA	NA	NA	NA
VDZ95472.1|1162057_1163836_+	Lead cadmium zinc and mercury transporting ATPase	NA	A0A218MNH6	uncultured_virus	36.1	1.6e-70
VDZ95473.1|1163774_1164560_+	Lead cadmium zinc and mercury transporting ATPase	NA	A0A218MNH6	uncultured_virus	40.2	3.0e-34
VDZ95474.1|1164713_1165541_+	Secreted protein	NA	NA	NA	NA	NA
VDZ95475.1|1166622_1167102_+|tRNA	Cys-tRNA(Pro) deacylase YbaK	tRNA	NA	NA	NA	NA
VDZ95476.1|1167218_1168871_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
VDZ95477.1|1169043_1170264_+	fosmidomycin resistance protein	NA	NA	NA	NA	NA
VDZ95478.1|1170275_1170401_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ95479.1|1170478_1170940_+	transport protein	NA	NA	NA	NA	NA
VDZ95480.1|1170957_1172154_+	transport protein	NA	NA	NA	NA	NA
VDZ95481.1|1172276_1173434_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
VDZ95482.1|1173732_1174704_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	6.6e-15
VDZ95483.1|1174700_1174907_-	ferrochelatase	NA	NA	NA	NA	NA
VDZ95484.1|1174933_1175257_-	ferrochelatase	NA	NA	NA	NA	NA
VDZ95485.1|1175360_1175660_-	ferrochelatase	NA	NA	NA	NA	NA
VDZ95486.1|1175888_1176533_-	adenylate kinase	NA	NA	NA	NA	NA
VDZ95487.1|1176773_1178648_-	chaperone protein HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	1.7e-115
VDZ95488.1|1178758_1179364_-	recombination protein RecR	NA	NA	NA	NA	NA
VDZ95489.1|1179363_1179693_-	DNA-binding protein, YbaB/EbfC family	NA	NA	NA	NA	NA
VDZ95490.1|1181780_1182332_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
VDZ95491.1|1182484_1182862_-	Inner membrane protein YbaN	NA	NA	NA	NA	NA
VDZ95492.1|1182942_1183458_+	Primosomal replication protein N prime prime	NA	NA	NA	NA	NA
VDZ95493.1|1183471_1183639_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VDZ95494.1|1183708_1184644_+|transposase	ISNCY transposase	transposase	Q2A0A7	Sodalis_phage	52.1	5.7e-64
>prophage 6
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	1834595	1842862	4839172	capsid	Enterobacteria_phage(66.67%)	12	NA	NA
VDZ96271.1|1834595_1836245_-	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.3	1.5e-261
VDZ96272.1|1836259_1836580_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ96273.1|1836576_1836804_-	bacteriophage protein	NA	NA	NA	NA	NA
VDZ96274.1|1836800_1836995_-	CI repressor	NA	Q7M2A7	Enterobacteria_phage	83.9	1.2e-21
VDZ96275.1|1837406_1837616_-	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	67.2	2.4e-15
VDZ96276.1|1838156_1839041_+|capsid	putative phage capsid protein	capsid	NA	NA	NA	NA
VDZ96277.1|1839159_1839726_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
VDZ96278.1|1839972_1840068_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ96279.1|1840319_1841108_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ96280.1|1841116_1841572_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ96281.1|1841594_1842344_-	Integrase	NA	B7SYF8	Stenotrophomonas_phage	41.6	7.1e-41
VDZ96282.1|1842418_1842862_-	Integrase	NA	E5AGD0	Erwinia_phage	43.6	2.7e-16
>prophage 7
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	1879449	1882704	4839172		Vibrio_phage(42.86%)	7	NA	NA
VDZ96321.1|1879449_1880016_+	Anaerobic ribonucleoside-triphosphate reductase	NA	A0A2H4YEI7	Aeromonas_phage	49.0	2.5e-30
VDZ96322.1|1879963_1880257_+	Anaerobic ribonucleoside-triphosphate reductase	NA	A0A2H4YEI7	Aeromonas_phage	69.8	1.1e-29
VDZ96323.1|1880210_1880390_+	Anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	97.1	1.1e-11
VDZ96324.1|1880428_1880941_+	Anaerobic ribonucleoside-triphosphate reductase	NA	Q76Z50	Aeromonas_virus	64.7	4.6e-60
VDZ96325.1|1880897_1881107_+	Anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	68.1	2.0e-17
VDZ96326.1|1881658_1882183_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2D0YLR2	Vibrio_phage	55.4	6.6e-46
VDZ96327.1|1882461_1882704_-	bifunctional antitoxin/transcriptional repressor RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
>prophage 8
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	2006027	2010434	4839172		Escherichia_phage(100.0%)	6	NA	NA
VDZ96479.1|2006027_2006522_-	Twin-arginine leader-binding protein DmsD	NA	A0A077SLS7	Escherichia_phage	72.4	9.6e-63
VDZ96480.1|2006596_2007370_-	dimethyl sulfoxide reductase subunit C	NA	A0A077SK59	Escherichia_phage	79.5	3.9e-103
VDZ96481.1|2007362_2007989_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	92.3	2.9e-120
VDZ96482.1|2008002_2008776_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	80.9	6.9e-124
VDZ96483.1|2008780_2009065_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	82.6	8.0e-38
VDZ96484.1|2009030_2010434_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	81.2	1.5e-217
>prophage 9
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	2097342	2136187	4839172	plate,tRNA,tail	Burkholderia_phage(50.0%)	52	NA	NA
VDZ96567.1|2097342_2098341_-|tRNA	tRNA dihydrouridine synthase A	tRNA	NA	NA	NA	NA
VDZ96568.1|2098490_2098784_-	conjugative transfer protein	NA	NA	NA	NA	NA
VDZ96569.1|2098843_2099137_-	conjugative transfer protein	NA	NA	NA	NA	NA
VDZ96570.1|2099174_2099738_-	conjugative transfer protein	NA	NA	NA	NA	NA
VDZ96571.1|2099984_2100500_+	zinc uptake regulation protein	NA	NA	NA	NA	NA
VDZ96572.1|2100941_2101448_-	DNA-damage-inducible membrane protein	NA	NA	NA	NA	NA
VDZ96573.1|2101638_2102271_-	DNA-damage-inducible membrane protein	NA	NA	NA	NA	NA
VDZ96574.1|2102449_2103058_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
VDZ96575.1|2103166_2103535_-	diacylglycerol kinase	NA	NA	NA	NA	NA
VDZ96576.1|2103705_2106126_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VDZ96577.1|2106224_2107097_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
VDZ96578.1|2107216_2107507_-	chorismate lyase	NA	NA	NA	NA	NA
VDZ96579.1|2108108_2108627_-	maltose operon periplasmic protein	NA	NA	NA	NA	NA
VDZ96580.1|2108878_2110237_-	maltoporin	NA	NA	NA	NA	NA
VDZ96581.1|2110325_2111435_-	maltose/maltodextrin transport ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
VDZ96582.1|2111797_2111929_+	maltose ABC transporter periplasmic protein	NA	NA	NA	NA	NA
VDZ96583.1|2111979_2112210_+	maltose ABC transporter periplasmic protein	NA	NA	NA	NA	NA
VDZ96584.1|2112319_2112664_+	maltose ABC transporter periplasmic protein	NA	NA	NA	NA	NA
VDZ96585.1|2112839_2112992_+	maltose ABC transporter periplasmic protein	NA	NA	NA	NA	NA
VDZ96586.1|2113123_2113306_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDZ96587.1|2113256_2113487_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDZ96588.1|2113717_2114068_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDZ96589.1|2114024_2114165_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDZ96590.1|2114172_2114673_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDZ96591.1|2114687_2114834_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDZ96592.1|2114884_2115577_+	maltose transport inner membrane protein	NA	NA	NA	NA	NA
VDZ96593.1|2115742_2116153_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
VDZ96594.1|2116295_2118368_-	lipoprotein	NA	NA	NA	NA	NA
VDZ96595.1|2118392_2119130_-	putative lipoprotein	NA	NA	NA	NA	NA
VDZ96596.1|2119126_2119765_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
VDZ96597.1|2119828_2120074_-	YjbE secreted protein	NA	NA	NA	NA	NA
VDZ96598.1|2120514_2121633_-	Glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
VDZ96599.1|2121616_2122165_-	Glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
VDZ96600.1|2122509_2123856_+	lysine-sensitive aspartokinase III	NA	NA	NA	NA	NA
VDZ96601.1|2123990_2124338_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
VDZ96602.1|2124913_2125201_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
VDZ96603.1|2125236_2125569_+	lytic murein transglycosylase	NA	J9SH25	Pseudomonas_phage	57.9	4.8e-26
VDZ96604.1|2125579_2125810_+	lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	67.1	1.7e-22
VDZ96605.1|2125822_2126137_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
VDZ96606.1|2126296_2126752_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDZ96607.1|2126748_2126946_+	gp12	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
VDZ96608.1|2126935_2128363_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
VDZ96609.1|2128362_2128887_+|tail	tail protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
VDZ96610.1|2128938_2129256_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ96611.1|2129440_2130718_+|tail	tail protein	tail	NA	NA	NA	NA
VDZ96612.1|2130680_2132192_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	6.4e-49
VDZ96613.1|2132172_2132295_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ96614.1|2132355_2132715_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
VDZ96615.1|2132705_2133821_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	6.9e-101
VDZ96616.1|2133813_2134446_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
VDZ96617.1|2134448_2135909_+	gp19	NA	A0A0M3ULH6	Salmonella_phage	38.8	1.2e-76
VDZ96618.1|2135911_2136187_+|tail	Phage tail fiber	tail	A0A0E3JQ06	Enterobacteria_phage	43.8	1.9e-15
>prophage 10
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	2285588	2316261	4839172	holin,head,integrase,plate,capsid,lysis,tail,portal	Salmonella_phage(53.33%)	49	2285381:2285427	2316377:2316423
2285381:2285427	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
VDZ96793.1|2285588_2286062_+	Uncharacterised protein	NA	S4TTB4	Salmonella_phage	52.7	2.2e-32
VDZ96794.1|2286040_2286259_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
VDZ96795.1|2286336_2287506_-	phage late control gene D	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
VDZ96796.1|2287502_2287715_-	gp25	NA	A0A0M4RCP0	Salmonella_phage	94.2	1.9e-28
VDZ96797.1|2287737_2287989_-	gp25	NA	S4TUC3	Salmonella_phage	92.4	4.3e-35
VDZ96798.1|2288000_2290442_-	gp24	NA	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
VDZ96799.1|2290586_2290922_-|tail	phage tail protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
VDZ96800.1|2290984_2291503_-|tail	major tail sheath protein FII	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
VDZ96801.1|2291518_2292706_-|tail	bacteriophage major tail sheath protein FI	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
VDZ96802.1|2293409_2294207_-	gp19	NA	E5G6P0	Salmonella_phage	95.1	3.6e-120
VDZ96803.1|2294277_2295153_-	gp19	NA	A0A0M3ULF6	Salmonella_phage	99.0	1.3e-110
VDZ96804.1|2295163_2295424_-|tail	orf38; p2 I-like tail protein	tail	A0A0M4R4W9	Salmonella_phage	98.8	1.2e-45
VDZ96805.1|2295515_2295695_-|tail	orf38; p2 I-like tail protein	tail	A0A0M4R4W9	Salmonella_phage	100.0	4.9e-25
VDZ96806.1|2295687_2296245_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.5	1.7e-95
VDZ96807.1|2296301_2296598_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	96.9	8.6e-43
VDZ96808.1|2296695_2296953_-|plate	baseplate assembly protein	plate	S4TRW8	Salmonella_phage	97.1	2.5e-30
VDZ96809.1|2296949_2297591_-|plate	baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
VDZ96810.1|2297667_2297985_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ96811.1|2298266_2298617_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ96812.1|2298760_2298907_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ96813.1|2299129_2299525_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	74.6	5.9e-39
VDZ96814.1|2299517_2299985_-|tail	P2 phage tail completion protein R	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
VDZ96815.1|2300092_2300506_-|lysis	phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
VDZ96816.1|2300502_2301012_-	glycoside hydrolase	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
VDZ96817.1|2300995_2301217_-|holin	prophage Hp1 family holin	holin	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
VDZ96818.1|2301207_2301411_-	phage Tail Protein X	NA	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
VDZ96819.1|2301537_2301912_-|head	phage head completion protein	head	A0A0F7LDJ1	Escherichia_phage	61.9	2.6e-36
VDZ96820.1|2302009_2302768_-	gpM	NA	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
VDZ96821.1|2302771_2303932_-|capsid	phage major capsid protein P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
VDZ96822.1|2303963_2304827_-|capsid	phage capsid scaffolding protein GpO	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
VDZ96823.1|2304992_2306762_+	Terminase, ATPase subunit	NA	Q9T0R3	Escherichia_phage	81.0	3.2e-286
VDZ96824.1|2306761_2307640_+|portal	phage portal protein pbsx family	portal	Q6K1J0	Salmonella_virus	78.9	2.2e-134
VDZ96825.1|2307629_2307800_+|portal	phage portal protein pbsx family	portal	S4TNX7	Salmonella_phage	69.6	1.4e-16
VDZ96826.1|2308201_2308303_-	Uncharacterised protein	NA	A0A0M4RE72	Salmonella_phage	87.9	3.6e-09
VDZ96827.1|2308505_2308940_+	Uncharacterised protein	NA	S4TUD6	Salmonella_phage	99.3	4.8e-74
VDZ96828.1|2309073_2309706_+	Fic protein family	NA	S4TP71	Salmonella_phage	100.0	2.1e-115
VDZ96829.1|2310111_2310309_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ96830.1|2310487_2311891_-	replication gene A protein	NA	S4TTC1	Salmonella_phage	92.7	1.9e-257
VDZ96831.1|2311868_2312372_-	replication gene A protein	NA	U5N0W3	Enterobacteria_phage	81.5	6.1e-73
VDZ96832.1|2312844_2313027_-	gp83	NA	S4TP00	Salmonella_phage	83.3	2.3e-22
VDZ96833.1|2313023_2313248_-	C4-type zinc finger protein, DksA/TraR family	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
VDZ96834.1|2313379_2313550_-	11.3 kDa protein in GpA 5'region	NA	Q7Y4C1	Escherichia_virus	65.9	2.8e-06
VDZ96835.1|2313549_2313774_-	8.3 kDa protein in GpA 5'region	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
VDZ96836.1|2313837_2314224_-	Replication protein (GpB)	NA	A0A0F7LBQ6	Escherichia_phage	96.1	1.5e-66
VDZ96837.1|2314220_2314337_-	Replication protein (GpB)	NA	U5N0V9	Enterobacteria_phage	71.4	2.0e-08
VDZ96838.1|2314506_2314779_-	Cox protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
VDZ96839.1|2314915_2315209_+	phage repressor protein c	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
VDZ96840.1|2315278_2315983_+|integrase	Puataive integrase	integrase	S4TP66	Salmonella_phage	91.9	5.3e-115
VDZ96841.1|2316018_2316261_+|integrase	Puataive integrase	integrase	S4TP66	Salmonella_phage	94.9	1.7e-36
2316377:2316423	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
>prophage 11
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	3496112	3503794	4839172		Escherichia_phage(83.33%)	14	NA	NA
VDZ98296.1|3496112_3497105_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
VDZ98297.1|3497149_3497386_-	Hydroxyaromatic non-oxidative decarboxylaseprotein D	NA	NA	NA	NA	NA
VDZ98298.1|3497396_3497720_-	Hydroxyaromatic non-oxidative decarboxylaseprotein B, Hydroxyaromatic non-oxidatived ecarboxylase protein C	NA	NA	NA	NA	NA
VDZ98299.1|3497670_3498084_-	Hydroxyaromatic non-oxidative decarboxylaseprotein B, Hydroxyaromatic non-oxidatived ecarboxylase protein C	NA	NA	NA	NA	NA
VDZ98300.1|3498064_3498748_-	Hydroxyaromatic non-oxidative decarboxylaseprotein B, Hydroxyaromatic non-oxidatived ecarboxylase protein C	NA	NA	NA	NA	NA
VDZ98301.1|3498827_3499004_-	decarboxylase	NA	NA	NA	NA	NA
VDZ98302.1|3498945_3499404_-	decarboxylase	NA	NA	NA	NA	NA
VDZ98303.1|3499593_3499734_+	Transcriptional regulator hosA	NA	NA	NA	NA	NA
VDZ98304.1|3499711_3499999_+	Transcriptional regulator hosA	NA	NA	NA	NA	NA
VDZ98305.1|3500087_3500783_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	61.1	2.6e-66
VDZ98306.1|3500979_3501603_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	69.4	3.4e-49
VDZ98307.1|3501563_3501809_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	86.5	1.8e-30
VDZ98308.1|3501896_3503159_+	membrane protein	NA	A0A077SLJ7	Escherichia_phage	61.5	3.3e-131
VDZ98309.1|3503155_3503794_+	sugar aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.8e-85
>prophage 12
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	3587916	3595292	4839172	tRNA	Pseudomonas_phage(14.29%)	10	NA	NA
VDZ98417.1|3587916_3588414_+	competence damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	51.0	7.5e-31
VDZ98418.1|3588498_3589071_+	recombinase A	NA	A0A0S2MVG1	Bacillus_phage	68.1	6.5e-63
VDZ98419.1|3589091_3589562_+	recombinase A	NA	A0A2D1GPX2	Mycobacterium_phage	64.6	1.5e-41
VDZ98420.1|3589682_3590399_+	Regulatory protein recX	NA	NA	NA	NA	NA
VDZ98421.1|3590617_3591328_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	39.1	9.0e-38
VDZ98422.1|3591311_3591851_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A2K9L3D8	Tupanvirus	29.5	2.2e-12
VDZ98423.1|3591837_3592515_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ98424.1|3592529_3593051_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ98425.1|3593285_3593471_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
VDZ98426.1|3594758_3595292_+	Phosphatase YqaB	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	26.6	1.1e-11
>prophage 13
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	3607421	3612202	4839172		Bacillus_phage(28.57%)	7	NA	NA
VDZ98439.1|3607421_3608339_-	glycine betaine/L-proline transport ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	1.1e-27
VDZ98440.1|3608693_3609239_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	A0A0N7CCA3	Skermania_phage	71.8	4.0e-70
VDZ98441.1|3609297_3609903_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	73.3	4.7e-43
VDZ98442.1|3610075_3610369_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	R4JDX9	Bacillus_phage	49.3	1.2e-12
VDZ98443.1|3610434_3610776_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A0A1W6JK74	Lactococcus_phage	57.5	2.9e-18
VDZ98444.1|3610835_3611792_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A0A2H4P8B4	Corynebacterium_phage	60.6	1.1e-99
VDZ98445.1|3611791_3612202_-	ribonucleotide reductase stimulatory protein	NA	A0A142F1R4	Bacillus_phage	41.8	3.3e-16
>prophage 14
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	3648966	3809612	4839172	tRNA,holin,head,integrase,terminase,capsid,plate,tail,portal	Salmonella_phage(57.75%)	200	3736253:3736270	3775870:3775887
VDZ98492.1|3648966_3649533_-	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	6.7e-68
VDZ98493.1|3649624_3651145_+	flagellin	NA	NA	NA	NA	NA
VDZ98494.1|3651281_3651578_+	repressor	NA	NA	NA	NA	NA
VDZ98495.1|3652442_3653345_-	Uncharacterised protein	NA	E5G6K9	Salmonella_phage	100.0	2.6e-175
VDZ98496.1|3653370_3653649_-	Uncharacterised protein	NA	E5G6K9	Salmonella_phage	100.0	4.7e-43
VDZ98497.1|3653742_3654627_-|integrase	phage integrase	integrase	E5G6L0	Salmonella_phage	97.0	4.6e-148
VDZ98498.1|3654681_3655314_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
VDZ98499.1|3655433_3655649_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98500.1|3655712_3656222_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
VDZ98501.1|3656229_3656430_+	bacteriophage protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
VDZ98502.1|3656393_3656735_+	Uncharacterised protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
VDZ98503.1|3656802_3657036_+	putative 8.8 kDa protein in GpA 5'region	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
VDZ98504.1|3657035_3657263_+	C4-type zinc finger protein, DksA/TraR family	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
VDZ98505.1|3657259_3657808_+	retron adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	8.7e-97
VDZ98506.1|3657782_3658118_+	retron adenine methylase	NA	E5G6L8	Salmonella_phage	99.1	2.8e-58
VDZ98507.1|3658114_3660529_+	possible endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
VDZ98508.1|3660681_3660870_+	bacteriophage protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
VDZ98509.1|3660880_3661114_+	prophage protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
VDZ98510.1|3661173_3661905_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98511.1|3662218_3663883_+	Abortive phage infection protein AIPR	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
VDZ98512.1|3663986_3665027_-|portal	portal vertex-like protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
VDZ98513.1|3665026_3666745_-|terminase	terminase, ATPase subunit	terminase	E5G6M4	Salmonella_phage	100.0	0.0e+00
VDZ98514.1|3666937_3667771_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
VDZ98515.1|3667787_3668849_+|capsid	major capsid-like protein	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
VDZ98516.1|3669027_3669504_+|terminase	terminase, endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.4	4.7e-83
VDZ98517.1|3669598_3669763_+|head	phage head completion protein	head	E5G6M8	Salmonella_phage	100.0	3.2e-15
VDZ98518.1|3669716_3670064_+|capsid	putative capsid completion protein	capsid	E5G6M8	Salmonella_phage	99.1	1.7e-61
VDZ98519.1|3670063_3670267_+|tail	phage tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
VDZ98520.1|3670270_3670471_+|holin	holin family protein	holin	E5G6N0	Salmonella_phage	100.0	8.1e-29
VDZ98521.1|3670467_3671049_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	3.1e-84
VDZ98522.1|3670999_3671407_+	regulatory protein	NA	E5G6N2	Salmonella_phage	99.3	8.5e-65
VDZ98523.1|3671348_3671933_+|tail	tail fiber protein	tail	E5G6N3	Salmonella_phage	100.0	6.4e-74
VDZ98524.1|3671925_3672372_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
VDZ98525.1|3672373_3673225_-	Uncharacterised protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
VDZ98526.1|3673302_3673680_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	2.6e-68
VDZ98527.1|3673673_3673880_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	3.8e-29
VDZ98528.1|3673876_3674236_+|plate	phage baseplate assembly protein W	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
VDZ98529.1|3674222_3674585_+|plate	phage baseplate assembly protein J	plate	E5G6N8	Salmonella_phage	100.0	2.5e-52
VDZ98530.1|3674584_3675133_+|plate	phage baseplate assembly protein J	plate	E5G6N8	Salmonella_phage	100.0	2.5e-88
VDZ98531.1|3675125_3675731_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
VDZ98532.1|3675727_3677581_+	gp19	NA	E5G6P0	Salmonella_phage	100.0	0.0e+00
VDZ98533.1|3679025_3679250_+	DNA invertase-like protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
VDZ98534.1|3679352_3680525_+|tail	major tail sheath protein	tail	E5G6P7	Salmonella_phage	99.7	3.4e-223
VDZ98535.1|3680534_3681050_+|tail	phage major tail tube protein FII	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
VDZ98536.1|3681153_3681408_+|tail	phage tail protein E	tail	E5G6P9	Salmonella_phage	100.0	7.9e-37
VDZ98537.1|3681534_3681948_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	3.1e-38
VDZ98538.1|3681913_3682168_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
VDZ98539.1|3682181_3683141_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	1.3e-164
VDZ98540.1|3683185_3683593_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	95.0	2.0e-45
VDZ98541.1|3683546_3684347_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.6	4.7e-144
VDZ98542.1|3684343_3684829_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
VDZ98543.1|3684825_3685926_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
VDZ98544.1|3686764_3687385_-	Putative HlyD family secretion protein	NA	NA	NA	NA	NA
VDZ98545.1|3687443_3687929_-	Putative HlyD family secretion protein	NA	NA	NA	NA	NA
VDZ98546.1|3687868_3690118_-	type I secretion protein, ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.0e-18
VDZ98547.1|3691588_3695365_-	Large repetitive protein	NA	NA	NA	NA	NA
VDZ98548.1|3695327_3703064_-	large repetitive protein	NA	NA	NA	NA	NA
VDZ98549.1|3703677_3704205_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	4.4e-29
VDZ98550.1|3704348_3704726_+	Ribosome association toxin RatA	NA	NA	NA	NA	NA
VDZ98551.1|3704774_3705065_+	UPF0125 protein yfjF	NA	NA	NA	NA	NA
VDZ98552.1|3705231_3705570_-	small protein A	NA	NA	NA	NA	NA
VDZ98553.1|3705718_3707380_-	DNA repair protein	NA	NA	NA	NA	NA
VDZ98554.1|3707465_3708140_-	NAD kinase	NA	NA	NA	NA	NA
VDZ98555.1|3708084_3708345_-	NAD kinase	NA	NA	NA	NA	NA
VDZ98556.1|3708621_3709074_+	heat shock protein GrpE	NA	NA	NA	NA	NA
VDZ98557.1|3709207_3709708_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98558.1|3709828_3710494_-	corB transporter	NA	NA	NA	NA	NA
VDZ98559.1|3710671_3710803_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98560.1|3711142_3711427_-	cytochrome c-type biogenesis heme exporter protein C	NA	NA	NA	NA	NA
VDZ98561.1|3711446_3711737_-	cytochrome c-type biogenesis heme exporter protein C	NA	NA	NA	NA	NA
VDZ98562.1|3711675_3711936_-	cytochrome c-type biogenesis heme exporter protein C	NA	NA	NA	NA	NA
VDZ98563.1|3712101_3713463_+	signal recognition particle protein	NA	NA	NA	NA	NA
VDZ98564.1|3713715_3714018_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
VDZ98565.1|3713983_3714532_+	Ribosome maturation factor rimM	NA	NA	NA	NA	NA
VDZ98566.1|3714576_3715344_+|tRNA	tRNA(guanine-N1)methyltransferase	tRNA	NA	NA	NA	NA
VDZ98567.1|3715384_3715732_+	50S ribosomal subunit protein L19	NA	NA	NA	NA	NA
VDZ98568.1|3716171_3716576_-	phage late control gene D	NA	Q6K1G4	Salmonella_virus	93.9	8.7e-62
VDZ98569.1|3716661_3717138_-	phage late control gene D	NA	A0A218M4J7	Erwinia_phage	97.4	2.4e-79
VDZ98570.1|3717205_3717343_-	phage late control gene D	NA	A0A0M5M5V5	Salmonella_phage	97.8	7.0e-16
VDZ98571.1|3717339_3717609_-	gp25	NA	A0A0M4RCP0	Salmonella_phage	93.2	1.1e-39
VDZ98572.1|3717692_3717827_-	gp25	NA	S4TUC3	Salmonella_phage	97.4	1.3e-14
VDZ98573.1|3717840_3719322_-	gp24	NA	A0A0M3UL85	Salmonella_phage	81.3	2.6e-204
VDZ98574.1|3719350_3719725_-	gp24	NA	A0A218M4J5	Erwinia_phage	98.3	2.1e-46
VDZ98575.1|3719750_3720284_-	Laminin subunit beta-2 S-laminin; Laminin chain B3; Flags: Precursor	NA	S4TP64	Salmonella_phage	100.0	6.3e-36
VDZ98576.1|3720428_3720764_-|tail	phage tail protein	tail	A0A218M4J8	Erwinia_phage	97.3	2.6e-51
VDZ98577.1|3720826_3721345_-|tail	major tail sheath protein FII	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
VDZ98578.1|3721360_3722539_-|tail	bacteriophage major tail sheath protein FI	tail	S4TRX2	Salmonella_phage	99.5	2.9e-222
VDZ98579.1|3723619_3725212_-|tail	phage variable tail-fiber protein	tail	S4TP62	Salmonella_phage	99.6	7.8e-239
VDZ98580.1|3725222_3725753_-|tail	orf38; p2 I-like tail protein	tail	Q6K1H3	Salmonella_virus	97.2	1.5e-101
VDZ98581.1|3725745_3726654_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	98.3	7.7e-159
VDZ98582.1|3726660_3726852_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.4	1.9e-27
VDZ98583.1|3726853_3727009_-|plate	baseplate assembly protein	plate	O80315	Escherichia_phage	96.1	2.0e-19
VDZ98584.1|3727005_3727647_-|tail	phage tail protein	tail	Q6K1H6	Salmonella_virus	96.7	5.5e-111
VDZ98585.1|3727715_3727952_-|tail	tail completion protein S	tail	O80313	Escherichia_phage	94.9	1.1e-35
VDZ98586.1|3728218_3728428_-|tail	tail fiber protein	tail	S4TTA5	Salmonella_phage	98.4	4.2e-28
VDZ98587.1|3728408_3728630_-|tail	tail fiber protein	tail	S4TTA5	Salmonella_phage	100.0	2.8e-30
VDZ98588.1|3729640_3729904_-|holin	phage holin protein	holin	Q6K1I2	Salmonella_virus	98.8	1.2e-35
VDZ98589.1|3729944_3730151_-|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	85.4	4.8e-16
VDZ98590.1|3730150_3730495_-|capsid	capsid completion protein	capsid	S4TNY1	Salmonella_phage	84.0	3.4e-43
VDZ98591.1|3730757_3731024_-|terminase	terminase, endonuclease subunit	terminase	S4TRV8	Salmonella_phage	100.0	4.4e-38
VDZ98592.1|3731001_3731508_-|terminase	terminase, endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	99.4	7.3e-82
VDZ98593.1|3731511_3731988_-|capsid	Phage major capsid protein	capsid	A0A0M4R4W2	Salmonella_phage	99.4	9.5e-84
VDZ98594.1|3732111_3732369_-|capsid	Phage major capsid protein	capsid	S4TUA6	Salmonella_phage	98.8	1.1e-38
VDZ98595.1|3732393_3732582_-|capsid	Phage major capsid protein	capsid	A0A0M4R4W2	Salmonella_phage	100.0	4.3e-24
VDZ98596.1|3732677_3732923_-	phage protein V	NA	S4TP53	Salmonella_phage	84.0	2.8e-23
VDZ98597.1|3733128_3733515_-	phage protein V	NA	S4TP53	Salmonella_phage	100.0	6.4e-62
VDZ98598.1|3733679_3734336_+|terminase	Phage terminase ATPase subunit	terminase	S4TT96	Salmonella_phage	98.2	1.9e-90
VDZ98599.1|3734778_3735390_+|terminase	Phage terminase ATPase subunit	terminase	S4TT96	Salmonella_phage	100.0	3.7e-104
VDZ98600.1|3735448_3735577_+	gp2	NA	A0A218M4L2	Erwinia_phage	96.7	3.5e-09
VDZ98601.1|3736195_3737218_+|portal	phage portal pbsx family protein	portal	Q6K1J0	Salmonella_virus	99.7	1.5e-198
3736253:3736270	attL	ATGGAGGCGTTCACCTTC	NA	NA	NA	NA
VDZ98602.1|3737622_3737724_-	Uncharacterised protein	NA	A0A0M4RE72	Salmonella_phage	100.0	3.8e-11
VDZ98603.1|3737740_3737935_-	Uncharacterised protein	NA	S4TRZ0	Salmonella_phage	79.7	2.0e-19
VDZ98604.1|3738068_3738278_-	Uncharacterised protein	NA	Q6K1F0	Salmonella_virus	97.1	2.6e-33
VDZ98605.1|3738473_3738707_-	DNA-damage-inducible protein DinI	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
VDZ98606.1|3738710_3738893_-	TumA	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
VDZ98607.1|3739440_3741234_-	bacteriophage replication protein	NA	A0A0M3ULG0	Salmonella_phage	95.0	0.0e+00
VDZ98608.1|3741230_3742061_-	prophage protein	NA	A0A0M4RCP6	Salmonella_phage	97.1	7.1e-159
VDZ98609.1|3742064_3742343_-	Orf83	NA	A0A0M4R2Q0	Salmonella_phage	87.0	2.0e-41
VDZ98610.1|3742343_3742565_-	bacteriophage protein	NA	A0A0M4S5Q7	Salmonella_phage	98.6	7.1e-34
VDZ98611.1|3742564_3742792_-	putative 8.8 kDa protein in GpA 5'region	NA	A0A0M3UL87	Salmonella_phage	97.3	9.9e-31
VDZ98612.1|3742861_3743062_-	signal peptide protein	NA	A0A0M5M7U3	Salmonella_phage	97.0	3.0e-31
VDZ98613.1|3743048_3743276_-	bacteriophage protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	1.2e-36
VDZ98614.1|3743283_3743793_-	Regulatory protein CII	NA	Q6K1F8	Salmonella_virus	98.8	9.5e-90
VDZ98615.1|3743843_3744197_-	bacteriophage protein	NA	Q6K1F9	Salmonella_virus	99.1	1.5e-57
VDZ98616.1|3744310_3744724_+	bacteriophage CI repressor	NA	Q6K1G0	Salmonella_virus	58.8	8.7e-33
VDZ98617.1|3744607_3745108_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98618.1|3745153_3745717_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98619.1|3745738_3746788_+|integrase	Phage integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.8	3.7e-189
VDZ98620.1|3747040_3748261_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
VDZ98621.1|3748253_3748772_-	putative periplasmic protein	NA	NA	NA	NA	NA
VDZ98622.1|3749211_3750282_+	Phospho-2-dehydro-3-deoxyheptonate aldolase, Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
VDZ98623.1|3750291_3751413_+	chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
VDZ98624.1|3751470_3751614_+	Putative cytoplasmic protein	NA	NA	NA	NA	NA
VDZ98625.1|3751585_3752380_+	Putative cytoplasmic protein	NA	NA	NA	NA	NA
VDZ98626.1|3752340_3752790_-	chorismate mutase-P/prephenate dehydratase	NA	NA	NA	NA	NA
VDZ98627.1|3753070_3753385_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98628.1|3753812_3754805_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
VDZ98629.1|3754871_3755177_-	putative repressor protein C	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
VDZ98630.1|3755274_3755613_+	bacteriophage regulatory protein	NA	NA	NA	NA	NA
VDZ98631.1|3755638_3755971_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98632.1|3755980_3756550_+	endodeoxyribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
VDZ98633.1|3756552_3756771_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98634.1|3756851_3757316_+	putative phage-like protein	NA	A0A077K8T2	Ralstonia_phage	47.9	6.5e-37
VDZ98635.1|3757282_3757570_+	putative phage-like protein	NA	A0A077K8T2	Ralstonia_phage	45.3	3.4e-12
VDZ98636.1|3757566_3758091_+	putative phage-like protein	NA	A0A2H4JDT6	uncultured_Caudovirales_phage	37.5	3.8e-25
VDZ98637.1|3758219_3759464_+	putative phage-like protein	NA	A0A077K8T2	Ralstonia_phage	49.4	4.4e-112
VDZ98638.1|3759555_3759762_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98639.1|3759815_3760142_-|portal	phage portal protein, pbsx family	portal	F1BUM7	Cronobacter_phage	63.6	4.1e-30
VDZ98640.1|3760132_3760606_-|portal	phage portal protein, pbsx family	portal	F1BUM7	Cronobacter_phage	70.7	1.4e-63
VDZ98641.1|3760830_3762615_-|terminase	Phage terminase ATPase subunit	terminase	F1BUM5	Cronobacter_phage	69.5	1.1e-246
VDZ98642.1|3762672_3763689_+	scaffold protein	NA	F1BUM4	Cronobacter_phage	52.0	4.4e-46
VDZ98643.1|3763700_3764729_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.1	5.5e-137
VDZ98644.1|3764740_3765439_+|terminase	phage terminase small subunit	terminase	F1BUM0	Cronobacter_phage	52.2	1.2e-61
VDZ98645.1|3765457_3765649_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98646.1|3765742_3766195_+|head	phage head completion protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
VDZ98647.1|3766191_3766674_+	putative phage gene	NA	F1BUL7	Cronobacter_phage	48.7	3.0e-37
VDZ98648.1|3766670_3767375_+	phage protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
VDZ98649.1|3767371_3768499_+	Topoisomerase IA	NA	F1BUL5	Cronobacter_phage	83.5	5.6e-175
VDZ98650.1|3768495_3768951_+	phage protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
VDZ98651.1|3768995_3769262_+|holin	phage holin family 2	holin	C7BGD7	Burkholderia_phage	49.3	1.9e-12
VDZ98652.1|3769258_3769600_+	hypothetical phage-related protein	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
VDZ98653.1|3769599_3769932_+	putative phage-related protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
VDZ98654.1|3770078_3770336_+	phage protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
VDZ98655.1|3770523_3772491_+|tail	phage tail tape measure protein, TP901 family, core region	tail	F1BUK9	Cronobacter_phage	70.5	4.7e-270
VDZ98656.1|3772487_3772817_+	phage protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
VDZ98657.1|3772813_3773221_+|plate	Phage baseplate	plate	F1BUK6	Cronobacter_phage	83.3	1.0e-54
VDZ98658.1|3773213_3773636_+|plate	Phage baseplate	plate	F1BUK6	Cronobacter_phage	83.9	1.1e-51
VDZ98659.1|3773601_3774000_+|plate	Phage baseplate	plate	F1BUK6	Cronobacter_phage	65.6	1.6e-47
VDZ98660.1|3773992_3774580_+|tail	Bacteriophage P2-related tail formation protein	tail	F1BUK5	Cronobacter_phage	82.6	3.8e-90
VDZ98661.1|3774589_3776824_+	gp19	NA	Q8HAB4	Salmonella_phage	73.7	7.2e-182
3775870:3775887	attR	ATGGAGGCGTTCACCTTC	NA	NA	NA	NA
VDZ98662.1|3776836_3777391_+	Gp20	NA	S4TUB9	Salmonella_phage	87.8	1.1e-88
VDZ98663.1|3777380_3778106_+	phage protein	NA	F1BUK1	Cronobacter_phage	56.8	2.3e-68
VDZ98664.1|3778077_3778623_+	phage protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
VDZ98665.1|3778622_3780326_+	phage protein	NA	F1BUJ7	Cronobacter_phage	81.1	1.6e-221
VDZ98666.1|3780224_3780710_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98667.1|3781444_3782821_+	chromosome segregation protein	NA	NA	NA	NA	NA
VDZ98668.1|3783054_3783441_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98669.1|3783598_3783937_-	sigma(54) modulation protein	NA	NA	NA	NA	NA
VDZ98670.1|3784208_3784946_-	lipoprotein	NA	NA	NA	NA	NA
VDZ98671.1|3785077_3786058_+	ftsH suppressor protein SfhB	NA	NA	NA	NA	NA
VDZ98672.1|3786054_3786786_+	membrane protein	NA	NA	NA	NA	NA
VDZ98673.1|3786915_3789489_+	protein disaggregation chaperone	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
VDZ98674.1|3795662_3796022_+	Putative cytoplasmic protein	NA	E3SMI8	Prochlorococcus_phage	50.0	7.5e-25
VDZ98675.1|3796125_3796788_+	alpha-ketoglutarate transporter	NA	Q6JIH2	Burkholderia_virus	34.5	1.0e-27
VDZ98676.1|3796744_3797428_+	alpha-ketoglutarate transporter	NA	NA	NA	NA	NA
VDZ98677.1|3797424_3797748_-	lipoprotein	NA	NA	NA	NA	NA
VDZ98678.1|3797791_3799147_-	phosphatidylserine synthase	NA	NA	NA	NA	NA
VDZ98679.1|3799261_3801922_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
VDZ98680.1|3801975_3802656_-	DTW domain-containing protein	NA	NA	NA	NA	NA
VDZ98681.1|3802807_3803149_-	thioredoxin 2	NA	A0A0K2FIM3	Achromobacter_phage	44.3	2.3e-07
VDZ98682.1|3803352_3804390_+|tRNA	tRNA/rRNA methyltransferase YfiF	tRNA	NA	NA	NA	NA
VDZ98683.1|3804505_3804979_-	uracil-DNA glycosylase	NA	U5U481	Elephant_endotheliotropic_herpesvirus	52.9	3.2e-39
VDZ98684.1|3804927_3805197_-	uracil-DNA glycosylase	NA	A0A0N9QWR4	Chrysochromulina_ericina_virus	38.9	8.2e-08
VDZ98685.1|3805515_3805899_+	Pyruvate formate-lyase	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
VDZ98686.1|3805960_3806548_-	Transporter LysE family	NA	NA	NA	NA	NA
VDZ98687.1|3806650_3806989_+	LysR-family transcriptional regulator	NA	NA	NA	NA	NA
VDZ98688.1|3807011_3807380_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDZ98689.1|3807330_3807552_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDZ98690.1|3807569_3808904_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
VDZ98691.1|3809033_3809612_+|tRNA	tRNA (adenine-N(6)-)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 15
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	3814991	3862724	4839172	holin,head,integrase,terminase,transposase,tail,portal	Salmonella_phage(37.93%)	69	3807133:3807146	3830738:3830751
3807133:3807146	attL	AGCAGTCGCTGGCG	NA	NA	NA	NA
VDZ98698.1|3814991_3816398_+|integrase	integrase	integrase	H6WRW7	Salmonella_phage	94.5	5.5e-228
VDZ98699.1|3816524_3816764_-	putative bacteriophage protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
VDZ98700.1|3816806_3817916_-	Gifsy-2 prophage RecT	NA	H6WRX0	Salmonella_phage	99.5	1.8e-205
VDZ98701.1|3817926_3819567_-	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	99.3	3.0e-254
VDZ98702.1|3819529_3820855_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.7	3.1e-241
VDZ98703.1|3820981_3821269_-	Gifsy-1 prophage protein	NA	H6WRX2	Salmonella_phage	98.9	8.6e-48
VDZ98704.1|3821353_3821512_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
VDZ98705.1|3822113_3822632_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ98706.1|3822631_3823018_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ98707.1|3823010_3823850_-	chromosome partitioning ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
VDZ98708.1|3823908_3824304_-	putative regulator	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
VDZ98709.1|3824403_3824646_+	phage regulatory protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
VDZ98710.1|3824659_3825070_+	repressor	NA	A0A0M4RU01	Salmonella_phage	100.0	2.7e-50
VDZ98711.1|3825072_3825792_+	replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	61.5	1.5e-35
VDZ98712.1|3825954_3826323_+	replication protein O of prophage CP-933X	NA	I6PBN0	Cronobacter_phage	60.3	2.8e-35
VDZ98713.1|3826664_3827363_+	Eaa1	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
VDZ98714.1|3827471_3828104_+	putative prophage protein	NA	NA	NA	NA	NA
VDZ98715.1|3828346_3828580_+	Gifsy-1 prophage DinI	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
VDZ98716.1|3828696_3828945_+	phage-like protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
VDZ98717.1|3828979_3829582_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
VDZ98718.1|3829581_3829788_+	Phage protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
VDZ98719.1|3829790_3830402_+	bacteriophage Lambda NinG protein	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
VDZ98720.1|3830398_3830539_+	DNA breaking-rejoining protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
VDZ98721.1|3830535_3831213_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
3830738:3830751	attR	AGCAGTCGCTGGCG	NA	NA	NA	NA
VDZ98722.1|3831772_3832051_+	antirepressor	NA	A0A088CD42	Shigella_phage	62.2	1.8e-05
VDZ98723.1|3832960_3833434_-	GogA	NA	Q9MBM2	Phage_Gifsy-1	100.0	2.4e-87
VDZ98724.1|3833916_3834063_+|holin	bacteriophage holin	holin	A0A0M3ULK9	Salmonella_phage	100.0	1.7e-20
VDZ98725.1|3834236_3834689_+	Lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
VDZ98726.1|3834685_3835159_+	putative endopeptidase	NA	A0A0M4RD57	Salmonella_phage	93.0	3.2e-71
VDZ98727.1|3835394_3835796_-	Inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
VDZ98728.1|3836082_3836628_+|terminase	terminase	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
VDZ98729.1|3836599_3837106_+|terminase	terminase	terminase	O64317	Escherichia_phage	66.7	3.2e-61
VDZ98730.1|3837056_3838532_+|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	65.5	8.6e-192
VDZ98731.1|3838515_3838719_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
VDZ98732.1|3838676_3840296_+|portal	phage portal protein, lambda family	portal	K7P6U7	Enterobacteria_phage	62.8	9.8e-189
VDZ98733.1|3840285_3841083_+	scaffold protein	NA	A0A0K2FI53	Enterobacteria_phage	59.4	2.9e-77
VDZ98734.1|3841075_3841279_+	scaffold protein	NA	NA	NA	NA	NA
VDZ98735.1|3841292_3841784_+	scaffold protein	NA	NA	NA	NA	NA
VDZ98736.1|3841796_3842144_+	Head decoration protein	NA	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
VDZ98737.1|3842198_3843227_+|head	head protein	head	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
VDZ98738.1|3843284_3843644_+	DNA packaging protein	NA	NA	NA	NA	NA
VDZ98739.1|3843654_3844038_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
VDZ98740.1|3844065_3844644_+	Gifsy-1 prophagei VmtZ	NA	A5LH33	Enterobacteria_phage	80.2	3.7e-82
VDZ98741.1|3844692_3845823_-	virulence factor	NA	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
VDZ98742.1|3845931_3846333_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
VDZ98743.1|3846343_3847087_+|tail	putative tail component of prophage	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
VDZ98744.1|3847137_3847533_+|tail	minor tail protein	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
VDZ98745.1|3847553_3847868_+|tail	minor tail-like protein	tail	A5LH37	Enterobacteria_phage	62.9	2.3e-30
VDZ98746.1|3847839_3848688_+|tail	tail protein	tail	A0A291AWX1	Escherichia_phage	58.7	5.5e-42
VDZ98747.1|3848687_3848780_+	Uncharacterised protein	NA	A5LH38	Enterobacteria_phage	82.1	2.2e-05
VDZ98748.1|3848766_3849015_+|tail	tail protein	tail	E4WL33	Enterobacteria_phage	80.0	1.5e-16
VDZ98749.1|3849004_3849649_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98750.1|3849720_3849873_+|tail	tail protein	tail	A5LH38	Enterobacteria_phage	74.0	6.4e-10
VDZ98751.1|3849869_3850346_+|tail	tail protein	tail	A5LH38	Enterobacteria_phage	51.8	2.8e-19
VDZ98752.1|3850480_3851047_+|tail	tail protein	tail	A5LH38	Enterobacteria_phage	51.5	2.4e-17
VDZ98753.1|3851301_3851844_+|tail	Minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	68.1	5.1e-57
VDZ98754.1|3852010_3852748_+	Tail fiber component K	NA	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
VDZ98755.1|3852786_3853128_+|tail	tail protein	tail	A0A291AWV5	Escherichia_phage	74.3	1.5e-38
VDZ98756.1|3853102_3853294_+|tail	tail protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	7.0e-22
VDZ98757.1|3853355_3854792_+|tail	Phage tail fiber protein	tail	A0A2I6TCW5	Escherichia_phage	80.6	3.7e-224
VDZ98758.1|3854752_3855673_+|tail	Phage tail fiber protein	tail	A5LH43	Enterobacteria_phage	74.0	1.6e-111
VDZ98759.1|3855627_3856746_+|tail	Phage tail fiber protein	tail	K7PKJ2	Enterobacteria_phage	81.6	1.1e-87
VDZ98760.1|3856758_3857001_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ98761.1|3857054_3857312_+|tail	side tail fiber protein	tail	Q687E6	Enterobacteria_phage	85.7	2.9e-18
VDZ98762.1|3858101_3858980_+	DNA recombinase-like protein	NA	A0A0U2SH60	Escherichia_phage	76.0	1.0e-43
VDZ98763.1|3859054_3859426_+|tail	side tail fiber protein	tail	E5G6P0	Salmonella_phage	67.5	2.0e-12
VDZ98764.1|3859422_3860247_+	UPF0189 protein LA_4133	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
VDZ98765.1|3861950_3862136_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ98766.1|3862250_3862724_-|transposase	transposase-like protein	transposase	NA	NA	NA	NA
>prophage 16
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	3908363	3918059	4839172		Heterosigma_akashiwo_virus(14.29%)	14	NA	NA
VDZ98820.1|3908363_3908801_-	Uncharacterised protein	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	26.7	8.1e-05
VDZ98821.1|3908945_3909632_-	extragenic suppressor protein SuhB	NA	NA	NA	NA	NA
VDZ98822.1|3909866_3910598_+	RNA methyltransferase	NA	NA	NA	NA	NA
VDZ98823.1|3910757_3911252_+	Iron-sulfur cluster regulator IscR	NA	NA	NA	NA	NA
VDZ98824.1|3911432_3912095_+	L-cysteine desulfurase	NA	A0A1X7C038	Faustovirus	39.5	3.1e-24
VDZ98825.1|3912054_3912621_+	L-cysteine desulfurase	NA	NA	NA	NA	NA
VDZ98826.1|3912674_3913061_+	NifU-like protein	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
VDZ98827.1|3913089_3913413_+	Iron binding protein IscA for iron-sulfur cluster assembly	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
VDZ98828.1|3913608_3914124_+	chaperone protein HscB	NA	NA	NA	NA	NA
VDZ98829.1|3914136_3914532_+	chaperone protein HscA	NA	A0A2K9L0P4	Tupanvirus	36.9	6.8e-11
VDZ98830.1|3914485_3915988_+	chaperone protein HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.7	1.2e-71
VDZ98831.1|3915989_3916319_+	ferredoxin	NA	NA	NA	NA	NA
VDZ98832.1|3916337_3916538_+	FeS assembly protein IscX	NA	NA	NA	NA	NA
VDZ98833.1|3916784_3918059_+	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	40.0	5.4e-33
>prophage 17
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	3979520	3983541	4839172		Prochlorococcus_phage(50.0%)	9	NA	NA
VDZ98900.1|3979520_3979751_-	phosphoribosylglycinamidine myltransferase	NA	E3SNR5	Prochlorococcus_phage	47.1	9.8e-10
VDZ98901.1|3979713_3980049_-	phosphoribosylglycinamidine myltransferase	NA	E3SNR5	Prochlorococcus_phage	43.9	2.7e-08
VDZ98902.1|3979993_3980104_-	phosphoribosylglycinamidine myltransferase	NA	NA	NA	NA	NA
VDZ98903.1|3980103_3980553_-	phosphoribosylaminoimidazole synthetase (AIR synthetase)	NA	A0A0E3FK46	Synechococcus_phage	36.5	1.0e-18
VDZ98904.1|3980536_3981142_-	phosphoribosylaminoimidazole synthetase	NA	Q58MH8	Prochlorococcus_phage	52.2	7.9e-43
VDZ98905.1|3981607_3982165_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
VDZ98906.1|3982271_3982829_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	42.3	5.8e-24
VDZ98907.1|3982825_3983080_+	uracil permease	NA	NA	NA	NA	NA
VDZ98908.1|3983154_3983541_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.0	4.6e-12
>prophage 18
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	4204601	4211805	4839172		Pseudomonas_phage(33.33%)	9	NA	NA
VDZ99186.1|4204601_4205321_+	glycerophosphoryl diester phosphodiesterase periplasmic	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.4e-08
VDZ99187.1|4205274_4205673_+	glycerophosphoryl diester phosphodiesterase periplasmic	NA	NA	NA	NA	NA
VDZ99188.1|4205787_4206666_-	transcriptional regulator	NA	NA	NA	NA	NA
VDZ99189.1|4206800_4207799_+	permease	NA	NA	NA	NA	NA
VDZ99190.1|4208020_4208275_-	ferredoxin	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
VDZ99191.1|4208274_4209405_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
VDZ99192.1|4209517_4209838_-	Ribonucleotide reductase of class Ia (aerobic)alpha subunit	NA	A0A2D1GNB1	Pseudoalteromonas_phage	62.3	2.3e-33
VDZ99193.1|4209824_4210481_-	Ribonucleotide reductase of class Ia (aerobic)alpha subunit	NA	I3UMG3	Colwellia_phage	71.5	2.3e-56
VDZ99194.1|4210440_4211805_-	Ribonucleotide reductase of class Ia (aerobic)alpha subunit	NA	A0A1W5PTL2	Pseudoalteromonas_phage	72.9	1.4e-191
>prophage 19
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	4215535	4222465	4839172		Oenococcus_phage(16.67%)	7	NA	NA
VDZ99200.1|4215535_4216450_+	MR-MLE family protein	NA	Q6A202	Oenococcus_phage	37.9	1.2e-47
VDZ99201.1|4216859_4217303_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	43.7	3.3e-22
VDZ99202.1|4217430_4219038_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	25.6	6.6e-36
VDZ99203.1|4219003_4219501_+	DNA gyrase subunit A	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	33.3	1.0e-16
VDZ99204.1|4219618_4221709_+	sensor protein RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	34.7	8.6e-28
VDZ99205.1|4221654_4221969_+	sensor protein RcsC	NA	NA	NA	NA	NA
VDZ99206.1|4221937_4222465_+	sensor protein RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	2.0e-05
>prophage 20
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	4324967	4334157	4839172	tRNA	Enterobacteria_phage(80.0%)	16	NA	NA
VDZ99345.1|4324967_4325915_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
VDZ99346.1|4325898_4326630_+	putative permease transmembrane component	NA	NA	NA	NA	NA
VDZ99347.1|4326610_4326718_-	membrane protein	NA	NA	NA	NA	NA
VDZ99348.1|4326777_4327020_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	91.2	1.7e-12
VDZ99349.1|4327295_4327433_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	97.6	5.4e-16
VDZ99350.1|4327734_4328232_+	putative sensor kinase	NA	Q9EYF3	Enterobacteria_phage	89.9	9.7e-63
VDZ99351.1|4328269_4329022_+	putative sensor kinase	NA	Q9EYF3	Enterobacteria_phage	97.5	2.9e-127
VDZ99352.1|4329032_4329422_+	putative sensor kinase	NA	Q9EYF3	Enterobacteria_phage	80.6	3.8e-54
VDZ99353.1|4329418_4329670_+	two-component system response regulator	NA	NA	NA	NA	NA
VDZ99354.1|4329795_4330140_+	two-component system response regulator	NA	NA	NA	NA	NA
VDZ99355.1|4330187_4330388_+	Protein of uncharacterised function (DUF1456)	NA	Q9EYF4	Enterobacteria_phage	81.1	2.1e-16
VDZ99356.1|4330450_4330657_+	Protein of uncharacterised function (DUF1456)	NA	Q9EYF4	Enterobacteria_phage	88.2	1.3e-26
VDZ99357.1|4330813_4330945_-	lipoprotein	NA	NA	NA	NA	NA
VDZ99358.1|4331405_4331882_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	77.0	3.9e-45
VDZ99359.1|4332122_4332794_-|tRNA	methionyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ99360.1|4332759_4334157_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	28.5	3.0e-53
>prophage 21
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	4402903	4411500	4839172		Enterobacteria_phage(57.14%)	13	NA	NA
VDZ99450.1|4402903_4403197_+	Colanic acid biosynthesis protein wcaM	NA	A0A291LBB9	Klebsiella_phage	40.9	2.3e-11
VDZ99451.1|4403548_4403734_+	Colanic acid biosynthesis protein wcaM	NA	NA	NA	NA	NA
VDZ99452.1|4403911_4404538_+	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	51.9	9.8e-28
VDZ99453.1|4404486_4404753_+	UTP-glucose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
VDZ99454.1|4405179_4406265_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
VDZ99455.1|4406264_4406534_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
VDZ99456.1|4406517_4407165_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
VDZ99457.1|4407276_4407597_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	2.7e-34
VDZ99458.1|4407656_4408094_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	61.0	2.1e-45
VDZ99459.1|4408097_4408646_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
VDZ99460.1|4408651_4409491_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
VDZ99461.1|4409642_4410416_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
VDZ99462.1|4410420_4411500_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
>prophage 22
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	4509416	4521279	4839172		Burkholderia_phage(44.44%)	15	NA	NA
VDZ99593.1|4509416_4509836_+	umuDC operon protein-like protein	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
VDZ99594.1|4509838_4511107_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
VDZ99595.1|4512233_4513445_-	outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	56.0	1.3e-108
VDZ99596.1|4514094_4514406_+	membrane protein	NA	NA	NA	NA	NA
VDZ99597.1|4514486_4515119_+	metal-dependent phospho hydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	6.6e-08
VDZ99598.1|4515256_4515958_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	61.2	3.7e-36
VDZ99599.1|4515932_4516331_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.7	3.4e-26
VDZ99600.1|4516414_4516690_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	72.1	5.4e-15
VDZ99601.1|4516670_4516832_+	patch repair protein	NA	NA	NA	NA	NA
VDZ99602.1|4516828_4517140_+	patch repair protein	NA	E5E3X5	Burkholderia_phage	48.4	3.1e-19
VDZ99603.1|4517243_4517414_-	inner membrane transporter yedA	NA	NA	NA	NA	NA
VDZ99604.1|4517367_4518051_-	inner membrane transporter yedA	NA	NA	NA	NA	NA
VDZ99605.1|4518395_4519187_+	putative inner membrane protein	NA	NA	NA	NA	NA
VDZ99606.1|4519216_4519402_+	Uncharacterized small protein	NA	NA	NA	NA	NA
VDZ99607.1|4519566_4521279_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
>prophage 23
LR134140	Salmonella enterica subsp. enterica strain NCTC129 genome assembly, chromosome: 1	4839172	4622152	4654098	4839172	transposase,tail,protease,integrase	Enterobacteria_phage(30.0%)	43	4623508:4623523	4638549:4638564
VDZ99762.1|4622152_4622830_-|integrase	phage integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.8	4.5e-63
VDZ99763.1|4622826_4623774_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	66.7	1.3e-55
4623508:4623523	attL	CACTTCTTCTTTTTCA	NA	NA	NA	NA
VDZ99764.1|4623963_4624251_+	lytic enzyme	NA	Q8HA86	Salmonella_phage	92.7	8.1e-38
VDZ99765.1|4624470_4624782_+	Protein gp55	NA	NA	NA	NA	NA
VDZ99766.1|4625038_4625206_-	lytic enzyme	NA	NA	NA	NA	NA
VDZ99767.1|4625514_4625778_+	DNA breaking-rejoining protein	NA	Q9EYD0	Enterobacteria_phage	59.8	9.1e-20
VDZ99768.1|4625932_4626361_+|tail	caudovirales tail fibre assembly protein	tail	A0A0M4QWS3	Salmonella_phage	91.7	2.1e-50
VDZ99769.1|4627445_4627715_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ99770.1|4627935_4628202_+	phage encoded protein PagM	NA	NA	NA	NA	NA
VDZ99771.1|4628383_4628506_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ99772.1|4628954_4629569_-	disulfide bond formation protein	NA	NA	NA	NA	NA
VDZ99773.1|4629578_4629737_-	membrane protein	NA	NA	NA	NA	NA
VDZ99774.1|4629869_4630784_-	drug/metabolite transporter DMT permease	NA	NA	NA	NA	NA
VDZ99775.1|4632078_4632447_-	putative cytoplasmic protein	NA	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
VDZ99776.1|4632570_4633428_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.0	1.2e-20
VDZ99777.1|4633427_4633574_+|transposase	transposase	transposase	NA	NA	NA	NA
VDZ99778.1|4634857_4635004_+	acetyltransferase	NA	NA	NA	NA	NA
VDZ99779.1|4634997_4635309_+	acetyltransferase	NA	NA	NA	NA	NA
VDZ99780.1|4635511_4635976_-	GlcNAc transferase	NA	NA	NA	NA	NA
VDZ99781.1|4635978_4636515_-	lipopolysaccharide 1,2-N-acetylglucosaminetransferase	NA	NA	NA	NA	NA
VDZ99782.1|4637493_4638006_-|integrase	phage integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	49.4	3.5e-39
VDZ99783.1|4638116_4638224_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ99784.1|4638351_4639365_-	O-actetyl transferase protein	NA	NA	NA	NA	NA
4638549:4638564	attR	TGAAAAAGAAGAAGTG	NA	NA	NA	NA
VDZ99785.1|4640061_4640265_-	Outer membrane usher protein papC Flags: Precursor	NA	NA	NA	NA	NA
VDZ99786.1|4641820_4641994_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ99787.1|4642249_4642726_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ99788.1|4643053_4643449_-	protein ycgX	NA	C6ZCX4	Enterobacteria_phage	32.8	7.0e-16
VDZ99789.1|4644132_4644855_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
VDZ99790.1|4645138_4645231_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ99791.1|4645526_4646177_+	Serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
VDZ99792.1|4646195_4646387_-	putative secreted protein	NA	NA	NA	NA	NA
VDZ99793.1|4646497_4646737_-	conserved domain protein	NA	NA	NA	NA	NA
VDZ99794.1|4646851_4648213_-	rRNA (cytosine-C(5)-)-methyltransferase RsmF	NA	NA	NA	NA	NA
VDZ99795.1|4648263_4648989_-	mce-related protein	NA	NA	NA	NA	NA
VDZ99796.1|4648988_4649768_-	mce-related protein	NA	NA	NA	NA	NA
VDZ99797.1|4649827_4650442_-	mce-related protein	NA	NA	NA	NA	NA
VDZ99798.1|4650459_4650711_-	mce-related protein	NA	NA	NA	NA	NA
VDZ99799.1|4650978_4651392_-	Paraquat-inducible protein A	NA	NA	NA	NA	NA
VDZ99800.1|4651661_4651775_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ99801.1|4651774_4652041_-	Paraquat-inducible protein A	NA	NA	NA	NA	NA
VDZ99802.1|4652451_4652778_+	GAF domain-containing protein	NA	NA	NA	NA	NA
VDZ99803.1|4653145_4653580_+	ProP effector	NA	NA	NA	NA	NA
VDZ99804.1|4653705_4654098_+|protease	Tail-specific protease precursor	protease	NA	NA	NA	NA
