The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	529165	553167	4466174	tRNA,protease	Ostreococcus_lucimarinus_virus(20.0%)	30	NA	NA
VDZ76530.1|529165_529414_+|protease	ATP-dependent metalloprotease	protease	NA	NA	NA	NA
VDZ76531.1|529667_530477_+|protease	ATP-dependent metalloprotease	protease	G9E4U6	Ostreococcus_lucimarinus_virus	61.5	3.2e-71
VDZ76532.1|530732_531116_+|protease	ATP-dependent metalloprotease	protease	NA	NA	NA	NA
VDZ76533.1|531219_531882_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.6	6.9e-16
VDZ76534.1|532062_532542_+	PGM/PMM family protein	NA	NA	NA	NA	NA
VDZ76535.1|532591_533401_+	PGM/PMM family protein	NA	NA	NA	NA	NA
VDZ76536.1|533622_533955_+	Protein-export membrane protein secG	NA	NA	NA	NA	NA
VDZ76537.1|534149_534491_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ76538.1|534718_535423_-	argininosuccinate synthase	NA	NA	NA	NA	NA
VDZ76539.1|535376_536132_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.8	6.0e-48
VDZ76540.1|536792_537215_+	ribosome maturation protein RimP	NA	NA	NA	NA	NA
VDZ76541.1|537242_538652_+	L factor	NA	NA	NA	NA	NA
VDZ76542.1|538819_539590_+	protein chain initiation factor 2	NA	NA	NA	NA	NA
VDZ76543.1|539709_540207_+	protein chain initiation factor 2	NA	E3T4N3	Cafeteria_roenbergensis_virus	72.5	8.9e-08
VDZ76544.1|540261_541455_+	protein chain initiation factor 2	NA	NA	NA	NA	NA
VDZ76545.1|541747_542149_+	ribosome-binding factor A	NA	NA	NA	NA	NA
VDZ76546.1|542148_542385_+|tRNA	tRNA pseudouridine 55 synthase	tRNA	NA	NA	NA	NA
VDZ76547.1|542381_543095_+|tRNA	tRNA pseudouridine 55 synthase	tRNA	NA	NA	NA	NA
VDZ76548.1|543578_543722_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
VDZ76549.1|543964_544150_+	Polyribonucleotide nucleotidyl transferase	NA	NA	NA	NA	NA
VDZ76550.1|544218_545406_+	Polyribonucleotide nucleotidyl transferase	NA	NA	NA	NA	NA
VDZ76551.1|545395_546037_+	Polyribonucleotide nucleotidyl transferase	NA	NA	NA	NA	NA
VDZ76552.1|546213_547098_+	Lipoprotein nlpI precursor	NA	NA	NA	NA	NA
VDZ76553.1|547276_549169_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	5.9e-52
VDZ76554.1|549321_550566_+	tryptophan permease	NA	NA	NA	NA	NA
VDZ76555.1|550649_551297_-	monooxygenase	NA	NA	NA	NA	NA
VDZ76556.1|551310_551658_-	monooxygenase	NA	NA	NA	NA	NA
VDZ76557.1|551767_552241_-|protease	putative protease	protease	NA	NA	NA	NA
VDZ76558.1|552204_552594_-|protease	putative protease	protease	NA	NA	NA	NA
VDZ76559.1|552654_553167_-|protease	protease	protease	NA	NA	NA	NA
>prophage 2
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	617794	662415	4466174	terminase,plate,tRNA,capsid,holin,portal,tail,protease,integrase	Salmonella_phage(50.91%)	76	617675:617723	648419:648467
617675:617723	attL	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
VDZ76654.1|617794_618832_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	97.1	1.1e-198
VDZ76655.1|618831_619410_-	repressor protein	NA	A0A218M4J1	Erwinia_phage	63.0	3.5e-64
VDZ76656.1|619540_619804_+	phage regulatory protein CII	NA	A0A218M4I5	Erwinia_phage	89.7	3.3e-38
VDZ76657.1|619835_620345_+	phage regulatory protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	6.2e-89
VDZ76658.1|620352_620580_+	bacteriophage protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
VDZ76659.1|620601_620766_+	signal peptide protein	NA	A0A0M5M7U3	Salmonella_phage	98.1	7.6e-25
VDZ76660.1|620835_620991_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ76661.1|621064_621289_+	bacteriophage protein	NA	Q6K1F5	Salmonella_virus	100.0	6.5e-35
VDZ76662.1|621278_621806_+	bacteriophage-like protein	NA	Q6K1F4	Salmonella_virus	93.0	1.4e-83
VDZ76663.1|622000_622780_+	putative bacteriophage replication protein	NA	Q6K1F3	Salmonella_virus	91.8	5.0e-122
VDZ76664.1|623247_623538_+	bacteriophage replication protein	NA	A0A218M4H2	Erwinia_phage	98.5	5.7e-31
VDZ76665.1|623497_623923_+	bacteriophage replication protein	NA	Q6K1F3	Salmonella_virus	100.0	9.8e-64
VDZ76666.1|624276_624705_+	bacteriophage sos operon Tum protein	NA	A0A218M4I0	Erwinia_phage	93.7	3.9e-60
VDZ76667.1|624800_624968_+	phage protein	NA	A0A218M4H5	Erwinia_phage	98.1	1.0e-21
VDZ76668.1|625011_625533_+	phage protein	NA	Q37850	Escherichia_phage	94.2	1.8e-91
VDZ76669.1|625643_626039_+	phage-like protein	NA	NA	NA	NA	NA
VDZ76670.1|626035_626125_+	phage-like protein	NA	NA	NA	NA	NA
VDZ76671.1|626812_627100_-	phage-like protein	NA	NA	NA	NA	NA
VDZ76672.1|627294_627585_-	phage-like protein	NA	NA	NA	NA	NA
VDZ76673.1|627662_627860_-|portal	phage portal pbsx family protein	portal	S4TNX7	Salmonella_phage	97.7	3.2e-17
VDZ76674.1|627901_628459_-|portal	phage portal pbsx family protein	portal	Q6K1J0	Salmonella_virus	96.6	1.2e-77
VDZ76675.1|628753_629386_-|terminase	Phage terminase ATPase subunit	terminase	S4TT96	Salmonella_phage	80.5	9.0e-90
VDZ76676.1|629749_630490_-|terminase	Phage terminase ATPase subunit	terminase	S4TT96	Salmonella_phage	97.4	5.4e-126
VDZ76677.1|630747_630936_+	phage protein V	NA	S4TP53	Salmonella_phage	100.0	3.4e-21
VDZ76678.1|631043_631514_+	phage protein V	NA	S4TP53	Salmonella_phage	97.9	6.3e-72
VDZ76679.1|631589_632198_+|capsid	major phage capside protein	capsid	O80304	Escherichia_phage	89.1	2.4e-95
VDZ76680.1|632416_632659_+|capsid	major phage capside protein	capsid	A0A0M4R4W2	Salmonella_phage	91.1	1.1e-35
VDZ76681.1|632662_632824_+|terminase	terminase, endonuclease subunit	terminase	A0A218M4L0	Erwinia_phage	95.7	5.4e-15
VDZ76682.1|632780_633413_+|terminase	terminase, endonuclease subunit	terminase	S4TRV8	Salmonella_phage	86.4	4.3e-92
VDZ76683.1|633506_633938_+|capsid	capsid completion protein	capsid	S4TNY1	Salmonella_phage	99.3	1.9e-70
VDZ76684.1|634028_634217_+|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	98.4	1.7e-28
VDZ76685.1|634220_634517_+|holin	phage holin protein	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
VDZ76686.1|634503_634767_+	phage lysozyme gene	NA	S4TUB1	Salmonella_phage	98.6	5.9e-35
VDZ76687.1|634888_635551_+	lysozyme	NA	S4TNY4	Salmonella_phage	89.0	7.1e-37
VDZ76688.1|635513_635981_+|tail	tail fiber protein	tail	S4TTA5	Salmonella_phage	99.4	2.5e-84
VDZ76689.1|635973_636423_+|tail	tail completion protein S	tail	A0A0M3UL83	Salmonella_phage	99.3	2.5e-73
VDZ76690.1|636491_637133_+|tail	phage tail protein	tail	Q6K1H6	Salmonella_virus	84.5	3.3e-95
VDZ76691.1|637129_637477_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
VDZ76692.1|637483_637888_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	87.3	8.5e-41
VDZ76693.1|637833_638010_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	100.0	8.2e-25
VDZ76694.1|638047_638251_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	98.4	5.9e-27
VDZ76695.1|639067_640909_+|tail	phage variable tail-fiber protein	tail	S4TP62	Salmonella_phage	98.7	1.5e-294
VDZ76696.1|640921_641470_+	gp20	NA	S4TUB9	Salmonella_phage	99.5	1.7e-100
VDZ76697.1|641604_642432_+|tail	bacteriophage major tail sheath protein FI	tail	Q6K1H0	Salmonella_virus	99.2	1.9e-140
VDZ76698.1|642520_642793_+|tail	bacteriophage major tail sheath protein FI	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-46
VDZ76699.1|642808_643327_+|tail	major tail sheath protein FII	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
VDZ76700.1|643390_643603_+|tail	phage tail protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	5.2e-26
VDZ76701.1|644060_645137_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	67.1	1.3e-109
VDZ76702.1|645120_646314_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	92.4	2.9e-182
VDZ76703.1|646328_646544_+	gp25	NA	Q6K1G5	Salmonella_virus	90.4	2.6e-20
VDZ76704.1|646543_646813_+	gp25	NA	A0A0M4RCP0	Salmonella_phage	100.0	7.8e-43
VDZ76705.1|646809_647979_+	phage late control gene D	NA	A0A0M5M5V5	Salmonella_phage	97.4	1.9e-210
VDZ76706.1|648045_648264_+	phage late control gene	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
VDZ76707.1|648622_649129_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
648419:648467	attR	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
VDZ76708.1|649274_649418_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
VDZ76709.1|649414_649753_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
VDZ76710.1|649745_649985_-	RNA polymerase sigma-70 factor	NA	F4YCU2	Synechococcus_phage	57.1	3.3e-16
VDZ76711.1|649977_651261_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
VDZ76712.1|651275_652823_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.7	1.1e-51
VDZ76713.1|652761_653022_-	DNA primase	NA	S5M810	Pseudoalteromonas_phage	57.9	1.1e-20
VDZ76714.1|653781_654258_+|protease	glycoprotease	protease	A0A0R6PI74	Moraxella_phage	62.1	2.8e-51
VDZ76715.1|654232_654388_+|protease	glycoprotease	protease	A0A0R6PI74	Moraxella_phage	63.8	1.1e-09
VDZ76716.1|654526_654799_+|protease	glycoprotease	protease	A0A0R6PI74	Moraxella_phage	51.8	1.5e-17
VDZ76717.1|654734_654959_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ76718.1|655084_655351_-	tartrate carrier protein	NA	NA	NA	NA	NA
VDZ76719.1|655350_655881_-	tartrate carrier protein	NA	NA	NA	NA	NA
VDZ76720.1|655965_656316_-	tartrate carrier protein	NA	NA	NA	NA	NA
VDZ76721.1|656480_656786_-	tartrate dehydratase	NA	NA	NA	NA	NA
VDZ76722.1|656778_656973_-	tartrate dehydratase	NA	NA	NA	NA	NA
VDZ76723.1|656969_657878_-	tartrate dehydratase	NA	NA	NA	NA	NA
VDZ76724.1|658088_659240_+	Putative transcriptional regulator LYSR-type	NA	NA	NA	NA	NA
VDZ76725.1|659106_659724_-	Acyl-phosphate:glycerol-3-phosphateO- acyltransferase PlsY	NA	NA	NA	NA	NA
VDZ76726.1|659830_660190_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
VDZ76727.1|660286_660739_+	undecaprenyl pyrophosphate phosphatase	NA	NA	NA	NA	NA
VDZ76728.1|660740_661109_+	undecaprenyl pyrophosphate phosphatase	NA	NA	NA	NA	NA
VDZ76729.1|661155_662415_-|tRNA	tRNA nucleotidyltransferase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	49.1	1.6e-90
>prophage 3
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	949353	956521	4466174		uncultured_Mediterranean_phage(50.0%)	12	NA	NA
VDZ77120.1|949353_949632_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	58.8	1.4e-18
VDZ77121.1|949651_949861_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.9	4.4e-09
VDZ77122.1|949882_950047_+	L-isoaspartyl protein carboxyl methyltransferase type II	NA	NA	NA	NA	NA
VDZ77123.1|950040_950514_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.4	2.3e-21
VDZ77124.1|950659_951793_+	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
VDZ77125.1|951855_952047_+	RNA polymerase sigma factor rpoS	NA	NA	NA	NA	NA
VDZ77126.1|952136_952850_+	RNA polymerase sigma factor rpoS	NA	G8CLC7	Synechococcus_phage	40.6	3.1e-30
VDZ77127.1|952950_953133_-	Hydroxyaromatic non-oxidative decarboxylaseprotein D	NA	NA	NA	NA	NA
VDZ77128.1|953143_954571_-	Hydroxyaromatic non-oxidative decarboxylaseprotein B, Hydroxyaromatic non-oxidatived ecarboxylase protein C	NA	NA	NA	NA	NA
VDZ77129.1|954687_955164_-	decarboxylase	NA	NA	NA	NA	NA
VDZ77130.1|955333_955738_+	Transcriptional regulator hosA	NA	NA	NA	NA	NA
VDZ77131.1|955756_956521_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.8e-69
>prophage 4
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	1035751	1043164	4466174	tRNA	Pseudomonas_phage(16.67%)	10	NA	NA
VDZ77246.1|1035751_1036249_+	competence damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	50.5	4.7e-17
VDZ77247.1|1036337_1037399_+	recombinase A	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
VDZ77248.1|1037514_1038015_+	Regulatory protein recX	NA	NA	NA	NA	NA
VDZ77249.1|1038259_1038889_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A1V0SK38	Klosneuvirus	44.4	1.3e-40
VDZ77250.1|1038909_1039023_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ77251.1|1039025_1040351_+|tRNA	alanyl-tRNA synthetase	tRNA	A0A2K9L3D8	Tupanvirus	32.5	3.8e-21
VDZ77252.1|1040373_1040556_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ77253.1|1040767_1040899_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ77254.1|1041170_1041320_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	2.6e-08
VDZ77255.1|1042624_1043164_+	Putative phosphatase YqaB	NA	G3MA51	Bacillus_virus	25.3	1.4e-06
>prophage 5
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	1053510	1057662	4466174		Corynebacterium_phage(50.0%)	6	NA	NA
VDZ77269.1|1053510_1054581_-	glycine betaine/L-proline transport ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.3	8.3e-27
VDZ77270.1|1054936_1055830_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	A0A0N7CCA3	Skermania_phage	71.1	4.4e-114
VDZ77271.1|1055952_1056636_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A0A2H4P903	Corynebacterium_phage	48.3	1.6e-39
VDZ77272.1|1056866_1057100_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A0A2H4P8B4	Corynebacterium_phage	65.7	6.2e-20
VDZ77273.1|1057115_1057445_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A7IYE5	Corynebacterium_phage	80.9	7.6e-24
VDZ77274.1|1057416_1057662_-	ribonucleoside-diphosphate reductase 2 subunit alpha	NA	A0A096XT50	Enterococcus_phage	64.4	7.7e-21
>prophage 6
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	1194333	1200684	4466174		Faustovirus(16.67%)	13	NA	NA
VDZ77455.1|1194333_1195200_+	L-cysteine desulfurase	NA	A0A1X7C038	Faustovirus	39.5	5.3e-24
VDZ77456.1|1195237_1195546_+	L-cysteine desulfurase	NA	NA	NA	NA	NA
VDZ77457.1|1195573_1195960_+	NifU-like protein	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
VDZ77458.1|1195988_1196312_+	Iron binding protein IscA for iron-sulfur cluster assembly	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
VDZ77459.1|1196508_1197024_+	chaperone protein HscB	NA	NA	NA	NA	NA
VDZ77460.1|1197036_1197756_+	chaperone protein HscA	NA	A0A2P1ELQ7	Moumouvirus	44.9	9.4e-43
VDZ77461.1|1197700_1198516_+	chaperone protein HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	4.5e-41
VDZ77462.1|1198493_1198688_+	chaperone protein HscA	NA	NA	NA	NA	NA
VDZ77463.1|1198891_1199146_+	ferredoxin	NA	NA	NA	NA	NA
VDZ77464.1|1199283_1199439_+	FeS assembly protein IscX	NA	NA	NA	NA	NA
VDZ77465.1|1199493_1199643_+	peptidase B	NA	NA	NA	NA	NA
VDZ77466.1|1199703_1200093_+	peptidase B	NA	NA	NA	NA	NA
VDZ77467.1|1200246_1200684_+	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	40.1	2.7e-16
>prophage 7
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	1314490	1363311	4466174	tRNA,protease,integrase	Morganella_phage(25.0%)	60	1341878:1341893	1364533:1364548
VDZ77638.1|1314490_1315906_+|tRNA	glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ77639.1|1315958_1316330_-	DNA binding domain, excisionase family	NA	NA	NA	NA	NA
VDZ77640.1|1316352_1316715_-	negative regulator	NA	NA	NA	NA	NA
VDZ77641.1|1317888_1319511_+	protein YfeA	NA	NA	NA	NA	NA
VDZ77642.1|1319591_1320794_-	nucleoside permease NupC	NA	NA	NA	NA	NA
VDZ77643.1|1321135_1322254_+	manganese transport protein MntH	NA	NA	NA	NA	NA
VDZ77644.1|1322201_1322378_+	manganese transport protein MntH	NA	NA	NA	NA	NA
VDZ77645.1|1322401_1322641_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ77646.1|1322967_1323474_-	ion-channel protein	NA	NA	NA	NA	NA
VDZ77647.1|1323415_1323598_-	ion-channel protein	NA	NA	NA	NA	NA
VDZ77648.1|1324044_1325325_+	decarboxylase	NA	NA	NA	NA	NA
VDZ77649.1|1325321_1325696_+	decarboxylase	NA	NA	NA	NA	NA
VDZ77650.1|1325556_1326954_-	Chloride channel protein	NA	NA	NA	NA	NA
VDZ77651.1|1327157_1328123_+	glucokinase	NA	NA	NA	NA	NA
VDZ77652.1|1328449_1328710_+	PTS system IIB component	NA	NA	NA	NA	NA
VDZ77653.1|1328759_1329662_+	PTS system IIC component	NA	NA	NA	NA	NA
VDZ77654.1|1329712_1330006_+	PTS system IIC component	NA	NA	NA	NA	NA
VDZ77655.1|1330022_1330310_+|protease	metalloprotease	protease	NA	NA	NA	NA
VDZ77656.1|1330643_1331021_+|protease	metalloprotease	protease	NA	NA	NA	NA
VDZ77657.1|1331103_1331355_+|protease	metalloprotease	protease	NA	NA	NA	NA
VDZ77658.1|1331366_1332143_+|protease	metalloprotease	protease	NA	NA	NA	NA
VDZ77659.1|1332164_1333586_+	phosphoenolpyruvate-protein phosphotransferase	NA	NA	NA	NA	NA
VDZ77660.1|1333658_1333862_+	phosphoenolpyruvate-protein phosphotransferase	NA	NA	NA	NA	NA
VDZ77661.1|1333943_1334324_+	phosphoenolpyruvate-protein phosphotransferase	NA	NA	NA	NA	NA
VDZ77662.1|1334369_1334666_+	phosphoenolpyruvate-protein phosphotransferase	NA	NA	NA	NA	NA
VDZ77663.1|1334762_1334897_-	Putative HTH-type transcriptional regulator ypdC	NA	NA	NA	NA	NA
VDZ77664.1|1335023_1335395_-	Putative HTH-type transcriptional regulator ypdC	NA	NA	NA	NA	NA
VDZ77665.1|1336002_1337421_+	aminotransferase	NA	NA	NA	NA	NA
VDZ77666.1|1338072_1338993_-	Protein Ddg	NA	A0A1W6JP29	Morganella_phage	53.9	1.1e-75
VDZ77667.1|1339140_1339272_+	transporter	NA	NA	NA	NA	NA
VDZ77668.1|1339427_1339670_+	Protein of uncharacterised function (DUF2545)	NA	NA	NA	NA	NA
VDZ77669.1|1339644_1339947_-	Phosphoglycerate transporter protein	NA	NA	NA	NA	NA
VDZ77670.1|1340488_1341427_+|protease	outer membrane protease E	protease	NA	NA	NA	NA
1341878:1341893	attL	AAAATTCACCAACACA	NA	NA	NA	NA
VDZ77671.1|1342332_1343244_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VDZ77672.1|1343495_1343687_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ77673.1|1343681_1343894_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ77674.1|1344267_1344810_+	fimbrial protein	NA	NA	NA	NA	NA
VDZ77675.1|1344823_1347247_+	type 1 fimbriae anchoring protein FimD	NA	NA	NA	NA	NA
VDZ77676.1|1347369_1347930_+	Fimbrial chaperone protein	NA	NA	NA	NA	NA
VDZ77677.1|1347926_1348991_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ77678.1|1349005_1349539_+	fimbrial protein	NA	NA	NA	NA	NA
VDZ77679.1|1349548_1350028_+	Fimbrial subunit	NA	NA	NA	NA	NA
VDZ77680.1|1350042_1350564_+	Fimbrial subunit	NA	NA	NA	NA	NA
VDZ77681.1|1350573_1351077_+	Fimbrial subunit	NA	NA	NA	NA	NA
VDZ77682.1|1351101_1351590_+	Fimbrial subunit	NA	NA	NA	NA	NA
VDZ77683.1|1351582_1352137_+	Fimbrial subunit	NA	NA	NA	NA	NA
VDZ77684.1|1352198_1352480_+	signal transduction protein PmrD	NA	NA	NA	NA	NA
VDZ77685.1|1352484_1352868_-	Transposase for insertion sequence element IS904	NA	NA	NA	NA	NA
VDZ77686.1|1352936_1353164_-	Mobile element protein	NA	NA	NA	NA	NA
VDZ77687.1|1353567_1353816_-	Protein of uncharacterised function (DUF3532)	NA	NA	NA	NA	NA
VDZ77688.1|1353799_1354042_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ77689.1|1354063_1354954_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ77690.1|1354986_1355559_-	DNA-invertase	NA	G8I4U3	Mycobacterium_phage	38.7	5.6e-22
VDZ77691.1|1355754_1355988_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ77692.1|1356715_1357321_-	bacteriophage DNA primase	NA	NA	NA	NA	NA
VDZ77693.1|1357337_1358186_-	bacteriophage DNA primase	NA	I3VYX9	Thermoanaerobacterium_phage	29.9	1.1e-05
VDZ77694.1|1358130_1359081_-	bacteriophage DNA primase	NA	NA	NA	NA	NA
VDZ77695.1|1359130_1360285_-	bacteriophage DNA primase	NA	NA	NA	NA	NA
VDZ77696.1|1361102_1362035_-	phage-like protein	NA	NA	NA	NA	NA
VDZ77697.1|1361982_1363311_-|integrase	phage integrase	integrase	Q7M297	Enterobacteria_phage	53.6	3.3e-118
1364533:1364548	attR	TGTGTTGGTGAATTTT	NA	NA	NA	NA
>prophage 8
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	1464973	1478965	4466174		Pseudomonas_phage(27.27%)	20	NA	NA
VDZ77848.1|1464973_1465885_+	glycerophosphoryl diester phosphodiesterase periplasmic	NA	A0A220BYK6	Staphylococcus_phage	46.0	4.3e-08
VDZ77849.1|1466176_1466488_-	transcriptional regulator	NA	NA	NA	NA	NA
VDZ77850.1|1466510_1467044_-	transcriptional regulator	NA	NA	NA	NA	NA
VDZ77851.1|1467178_1467670_+	permease	NA	NA	NA	NA	NA
VDZ77852.1|1467629_1468397_+	transmembrane transport protein	NA	NA	NA	NA	NA
VDZ77853.1|1468400_1468655_-	ferredoxin	NA	G9IAA2	Pseudomonas_phage	71.6	1.5e-24
VDZ77854.1|1468654_1469473_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	75.7	1.3e-120
VDZ77855.1|1469457_1469907_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	85.7	1.6e-35
VDZ77856.1|1469906_1470179_-	Ribonucleotide reductase of class Ia (aerobic)alpha subunit	NA	A0A1W5PTL2	Pseudoalteromonas_phage	63.3	1.5e-28
VDZ77857.1|1470535_1470847_-	Ribonucleotide reductase of class Ia (aerobic)alpha subunit	NA	A0A2I7S840	Vibrio_phage	47.8	1.2e-13
VDZ77858.1|1471074_1471710_-	Ribonucleotide reductase of class Ia (aerobic)alpha subunit	NA	A0A2D1GNB1	Pseudoalteromonas_phage	72.3	3.6e-54
VDZ77859.1|1471722_1472205_-	Ribonucleotide reductase of class Ia (aerobic)alpha subunit	NA	A0A1W5PTL2	Pseudoalteromonas_phage	65.8	4.7e-54
VDZ77860.1|1472562_1473291_-	3-demethylubiquinone-9 3-methyltransferase	NA	NA	NA	NA	NA
VDZ77861.1|1473507_1474725_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	43.9	2.1e-82
VDZ77862.1|1474705_1475140_+	DNA gyrase subunit A	NA	NA	NA	NA	NA
VDZ77863.1|1475305_1475806_+	DNA gyrase subunit A	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	31.3	2.3e-19
VDZ77864.1|1475823_1476075_+	DNA gyrase subunit A	NA	NA	NA	NA	NA
VDZ77865.1|1476043_1476499_+	sensor protein RcsC	NA	NA	NA	NA	NA
VDZ77866.1|1476470_1477724_+	sensor protein RcsC	NA	NA	NA	NA	NA
VDZ77867.1|1477699_1478965_+	sensor protein RcsC	NA	A0A1V0SGX0	Hokovirus	40.9	1.2e-27
>prophage 9
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	1509362	1516083	4466174		Vibrio_phage(33.33%)	9	NA	NA
VDZ77912.1|1509362_1509599_+	nucleoid-asociated protein	NA	Q5QF34	Pseudomonas_virus	42.5	3.0e-14
VDZ77913.1|1509595_1509988_+	nucleoid-asociated protein	NA	A0A1V0E8C0	Vibrio_phage	61.5	4.0e-27
VDZ77914.1|1510138_1510423_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
VDZ77915.1|1510547_1511804_-	helicase	NA	M4Q3N1	Vibrio_phage	43.2	8.1e-66
VDZ77916.1|1511757_1512309_-	helicase	NA	A0A2P1MXB6	Escherichia_phage	43.0	1.6e-26
VDZ77917.1|1512460_1513156_+	ribosomal small subunit pseudouridine synthase	NA	NA	NA	NA	NA
VDZ77918.1|1513183_1514473_+	bicyclomycin resistance protein	NA	S4TR35	Salmonella_phage	23.0	2.0e-19
VDZ77919.1|1514764_1515109_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ77920.1|1515117_1516083_-	ABC-transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	2.6e-11
>prophage 10
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	1584642	1591276	4466174	tRNA	Enterobacteria_phage(71.43%)	12	NA	NA
VDZ78018.1|1584642_1585230_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.4	1.2e-88
VDZ78019.1|1585452_1586736_+	putative sensor kinase	NA	Q9EYF3	Enterobacteria_phage	89.5	2.9e-196
VDZ78020.1|1587135_1587591_+	two-component system response regulator	NA	NA	NA	NA	NA
VDZ78021.1|1587583_1587856_+	two-component system response regulator	NA	NA	NA	NA	NA
VDZ78022.1|1587902_1588373_+	Protein of uncharacterised function (DUF1456)	NA	Q9EYF4	Enterobacteria_phage	91.7	1.1e-76
VDZ78023.1|1588511_1588730_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.9	7.5e-20
VDZ78024.1|1588743_1588971_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	67.6	3.9e-19
VDZ78025.1|1589238_1589556_-|tRNA	methionyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ78026.1|1589552_1589792_-|tRNA	methionyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ78027.1|1589740_1590106_-|tRNA	methionyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ78028.1|1590212_1590608_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0S905	Catovirus	35.8	1.4e-08
VDZ78029.1|1590604_1591276_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	33.5	4.7e-28
>prophage 11
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	1755321	1760223	4466174		Enterobacteria_phage(42.86%)	9	NA	NA
VDZ78247.1|1755321_1755462_-	outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	64.4	3.8e-09
VDZ78248.1|1755490_1755979_-	Outer membrane protein C precursor	NA	Q1MVN1	Enterobacteria_phage	50.4	1.4e-26
VDZ78249.1|1755941_1756514_-	Outer membrane protein C precursor	NA	Q1MVN1	Enterobacteria_phage	64.5	1.1e-62
VDZ78250.1|1757161_1757428_+	membrane protein	NA	NA	NA	NA	NA
VDZ78251.1|1757565_1758129_+	metal-dependent phospho hydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	30.8	8.0e-05
VDZ78252.1|1758118_1758262_+	metal-dependent phospho hydrolase	NA	NA	NA	NA	NA
VDZ78253.1|1758330_1758813_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	73.8	8.3e-11
VDZ78254.1|1758986_1759478_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	56.6	9.4e-18
VDZ78255.1|1759752_1760223_+	patch repair protein	NA	E5E3X5	Burkholderia_phage	46.9	2.4e-31
>prophage 12
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	1876204	1902276	4466174	protease,transposase	Moraxella_phage(50.0%)	32	NA	NA
VDZ78465.1|1876204_1876513_+|protease	Tail-specific protease precursor	protease	NA	NA	NA	NA
VDZ78466.1|1876617_1877637_+|protease	Tail-specific protease precursor	protease	A0A0R6PIZ1	Moraxella_phage	33.1	5.6e-41
VDZ78467.1|1877587_1877839_+|protease	Tail-specific protease precursor	protease	A0A0R6PIZ1	Moraxella_phage	48.8	1.3e-10
VDZ78468.1|1877922_1878258_+|protease	Tail-specific protease precursor	protease	NA	NA	NA	NA
VDZ78469.1|1878705_1878906_+|transposase	transposase	transposase	NA	NA	NA	NA
VDZ78470.1|1879165_1879879_+	heat shock protein	NA	NA	NA	NA	NA
VDZ78471.1|1880092_1881466_-	export protein	NA	NA	NA	NA	NA
VDZ78472.1|1881641_1882433_+	transcriptional regulator KdgR	NA	NA	NA	NA	NA
VDZ78473.1|1882640_1882880_-	putative exported protein	NA	NA	NA	NA	NA
VDZ78474.1|1883037_1883181_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VDZ78475.1|1883251_1883539_+	putative exported protein	NA	NA	NA	NA	NA
VDZ78476.1|1884781_1886527_+	penicillin-binding protein	NA	NA	NA	NA	NA
VDZ78477.1|1886593_1887343_+	rRNA guanine-N1-methyltransferase	NA	NA	NA	NA	NA
VDZ78478.1|1887400_1887967_-	membrane protein YebN	NA	NA	NA	NA	NA
VDZ78479.1|1888377_1888836_-	membrane protein	NA	NA	NA	NA	NA
VDZ78480.1|1888899_1889751_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
VDZ78481.1|1889763_1890564_-	phosphotransferase enzyme II, C component	NA	NA	NA	NA	NA
VDZ78482.1|1890616_1891588_-	PTS system mannose-specific transporter subunit IIAB	NA	NA	NA	NA	NA
VDZ78483.1|1892058_1893618_+	Magnesium and cobalt efflux protein CorC	NA	A0A0R6PEZ3	Moraxella_phage	44.0	7.3e-40
VDZ78484.1|1893468_1894128_-	cyclic diguanylate phosphodiesterase (EAL) domain protein	NA	NA	NA	NA	NA
VDZ78485.1|1894090_1895053_-	cyclic diguanylate phosphodiesterase (EAL) domain protein	NA	NA	NA	NA	NA
VDZ78486.1|1895377_1896742_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
VDZ78487.1|1897009_1897450_-	putative nudix hydrolase YeaB	NA	NA	NA	NA	NA
VDZ78488.1|1897597_1897903_-	para-aminobenzoate synthase component I	NA	S4VNU7	Pandoravirus	45.7	3.3e-13
VDZ78489.1|1897844_1898324_-	para-aminobenzoate synthase component I	NA	S4VT78	Pandoravirus	41.0	2.7e-17
VDZ78490.1|1898458_1898872_-	para-aminobenzoate synthase component I	NA	NA	NA	NA	NA
VDZ78491.1|1899054_1899231_+	conserved domain protein	NA	NA	NA	NA	NA
VDZ78492.1|1899284_1899482_-	Putative translation initiation inhibitor YoaB	NA	NA	NA	NA	NA
VDZ78493.1|1900020_1900314_+	ATP-dependent helicase	NA	NA	NA	NA	NA
VDZ78494.1|1900691_1901123_+	ATP-dependent helicase	NA	NA	NA	NA	NA
VDZ78495.1|1901136_1901643_+	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	45.8	1.8e-35
VDZ78496.1|1901700_1902276_+|protease	metal-dependent protease-like protein, putative molecular chaperone	protease	NA	NA	NA	NA
>prophage 13
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	2128690	2135941	4466174		uncultured_Caudovirales_phage(42.86%)	10	NA	NA
VDZ78826.1|2128690_2129110_+	DNA repair protein	NA	A0A1W6JNS2	Morganella_phage	58.6	2.7e-34
VDZ78827.1|2129143_2130379_+	DNA repair protein	NA	I6RSM4	Salmonella_phage	78.3	9.1e-187
VDZ78828.1|2130371_2130788_-	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	56.2	7.9e-42
VDZ78829.1|2130901_2131042_-	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	58.1	1.5e-05
VDZ78830.1|2131366_2131981_-	Protein of uncharacterised function (DUF3828)	NA	NA	NA	NA	NA
VDZ78831.1|2132351_2132609_+	Uncharacterised protein	NA	S4TRL9	Salmonella_phage	58.9	8.6e-15
VDZ78832.1|2132730_2133006_+	FrmR: Negative transcriptional regulator of formaldehyde detoxification operon	NA	NA	NA	NA	NA
VDZ78833.1|2133037_2134156_+	alcohol dehydrogenase class III	NA	A0A0K0KVL7	Prochlorococcus_phage	29.6	5.2e-32
VDZ78834.1|2134325_2135516_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
VDZ78835.1|2135503_2135941_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.7	1.9e-06
>prophage 14
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	2531014	2535076	4466174	protease	Enterobacterial_phage(100.0%)	6	NA	NA
VDZ79386.1|2531014_2531797_-|protease	hemoglobin protease	protease	Q9LA58	Enterobacterial_phage	67.6	1.0e-103
VDZ79387.1|2531816_2532404_-|protease	hemoglobin protease	protease	Q9LA58	Enterobacterial_phage	26.7	1.4e-20
VDZ79388.1|2532360_2533098_-|protease	hemoglobin protease	protease	NA	NA	NA	NA
VDZ79389.1|2533253_2533565_-|protease	hemoglobin protease	protease	NA	NA	NA	NA
VDZ79390.1|2533677_2534463_-|protease	hemoglobin protease	protease	Q9LA58	Enterobacterial_phage	48.0	1.0e-58
VDZ79391.1|2534440_2535076_-|protease	hemoglobin protease	protease	Q9LA58	Enterobacterial_phage	54.4	1.9e-47
>prophage 15
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	2704689	2712296	4466174	tail	Salmonella_phage(50.0%)	16	NA	NA
VDZ79632.1|2704689_2705268_-	type III secretion system effector protein	NA	B6DZB9	Enterobacteria_phage	45.6	2.0e-19
VDZ79633.1|2705424_2705541_-	phage-like protein	NA	NA	NA	NA	NA
VDZ79634.1|2705639_2705963_-	phage-like protein	NA	NA	NA	NA	NA
VDZ79635.1|2706006_2706360_-	phage-like protein	NA	NA	NA	NA	NA
VDZ79636.1|2706319_2706583_-	phage-like protein	NA	NA	NA	NA	NA
VDZ79637.1|2706757_2707015_-	phage-like protein	NA	NA	NA	NA	NA
VDZ79638.1|2707099_2707450_-	phage-like protein	NA	Q8HA82	Salmonella_phage	74.8	8.1e-48
VDZ79639.1|2707552_2707858_-	phage-like protein	NA	Q8HA83	Salmonella_phage	53.1	6.2e-20
VDZ79640.1|2707946_2708357_-	phage-like protein	NA	NA	NA	NA	NA
VDZ79641.1|2708431_2708791_-	protein gp55	NA	NA	NA	NA	NA
VDZ79642.1|2708756_2709287_-	phage protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	9.9e-90
VDZ79643.1|2709546_2709804_-|tail	phage-tail assembly protein	tail	NA	NA	NA	NA
VDZ79644.1|2710085_2710700_-	bacteriophage protein	NA	Q8HA86	Salmonella_phage	92.6	2.7e-107
VDZ79645.1|2710699_2710981_-	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
VDZ79646.1|2710967_2711357_-	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	71.8	1.4e-40
VDZ79647.1|2711594_2712296_-	pertussis toxin s1 subunit	NA	A0A0U2KD26	Escherichia_phage	63.8	1.5e-77
>prophage 16
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	2715399	2728711	4466174	integrase	Salmonella_phage(58.82%)	24	2714683:2714697	2733400:2733414
2714683:2714697	attL	AGCAGTTCCGTCAGG	NA	NA	NA	NA
VDZ79652.1|2715399_2716071_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	57.1	1.5e-63
VDZ79653.1|2716344_2716461_-	Phage protein	NA	S4TNP0	Salmonella_phage	81.6	7.5e-11
VDZ79654.1|2716460_2717063_-	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.0	1.3e-109
VDZ79655.1|2717097_2717346_-	phage-like protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	3.6e-42
VDZ79656.1|2717462_2717696_-	Gifsy-1 prophage DinI	NA	H6WRY5	Salmonella_phage	98.7	7.3e-37
VDZ79657.1|2717881_2718406_-	phage-like protein	NA	A0A0P0ZD96	Stx2-converting_phage	57.6	3.9e-38
VDZ79658.1|2718416_2718629_-	phage-like protein	NA	A0A0P0ZDC0	Stx2-converting_phage	81.2	9.3e-15
VDZ79659.1|2718701_2719616_-	phage antirepressor protein	NA	I6S627	Salmonella_phage	47.3	5.0e-57
VDZ79660.1|2719602_2719770_-	phage-like protein	NA	G9L6D7	Escherichia_phage	75.5	6.6e-16
VDZ79661.1|2719893_2720325_+	bacteriophage regulatory protein	NA	G9L6D6	Escherichia_phage	55.8	9.7e-27
VDZ79662.1|2720504_2720612_-	phage-like protein	NA	NA	NA	NA	NA
VDZ79663.1|2720611_2720986_-	phage-like protein	NA	NA	NA	NA	NA
VDZ79664.1|2721247_2721949_-	phage protein	NA	H6WRY2	Salmonella_phage	52.6	5.6e-32
VDZ79665.1|2722576_2722912_-	replication protein P	NA	A0A0M3ULE2	Salmonella_phage	95.7	2.7e-40
VDZ79666.1|2722908_2723814_-	phage replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	99.0	1.3e-174
VDZ79667.1|2723905_2724226_-	repressor	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
VDZ79668.1|2724245_2724473_-	phage regulatory protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
VDZ79669.1|2724571_2724955_+	DNA-binding protein	NA	K7PHG0	Enterobacteria_phage	89.8	6.1e-57
VDZ79670.1|2725126_2725897_+	phage-like protein	NA	NA	NA	NA	NA
VDZ79671.1|2725972_2726779_+	phage-like protein	NA	NA	NA	NA	NA
VDZ79672.1|2726884_2727025_-	bacteriophage protein	NA	NA	NA	NA	NA
VDZ79673.1|2727314_2727431_+	Gifsy-1 prophage protein	NA	NA	NA	NA	NA
VDZ79674.1|2727466_2727691_+	phage-like protein	NA	NA	NA	NA	NA
VDZ79675.1|2727691_2728711_+|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A192Y7M7	Salmonella_phage	53.5	8.3e-93
2733400:2733414	attR	AGCAGTTCCGTCAGG	NA	NA	NA	NA
>prophage 17
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	2810195	2818392	4466174	tRNA	Escherichia_phage(42.86%)	9	NA	NA
VDZ79791.1|2810195_2810813_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	1.5e-76
VDZ79792.1|2810823_2811840_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	1.2e-88
VDZ79793.1|2811836_2812061_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	NA	NA	NA	NA
VDZ79794.1|2812299_2813268_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	51.2	3.0e-76
VDZ79795.1|2813503_2814796_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
VDZ79796.1|2815052_2816396_-	Holliday junction DNA helicase	NA	G3MBE0	Bacillus_virus	40.9	1.8e-79
VDZ79797.1|2816405_2817017_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VDZ79798.1|2817159_2817540_-	DNA translocase ftsK	NA	J7I0T4	Pseudomonas_phage	50.0	1.1e-13
VDZ79799.1|2817783_2818392_-	DNA translocase ftsK	NA	S5VNE3	Mycobacterium_phage	55.2	2.4e-39
>prophage 18
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	2831595	2837982	4466174	protease	Agrobacterium_phage(16.67%)	6	NA	NA
VDZ79818.1|2831595_2832201_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	41.6	2.5e-36
VDZ79819.1|2832148_2833873_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1L2CUT6	Pectobacterium_phage	43.9	9.9e-123
VDZ79820.1|2833903_2834224_-|protease	ATP-dependent clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
VDZ79821.1|2834548_2834770_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
VDZ79822.1|2834920_2836867_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	41.7	3.1e-40
VDZ79823.1|2836863_2837982_-	Macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	38.1	1.8e-08
>prophage 19
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	2873089	2889114	4466174	plate,tail,integrase	Salmonella_phage(75.0%)	31	2875896:2875909	2889207:2889220
VDZ79877.1|2873089_2873359_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	68.8	6.5e-13
VDZ79878.1|2873490_2873784_-	membrane protein	NA	NA	NA	NA	NA
VDZ79879.1|2874084_2874327_+	transporter	NA	NA	NA	NA	NA
VDZ79880.1|2874651_2874942_+	transporter	NA	NA	NA	NA	NA
VDZ79881.1|2874938_2875349_+	transporter	NA	NA	NA	NA	NA
VDZ79882.1|2875326_2875749_+	transporter	NA	NA	NA	NA	NA
2875896:2875909	attL	GGGTTTTTTGTTGT	NA	NA	NA	NA
VDZ79883.1|2876333_2876828_-	regulator of late gene expression	NA	Q53ZE8	Salmonella_virus	93.2	6.0e-65
VDZ79884.1|2876769_2877153_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	85.9	4.1e-61
VDZ79885.1|2877106_2877358_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	7.9e-21
VDZ79886.1|2877382_2877841_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.1e-67
VDZ79887.1|2877837_2878176_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	97.3	1.3e-50
VDZ79888.1|2878297_2879437_-|tail	putative bacteriophage tail protein	tail	A0A1S6L010	Salmonella_phage	63.1	2.7e-108
VDZ79889.1|2879516_2879729_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	2.1e-27
VDZ79890.1|2879671_2880583_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	83.6	1.5e-72
VDZ79891.1|2880524_2880821_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	97.6	6.2e-33
VDZ79892.1|2880947_2881250_-|tail	phage tail protein E	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
VDZ79893.1|2881304_2881511_-|tail	phage major tail tube protein FII	tail	E5G6P8	Salmonella_phage	91.2	1.6e-27
VDZ79894.1|2881570_2881756_-|tail	major tail sheath protein	tail	E5G6P7	Salmonella_phage	93.2	2.5e-24
VDZ79895.1|2881898_2882054_-	DNA invertase-like protein	NA	S4TTF2	Salmonella_phage	88.1	1.4e-12
VDZ79896.1|2882135_2882393_-	DNA-invertase	NA	M1T2R9	Escherichia_phage	78.8	1.3e-31
VDZ79897.1|2882422_2882821_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ79898.1|2883010_2883475_+|tail	phage tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	1.0e-18
VDZ79899.1|2883696_2884173_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ79900.1|2884127_2884853_-	Uncharacterized protein conserved in bacteria	NA	A0A088CPR9	Enterobacteria_phage	32.3	8.1e-18
VDZ79901.1|2885246_2886164_-|tail	probable variable tail fibre protein	tail	A0A1S6KZZ8	Salmonella_phage	78.8	1.1e-104
VDZ79902.1|2886398_2886665_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	97.6	5.7e-46
VDZ79903.1|2886813_2887575_-|plate	phage baseplate assembly protein J	plate	E5G6N8	Salmonella_phage	98.3	7.5e-123
VDZ79904.1|2887549_2887666_-|plate	phage baseplate assembly protein J	plate	E5G6N8	Salmonella_phage	94.6	1.2e-11
VDZ79905.1|2887652_2888012_-|plate	phage baseplate assembly protein W	plate	E5G6N7	Salmonella_phage	96.6	1.8e-58
VDZ79906.1|2888070_2888484_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	97.1	2.7e-74
VDZ79907.1|2888598_2889114_+|integrase	probable bacteriophage integrase	integrase	F1BUS9	Erwinia_phage	54.8	3.6e-36
2889207:2889220	attR	GGGTTTTTTGTTGT	NA	NA	NA	NA
>prophage 20
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	3203344	3210884	4466174	transposase,integrase	Leptospira_phage(50.0%)	9	3198845:3198857	3214025:3214037
3198845:3198857	attL	CGATCAACGTTTG	NA	NA	NA	NA
VDZ80358.1|3203344_3203563_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
VDZ80359.1|3205221_3205683_+	acyltransferase	NA	NA	NA	NA	NA
VDZ80360.1|3205800_3205941_+|transposase	transposase subfamily protein	transposase	NA	NA	NA	NA
VDZ80361.1|3205995_3206136_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ80362.1|3206414_3206714_-|transposase	transposase IS116	transposase	NA	NA	NA	NA
VDZ80363.1|3206836_3207022_-|transposase	transposase IS116	transposase	NA	NA	NA	NA
VDZ80364.1|3207516_3208173_-	O-antigen polymerase	NA	NA	NA	NA	NA
VDZ80365.1|3209001_3209346_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	54.2	8.5e-26
VDZ80366.1|3210413_3210884_+|integrase	integrase	integrase	A0A0M4R586	Salmonella_phage	96.1	1.0e-85
3214025:3214037	attR	CGATCAACGTTTG	NA	NA	NA	NA
>prophage 21
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	3249107	3283886	4466174	protease,transposase	Bacillus_phage(33.33%)	42	NA	NA
VDZ80423.1|3249107_3249260_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VDZ80424.1|3249299_3250439_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VDZ80425.1|3250482_3252663_-	integral membrane protein AefA	NA	NA	NA	NA	NA
VDZ80426.1|3252779_3253436_-	potential acrAB operon repressor	NA	NA	NA	NA	NA
VDZ80427.1|3253577_3254771_+	acriflavin resistance protein A	NA	NA	NA	NA	NA
VDZ80428.1|3254793_3257943_+	acriflavin resistance protein B	NA	NA	NA	NA	NA
VDZ80429.1|3258438_3258813_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
VDZ80430.1|3258839_3259058_+	hemolysin expression modulating protein	NA	NA	NA	NA	NA
VDZ80431.1|3259236_3259788_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
VDZ80432.1|3259905_3260169_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VDZ80433.1|3260125_3260377_+	Putative inner membrane protein	NA	NA	NA	NA	NA
VDZ80434.1|3260575_3260836_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
VDZ80435.1|3261040_3262591_+	Uncharacterized protein ylaB	NA	NA	NA	NA	NA
VDZ80436.1|3262829_3263219_+	methylated-DNA methyltransferase	NA	NA	NA	NA	NA
VDZ80437.1|3263251_3263821_-	lipoprotein	NA	NA	NA	NA	NA
VDZ80438.1|3264035_3264896_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
VDZ80439.1|3265019_3266306_-	ammonium transporter	NA	NA	NA	NA	NA
VDZ80440.1|3266337_3266676_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
VDZ80441.1|3266890_3268672_-	Multidrug resistance-like ATP-binding protein mdlB	NA	W8CYL7	Bacillus_phage	26.9	1.4e-39
VDZ80442.1|3268686_3268977_-	ABC transporter ATP-binding membrane protein	NA	NA	NA	NA	NA
VDZ80443.1|3268970_3269645_-	ABC transporter ATP-binding membrane protein	NA	W8CYL7	Bacillus_phage	33.9	8.9e-27
VDZ80444.1|3269634_3270093_-	ABC transporter ATP-binding membrane protein	NA	NA	NA	NA	NA
VDZ80445.1|3270092_3270440_-	ABC transporter ATP-binding membrane protein	NA	NA	NA	NA	NA
VDZ80446.1|3270481_3270940_-	transcriptional regulator	NA	NA	NA	NA	NA
VDZ80447.1|3271048_3271213_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ80448.1|3271339_3271585_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ80449.1|3271607_3271982_+	lyase	NA	NA	NA	NA	NA
VDZ80450.1|3272158_3272977_-	HMP-PP phosphatase	NA	NA	NA	NA	NA
VDZ80451.1|3273315_3274212_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDZ80452.1|3274162_3274390_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDZ80453.1|3274341_3274782_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDZ80454.1|3274845_3275541_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.1	1.6e-87
VDZ80455.1|3275649_3276048_-	4-hydroxybenzoyl-CoA thio esterase family activesite	NA	NA	NA	NA	NA
VDZ80456.1|3276153_3276528_-	competence protein ComEA	NA	NA	NA	NA	NA
VDZ80457.1|3276677_3278549_-	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VDZ80458.1|3278840_3279113_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
VDZ80459.1|3279321_3280599_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	63.9	6.2e-154
VDZ80460.1|3280591_3280978_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	55.0	3.6e-33
VDZ80461.1|3280940_3281678_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	25.4	3.0e-12
VDZ80462.1|3281863_3283135_-|protease	ATP-dependent clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	4.3e-131
VDZ80463.1|3283261_3283396_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
VDZ80464.1|3283358_3283886_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	66.0	1.3e-54
>prophage 22
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	3936255	3944571	4466174	tRNA,protease	Lactococcus_phage(50.0%)	12	NA	NA
VDZ81322.1|3936255_3936549_-|tRNA	putative tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
VDZ81323.1|3936652_3939097_-	ribonuclease R (RNase R)	NA	Q0GXV6	Lactococcus_phage	32.4	6.4e-67
VDZ81324.1|3939134_3939560_-	transcriptional regulator	NA	NA	NA	NA	NA
VDZ81325.1|3939783_3940761_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	33.7	2.0e-43
VDZ81326.1|3940735_3941047_-	adenylosuccinate synthetase	NA	NA	NA	NA	NA
VDZ81327.1|3941186_3941384_-	membrane protein	NA	NA	NA	NA	NA
VDZ81328.1|3941462_3941699_-|protease	FtsH protease regulator HflC	protease	NA	NA	NA	NA
VDZ81329.1|3941837_3942281_-|protease	FtsH protease regulator HflC	protease	NA	NA	NA	NA
VDZ81330.1|3942472_3943027_-|protease	protease	protease	NA	NA	NA	NA
VDZ81331.1|3942977_3943577_-|protease	protease	protease	NA	NA	NA	NA
VDZ81332.1|3943952_3944387_-|protease	GTP-binding subunit of protease	protease	NA	NA	NA	NA
VDZ81333.1|3944325_3944571_-|protease	GTP-binding subunit of protease	protease	NA	NA	NA	NA
>prophage 23
LR134137	Salmonella bongori strain NCTC12419 genome assembly, chromosome: 1	4466174	4012576	4017087	4466174		Escherichia_phage(100.0%)	7	NA	NA
VDZ81415.1|4012576_4012849_-	Twin-arginine leader-binding protein DmsD	NA	A0A077SLS7	Escherichia_phage	70.8	1.1e-28
VDZ81416.1|4012829_4013093_-	twin-argninine leader-binding protein DmsD	NA	A0A077SLS7	Escherichia_phage	69.1	1.8e-31
VDZ81417.1|4013365_4013692_-	dimethyl sulfoxide reductase subunit C	NA	A0A077SK59	Escherichia_phage	75.0	2.7e-37
VDZ81418.1|4013696_4014020_-	dimethyl sulfoxide reductase subunit C	NA	A0A077SK59	Escherichia_phage	88.0	8.8e-41
VDZ81419.1|4014172_4014640_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	92.9	2.5e-89
VDZ81420.1|4014653_4016717_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	81.2	0.0e+00
VDZ81421.1|4016724_4017087_-	anaerobic dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	69.7	1.5e-25
