The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	824263	874430	5295029	transposase	Escherichia_phage(30.77%)	38	NA	NA
VDZ29745.1|824263_825286_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
VDZ29746.1|825285_826065_+	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
VDZ29747.1|826364_827090_+	CP4-57 prophage protein	NA	NA	NA	NA	NA
VDZ29748.1|827297_827969_+	CP4-57 prophage protein	NA	NA	NA	NA	NA
VDZ29749.1|829116_829266_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ29750.1|829510_830077_+	Protein of uncharacterised function (DUF3296)	NA	NA	NA	NA	NA
VDZ29751.1|830324_830885_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ29752.1|830953_831187_+	putative regulatory protein	NA	NA	NA	NA	NA
VDZ29753.1|831453_832002_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ29754.1|832269_832893_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VDZ29755.1|832990_833224_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ29756.1|833587_835354_+	putative hemolysin activator ShlB-type	NA	A0A0R6PI85	Moraxella_phage	25.5	4.6e-22
VDZ29757.1|835366_845095_+	hemagglutinin-related protein	NA	A0A0R6PJK4	Moraxella_phage	33.5	1.6e-28
VDZ29758.1|845091_845478_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ29759.1|845508_845886_+	protein encoded within IS	NA	A0A0P0ZBS5	Stx2-converting_phage	98.1	1.7e-56
VDZ29760.1|846190_846523_+	ImpA-related N-terminal family protein	NA	NA	NA	NA	NA
VDZ29761.1|846506_847034_+	TraG-like protein, N-terminal region	NA	NA	NA	NA	NA
VDZ29762.1|847043_847400_+	TraG-like protein, N-terminal region	NA	NA	NA	NA	NA
VDZ29763.1|847780_848827_+	modification methylase	NA	A0A0R6PG08	Moraxella_phage	43.0	2.0e-65
VDZ29764.1|848831_851792_+	ATPase	NA	A0A1B5FPD5	Escherichia_phage	24.3	3.9e-34
VDZ29765.1|851805_853161_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ29766.1|854152_854419_+|transposase	transposase	transposase	NA	NA	NA	NA
VDZ29767.1|854447_854768_+|transposase	transposase	transposase	NA	NA	NA	NA
VDZ29768.1|854906_854996_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ29769.1|855696_857169_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	1.9e-21
VDZ29770.1|857169_857889_-	response regulator	NA	W8CYM9	Bacillus_phage	35.2	3.3e-35
VDZ29771.1|858029_858629_+	putative transmembrane hydrogenase cytochrome b-type subunit oxidoreductase protein	NA	NA	NA	NA	NA
VDZ29772.1|858628_859399_+	oxidoreductase	NA	NA	NA	NA	NA
VDZ29773.1|859426_859669_+	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
VDZ29774.1|860852_861365_+	hemolysin C	NA	NA	NA	NA	NA
VDZ29775.1|861376_864451_+	hemolysin A	NA	NA	NA	NA	NA
VDZ29776.1|864521_866645_+	alpha-hemolysin translocation ATP-binding protein HlyB	NA	W8CYL7	Bacillus_phage	29.7	6.4e-47
VDZ29777.1|866663_868100_+	hemolysin D	NA	NA	NA	NA	NA
VDZ29778.1|869045_872090_+	cytotoxic necrotizing factor 1	NA	NA	NA	NA	NA
VDZ29779.1|872463_872916_-|transposase	putative transposase	transposase	A0A077SLK2	Escherichia_phage	82.6	3.1e-68
VDZ29780.1|873009_873309_+|transposase	transposase	transposase	NA	NA	NA	NA
VDZ29781.1|873305_873872_+	putative IS tranposase	NA	A0A0P0I4A4	Acinetobacter_phage	39.4	1.2e-24
VDZ29782.1|874196_874430_+|transposase	putative transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.9e-22
>prophage 2
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	1449288	1503110	5295029	tRNA,transposase	Bacillus_phage(14.29%)	56	NA	NA
VDZ30308.1|1449288_1449891_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.3e-61
VDZ30309.1|1450115_1450637_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ30310.1|1450728_1452732_-	transketolase	NA	NA	NA	NA	NA
VDZ30311.1|1452751_1453702_-	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
VDZ30312.1|1453990_1456270_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
VDZ30313.1|1456560_1456896_+	ethanolamine utilization protein EutS	NA	NA	NA	NA	NA
VDZ30314.1|1456908_1457388_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
VDZ30315.1|1457362_1458064_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
VDZ30316.1|1458060_1458864_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
VDZ30317.1|1458860_1459877_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
VDZ30318.1|1459873_1460209_+	detox protein in ethanolamine utilization	NA	NA	NA	NA	NA
VDZ30319.1|1460315_1460603_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
VDZ30320.1|1460614_1462018_+	ethanolamine utilization aldehyde dehydrogenase	NA	NA	NA	NA	NA
VDZ30321.1|1462028_1462865_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
VDZ30322.1|1462854_1464042_+	alcohol dehydrogenase in ethanolamine utilization	NA	NA	NA	NA	NA
VDZ30323.1|1464095_1464698_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.3e-61
VDZ30324.1|1464922_1465444_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ30325.1|1465595_1466822_+	putative ethanolamine transporter	NA	NA	NA	NA	NA
VDZ30326.1|1466818_1468222_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
VDZ30327.1|1468233_1469595_+	ethanolamine ammonia-lyase heavy chain	NA	NA	NA	NA	NA
VDZ30328.1|1469615_1470503_+	Ethanolamine ammonia-lyase light chain	NA	NA	NA	NA	NA
VDZ30329.1|1470512_1471172_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
VDZ30330.1|1471184_1471685_+	ethanolamine utilization protein EutK	NA	NA	NA	NA	NA
VDZ30331.1|1471730_1472783_+	ethanolamine operon transcriptional regulator	NA	NA	NA	NA	NA
VDZ30332.1|1472788_1473688_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
VDZ30333.1|1473691_1474561_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
VDZ30334.1|1474774_1475200_+	N-acetyltransferase GCN5	NA	NA	NA	NA	NA
VDZ30335.1|1475186_1475636_+	inner membrane protein	NA	NA	NA	NA	NA
VDZ30336.1|1475696_1476272_+	putative lipoprotein	NA	NA	NA	NA	NA
VDZ30337.1|1476367_1477267_+	putative peroxidase	NA	S4VVJ7	Pandoravirus	32.2	1.7e-25
VDZ30338.1|1477324_1478629_-	periplasmic esterase	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
VDZ30339.1|1478633_1480058_-	N-acetylmuramic acid-specific PTS system EIIBC component	NA	NA	NA	NA	NA
VDZ30340.1|1480061_1480958_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
VDZ30341.1|1481121_1481979_+	RpiR-family transcriptional regulator	NA	NA	NA	NA	NA
VDZ30342.1|1482107_1482899_+	short chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.2e-17
VDZ30343.1|1483056_1484073_+	thiosulfate ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
VDZ30344.1|1484072_1484906_+	sulfate	NA	NA	NA	NA	NA
VDZ30345.1|1484905_1485781_+	sulfate ABC transporter, permease protein	NA	NA	NA	NA	NA
VDZ30346.1|1485770_1486868_+	sulfate ABC transporter, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
VDZ30347.1|1487001_1487913_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	4.5e-58
VDZ30348.1|1487915_1488284_-	protein	NA	NA	NA	NA	NA
VDZ30349.1|1488388_1489240_+	pyridoxine kinase	NA	NA	NA	NA	NA
VDZ30350.1|1489281_1489791_-	glucose-specific PTS system EIIA component	NA	NA	NA	NA	NA
VDZ30351.1|1489831_1491559_-	PEP-protein phosphotransferase system enzyme I	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
VDZ30352.1|1491603_1491861_-	phosphohistidinoprotein-hexose phosphotransferase component of PTS system	NA	NA	NA	NA	NA
VDZ30353.1|1492244_1493216_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
VDZ30354.1|1493400_1494162_-	putative sulfate transport protein	NA	NA	NA	NA	NA
VDZ30355.1|1494391_1495390_+	cell division protein ZipA	NA	NA	NA	NA	NA
VDZ30356.1|1495460_1497476_+	DNA ligase	NA	A0A0K2QQN8	Ralstonia_phage	43.5	2.0e-151
VDZ30357.1|1497477_1497696_+	protein	NA	NA	NA	NA	NA
VDZ30358.1|1497692_1498691_-	sodium/bile acid symporter family (mazG-like)	NA	NA	NA	NA	NA
VDZ30359.1|1498780_1499707_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDZ30360.1|1499697_1500039_-	ybl109	NA	NA	NA	NA	NA
VDZ30361.1|1500814_1502230_+|tRNA	glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
VDZ30362.1|1502230_1502773_-|transposase	transposase TnA	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	3.9e-41
VDZ30363.1|1502840_1503110_+|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	95.4	7.8e-43
>prophage 3
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	1538318	1595169	5295029	integrase,transposase	Shigella_phage(20.0%)	52	1525623:1525639	1586618:1586634
1525623:1525639	attL	CTTTACGACCATAATCC	NA	NA	NA	NA
VDZ30392.1|1538318_1538696_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	99.2	6.4e-67
VDZ30393.1|1538740_1539016_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
VDZ30394.1|1539436_1539982_+	F17 fimbrial protein	NA	NA	NA	NA	NA
VDZ30395.1|1540046_1540769_+	F17-like fimbrial chaperone	NA	NA	NA	NA	NA
VDZ30396.1|1540780_1543318_+	F17-like fimbrial usher	NA	NA	NA	NA	NA
VDZ30397.1|1543319_1544372_+	F17-like fimbril adhesin subunit	NA	NA	NA	NA	NA
VDZ30398.1|1544707_1544857_+|transposase	putative transposase A, IS2	transposase	Q76S41	Shigella_phage	75.0	3.5e-08
VDZ30399.1|1545014_1545878_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VDZ30400.1|1546168_1547674_+	Methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VDZ30401.1|1547685_1549611_+	putative malonic semialdehyde oxidative decarboxylase (iolD-like)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.0	2.2e-25
VDZ30402.1|1549509_1549731_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ30403.1|1549893_1550880_+	putative myo-inositol 2-dehydrogenase (iolG-like)	NA	NA	NA	NA	NA
VDZ30404.1|1550911_1551841_+	D-ribose transporter subunit RbsB	NA	NA	NA	NA	NA
VDZ30405.1|1551892_1553440_+	ybl121	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	3.5e-10
VDZ30406.1|1553451_1554480_+	high-affinity ribose transport system permease protein RbsC	NA	NA	NA	NA	NA
VDZ30407.1|1554488_1555622_+	KpLE2 phage-like element; predicted oxidoreductase	NA	NA	NA	NA	NA
VDZ30408.1|1555634_1557539_+	putative carbohydrate kinase	NA	NA	NA	NA	NA
VDZ30409.1|1557550_1558441_+	2-keto-myo-inositol dehydratase	NA	NA	NA	NA	NA
VDZ30410.1|1558450_1559272_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
VDZ30411.1|1559397_1559523_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ30412.1|1560440_1560866_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ30413.1|1561537_1562038_-	PapX protein	NA	NA	NA	NA	NA
VDZ30414.1|1563403_1563772_+	putative ATP/GTP binding protein	NA	NA	NA	NA	NA
VDZ30415.1|1563768_1565532_+	putative ATP-dependent helicase	NA	NA	NA	NA	NA
VDZ30416.1|1565489_1565966_+	putative ATP-dependent helicase	NA	NA	NA	NA	NA
VDZ30417.1|1566810_1567839_-	Uncharacterized conserved protein	NA	A0A0R6PKN1	Moraxella_phage	26.0	5.0e-13
VDZ30418.1|1567838_1568888_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ30419.1|1569595_1570786_-|integrase	site-specific recombinase, phage integrase	integrase	Q7M297	Enterobacteria_phage	57.3	7.6e-130
VDZ30420.1|1571111_1572161_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	100.0	8.1e-168
VDZ30421.1|1572337_1573093_+	lipoprotein	NA	NA	NA	NA	NA
VDZ30422.1|1573274_1574543_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ30423.1|1574907_1576248_-	long-chain fatty acid outer membrane transporter	NA	NA	NA	NA	NA
VDZ30424.1|1576619_1576904_+	protein YfcZ	NA	NA	NA	NA	NA
VDZ30425.1|1577084_1578395_+	fatty acid oxidation comple beta subunit (3 -ketoacyl-CoA thiolase)	NA	NA	NA	NA	NA
VDZ30426.1|1578394_1580539_+	fatty acid oxidation complex alpha subunit [includes: enoyl-CoA hydratase; 3-hydroxyacyl-CoA dehydrogenase; 3-hydroxybutyryl-CoA epimerase]	NA	NA	NA	NA	NA
VDZ30427.1|1580741_1581227_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
VDZ30428.1|1581870_1582434_+	fimbrial protein	NA	NA	NA	NA	NA
VDZ30429.1|1582517_1585157_+	fimbrial usher	NA	NA	NA	NA	NA
VDZ30430.1|1585179_1585929_+	chaperone protein PapD	NA	NA	NA	NA	NA
VDZ30431.1|1585944_1586451_+	putative fimbrial protein	NA	NA	NA	NA	NA
VDZ30432.1|1586447_1586936_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
1586618:1586634	attR	GGATTATGGTCGTAAAG	NA	NA	NA	NA
VDZ30433.1|1586932_1587472_+	fimbrial protein	NA	NA	NA	NA	NA
VDZ30434.1|1587473_1588313_+	putative fimbrial adhesin YfcO precursor	NA	NA	NA	NA	NA
VDZ30435.1|1588481_1589033_-	Smr protein/MutS2	NA	NA	NA	NA	NA
VDZ30436.1|1589198_1590131_+	putative methylase	NA	NA	NA	NA	NA
VDZ30437.1|1590165_1591251_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
VDZ30438.1|1591254_1592079_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
VDZ30439.1|1592078_1592888_+	inner membrane protein	NA	NA	NA	NA	NA
VDZ30440.1|1592887_1593436_+	putative transporting ATPase	NA	NA	NA	NA	NA
VDZ30441.1|1593469_1593748_+	protein	NA	NA	NA	NA	NA
VDZ30442.1|1593820_1594423_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.3e-61
VDZ30443.1|1594647_1595169_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	1830221	1839666	5295029		Enterobacteria_phage(85.71%)	10	NA	NA
VDZ30652.1|1830221_1831148_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
VDZ30653.1|1831152_1831884_+	ABC transporter permease	NA	NA	NA	NA	NA
VDZ30654.1|1831864_1831972_-	putative inner membrane protein	NA	NA	NA	NA	NA
VDZ30655.1|1832031_1832763_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VDZ30656.1|1832984_1834670_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VDZ30657.1|1834666_1835386_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VDZ30658.1|1835432_1835903_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VDZ30659.1|1835943_1836405_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VDZ30660.1|1836529_1838533_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
VDZ30661.1|1838529_1839666_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
>prophage 5
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	1934109	1944456	5295029	transposase	Enterobacteria_phage(30.0%)	11	NA	NA
VDZ30737.1|1934109_1935504_+	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	32.3	1.7e-19
VDZ30738.1|1935678_1936572_+	UTP--glucose-1-phosphate uridylyltransferase subunit GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
VDZ30739.1|1936944_1938030_+	dTDP-D-glucose 4,6-dehydratase rmlB	NA	I7HTA3	Enterobacteria_phage	54.2	3.6e-102
VDZ30740.1|1938029_1938929_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.3	6.3e-28
VDZ30741.1|1938986_1939865_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	62.7	2.8e-105
VDZ30742.1|1939869_1940418_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.5	4.2e-51
VDZ30743.1|1940424_1941498_+	Uncharacterised protein	NA	A0A1V0SDW6	Indivirus	25.8	7.8e-25
VDZ30744.1|1941490_1942222_+	O-acetyltransferase	NA	M1HJ62	Paramecium_bursaria_Chlorella_virus	35.1	1.7e-07
VDZ30745.1|1942214_1943702_+	O-antigen flippase	NA	NA	NA	NA	NA
VDZ30746.1|1943761_1944034_+	IS1 InsA protein	NA	A0A0U2RK18	Escherichia_phage	86.9	1.9e-36
VDZ30747.1|1944060_1944456_+|transposase	IS1, transposase orfB	transposase	A0A0U2RK18	Escherichia_phage	90.1	8.8e-67
>prophage 6
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	1995565	2085151	5295029	protease,capsid,tail,head,integrase,portal,terminase,transposase	Escherichia_phage(45.24%)	79	1993938:1993954	2074644:2074660
1993938:1993954	attL	ATCACCTGATGCTGCTG	NA	NA	NA	NA
VDZ30798.1|1995565_1996945_+|transposase	transposase	transposase	NA	NA	NA	NA
VDZ30799.1|1997596_1998427_-	phosphotriesterase	NA	NA	NA	NA	NA
VDZ30800.1|1998513_1998813_+|transposase	transposase	transposase	NA	NA	NA	NA
VDZ30801.1|1998809_1999541_+|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	1.8e-36
VDZ30802.1|2001120_2001666_+	bifunctional adenosylcobalamin biosynthesis protein [includes adenosylcobinamide kinase; adenosylcobinamide-phosphate guanylyltransferase]	NA	NA	NA	NA	NA
VDZ30803.1|2001662_2002406_+	cobalamin synthase	NA	NA	NA	NA	NA
VDZ30804.1|2002417_2003497_+	Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
VDZ30805.1|2003558_2004494_+	ErfK/YbiS/YcfS/YnhG family protein	NA	NA	NA	NA	NA
VDZ30806.1|2004950_2005868_+	Nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
VDZ30807.1|2005969_2006920_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDZ30808.1|2007226_2008681_+	multidrug efflux system	NA	NA	NA	NA	NA
VDZ30809.1|2009311_2010028_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDZ30810.1|2010370_2011825_-	AMP nucleosidase	NA	NA	NA	NA	NA
VDZ30811.1|2011926_2013243_-	shikimate transporter	NA	NA	NA	NA	NA
VDZ30812.1|2013557_2014610_+	ADP-heptose--LPS heptosyltransferase-like protein	NA	NA	NA	NA	NA
VDZ30813.1|2014737_2015874_-	putative invasin	NA	NA	NA	NA	NA
VDZ30814.1|2015821_2016670_-	putative invasin/adhesin protein	NA	NA	NA	NA	NA
VDZ30815.1|2016802_2017513_-	putative invasin	NA	NA	NA	NA	NA
VDZ30816.1|2018204_2020226_-	pesticin/yersiniabactin TonB-dependent receptor	NA	NA	NA	NA	NA
VDZ30817.1|2020356_2021934_-	yersiniabactin siderophore biosynthetic protein	NA	NA	NA	NA	NA
VDZ30818.1|2021937_2022741_-	yersiniabactin siderophore biosynthetic protein	NA	NA	NA	NA	NA
VDZ30819.1|2022737_2023838_-	Thiazolinyl-S-HMWP1 reductase YbtU	NA	NA	NA	NA	NA
VDZ30820.1|2023834_2033326_-	non-ribosomal peptide synthase (yersiniabactin siderophore biosynthetic protein)	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
VDZ30821.1|2033413_2039521_-	phenyloxazoline synthase MbtB	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
VDZ30822.1|2039711_2040671_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VDZ30823.1|2040837_2042640_+	ABC transporter ATP-binding/permease rpotein	NA	W8CYL7	Bacillus_phage	27.6	1.4e-31
VDZ30824.1|2042626_2044429_+	permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
VDZ30825.1|2044421_2045702_+	yersiniabactin-iron transporter permease YbtX	NA	NA	NA	NA	NA
VDZ30826.1|2045729_2047034_+	putative chorismate binding protein	NA	NA	NA	NA	NA
VDZ30827.1|2047227_2047977_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.0	1.6e-40
VDZ30828.1|2047981_2048143_-|integrase	integrase	integrase	A7X7X0	Dichelobacter_phage	51.3	1.7e-05
VDZ30829.1|2048480_2049278_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
VDZ30830.1|2049513_2050539_-|integrase	site-specific recombinase, phage integrase family	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
VDZ30831.1|2050538_2050742_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ30832.1|2050800_2053242_-	Exodeoxyribonuclease VIII from bacteriophage origin	NA	V5UQJ3	Shigella_phage	46.8	2.9e-112
VDZ30833.1|2053335_2053527_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ30834.1|2053523_2053712_-	division inhibition protein dicB	NA	NA	NA	NA	NA
VDZ30835.1|2054111_2054276_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ30836.1|2054279_2054498_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ30837.1|2054527_2054656_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ30838.1|2054657_2054894_-	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	1.4e-06
VDZ30839.1|2055085_2055802_-	Putative SOS-response transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	1.1e-51
VDZ30840.1|2055851_2056067_+	putative antirepressor protein	NA	NA	NA	NA	NA
VDZ30841.1|2056063_2056489_+	phage regulatory protein	NA	NA	NA	NA	NA
VDZ30842.1|2056560_2057631_+	replication protein	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
VDZ30843.1|2057671_2058097_+	phage protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
VDZ30844.1|2058250_2058937_+	putative prophage protein	NA	NA	NA	NA	NA
VDZ30845.1|2060301_2061420_+	putative prophage protein	NA	U5P0K4	Shigella_phage	55.0	1.8e-109
VDZ30846.1|2061432_2061792_+	Holliday junction resolvase	NA	V5URS4	Shigella_phage	67.5	8.3e-40
VDZ30847.1|2061788_2062478_+	Antitermination protein Q	NA	I6PDF8	Cronobacter_phage	47.6	1.4e-56
VDZ30848.1|2062752_2063472_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ30849.1|2063638_2064025_+	phage membrane protein	NA	A0A192Y8P2	Salmonella_phage	93.0	5.6e-58
VDZ30850.1|2064011_2064293_+	phage membrane protein	NA	A0A0U2SHD1	Escherichia_phage	47.8	5.3e-18
VDZ30851.1|2064292_2064907_+	phage encoded lysozyme	NA	Q8HA86	Salmonella_phage	79.4	1.2e-91
VDZ30852.1|2064914_2065184_+	Uncharacterised protein	NA	G8C7W1	Escherichia_phage	65.5	1.6e-19
VDZ30853.1|2065324_2065447_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ30854.1|2065594_2066134_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ30855.1|2066272_2066623_+	putative prophage endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	2.1e-64
VDZ30856.1|2066770_2067253_+|terminase	putative prophage terminase, small subunit	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
VDZ30857.1|2067252_2069010_+|terminase	phage terminase	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
VDZ30858.1|2069021_2069204_+	prophage protein	NA	A0A1B5FP99	Escherichia_phage	95.0	2.5e-24
VDZ30859.1|2069203_2070445_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
VDZ30860.1|2070422_2071073_+|head,protease	pro-head protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
VDZ30861.1|2071087_2072293_+|capsid	major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.3	1.0e-222
VDZ30862.1|2072343_2072532_+	phage protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
VDZ30863.1|2072543_2072849_+	phage protein	NA	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
VDZ30864.1|2072857_2073196_+|head,tail	putative prophage head-tail adaptor	head,tail	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
VDZ30865.1|2073195_2073642_+	prophage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
VDZ30866.1|2073638_2073983_+	putative prophage protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
VDZ30867.1|2073991_2074747_+|tail	phage major tail subunit	tail	A0A1B5FP82	Escherichia_phage	96.2	1.2e-117
2074644:2074660	attR	CAGCAGCATCAGGTGAT	NA	NA	NA	NA
VDZ30868.1|2074761_2075133_+|tail	tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
VDZ30869.1|2075156_2075435_+	prophage protein	NA	A0A1B5FP87	Escherichia_phage	96.7	2.4e-42
VDZ30870.1|2075481_2078709_+|tail	phage-related minor tail protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
VDZ30871.1|2078701_2079043_+|tail	prophage minor tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	1.2e-40
VDZ30872.1|2079042_2079741_+|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
VDZ30873.1|2079889_2080489_+|tail	tail component	tail	K7PLW1	Enterobacteria_phage	97.0	1.5e-118
VDZ30874.1|2080485_2081028_+|tail	putative phage tail component	tail	A0A291AWV5	Escherichia_phage	82.4	2.4e-75
VDZ30875.1|2081088_2084484_+	Host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	90.2	0.0e+00
VDZ30876.1|2084551_2085151_+	outer membrane precursor Lom	NA	A5LH44	Enterobacteria_phage	98.0	1.3e-109
>prophage 7
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	2457408	2520760	5295029	protease,lysis,portal,tail,integrase,head,terminase,transposase	Enterobacteria_phage(39.13%)	69	2486040:2486055	2489356:2489371
VDZ31245.1|2457408_2458230_-|protease	putative protease	protease	NA	NA	NA	NA
VDZ31246.1|2458505_2458814_-	acid shock protein	NA	NA	NA	NA	NA
VDZ31247.1|2459237_2460491_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VDZ31248.1|2460597_2461491_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDZ31249.1|2461625_2462846_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VDZ31250.1|2462970_2463666_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VDZ31251.1|2463618_2464875_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VDZ31252.1|2465069_2465684_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
VDZ31253.1|2465726_2466581_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VDZ31254.1|2466582_2467200_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
VDZ31255.1|2467210_2469607_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	4.8e-208
VDZ31256.1|2469694_2472121_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
VDZ31257.1|2472319_2472625_-	protein	NA	NA	NA	NA	NA
VDZ31258.1|2472696_2473443_+	lipoprotein	NA	NA	NA	NA	NA
VDZ31259.1|2473445_2474006_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VDZ31260.1|2474040_2474382_-	protein	NA	NA	NA	NA	NA
VDZ31261.1|2474516_2474867_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	6.2e-24
VDZ31262.1|2475047_2476262_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	5.3e-46
VDZ31263.1|2476273_2477293_+	dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
VDZ31264.1|2477350_2477461_+	protein, truncated	NA	NA	NA	NA	NA
VDZ31265.1|2477480_2478761_-|integrase	defective integrase; Qin prophage	integrase	B6DZ48	Enterobacteria_phage	62.6	5.1e-156
VDZ31266.1|2478795_2479032_-	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VDZ31267.1|2479119_2481591_-	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
VDZ31268.1|2481684_2481876_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ31269.1|2481872_2482061_-	division inhibition protein	NA	NA	NA	NA	NA
VDZ31270.1|2482547_2483123_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ31271.1|2483124_2483280_-	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
VDZ31272.1|2483472_2483931_-	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
VDZ31273.1|2483957_2484185_+	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VDZ31274.1|2484168_2484690_+	YdfX	NA	NA	NA	NA	NA
VDZ31275.1|2484670_2485636_+	ybl78	NA	U5P0A0	Shigella_phage	61.2	1.7e-55
VDZ31276.1|2485676_2486096_+	exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
2486040:2486055	attL	AGGAGAAGCAGGCTAT	NA	NA	NA	NA
VDZ31277.1|2486129_2487470_+|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VDZ31278.1|2487906_2488239_-	Qin prophage protein	NA	NA	NA	NA	NA
VDZ31279.1|2488771_2489011_+	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VDZ31280.1|2489010_2489298_+	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VDZ31281.1|2489369_2489525_+	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
2489356:2489371	attR	AGGAGAAGCAGGCTAT	NA	NA	NA	NA
VDZ31282.1|2489741_2489993_+	putative prophage protein	NA	NA	NA	NA	NA
VDZ31283.1|2490339_2491389_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	2.2e-112
VDZ31284.1|2491402_2492155_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VDZ31285.1|2492576_2492789_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
VDZ31286.1|2494067_2494274_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VDZ31287.1|2494278_2494590_+	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VDZ31288.1|2494586_2495120_+	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VDZ31289.1|2495116_2495614_+	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	3.7e-06
VDZ31290.1|2496399_2497380_-|transposase	IS5 transposase and trans-activator	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
VDZ31291.1|2497425_2497614_-	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	89.5	2.6e-21
VDZ31292.1|2497914_2498121_+	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
VDZ31293.1|2498141_2498309_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31294.1|2498693_2499221_+|terminase	putative terminase small subunit	terminase	A5LH26	Enterobacteria_phage	100.0	2.1e-92
VDZ31295.1|2499229_2501329_+|terminase	terminase large subunit	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
VDZ31296.1|2501325_2501538_+	prophage protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
VDZ31297.1|2501537_2503046_+|head,tail,portal	portal protein (head-tail preconnector protein) from prophage	head,tail,portal	K7PJP3	Enterobacteria_phage	99.4	1.0e-288
VDZ31298.1|2502990_2505018_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A291AWT6	Escherichia_phage	99.1	0.0e+00
VDZ31299.1|2505104_2505428_+	prophage protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
VDZ31300.1|2505420_2505696_+	prophage protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
VDZ31301.1|2505707_2506286_+|tail	Minor tail protein Z (GPZ) of prophage	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
VDZ31302.1|2506282_2506684_+|tail	Minor tail protein U	tail	A0A291AWY2	Escherichia_phage	99.2	1.1e-72
VDZ31303.1|2506694_2507438_+|tail	Major tail protein V	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
VDZ31304.1|2507498_2507885_+|tail	minor tail component of prophage	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
VDZ31305.1|2507893_2508223_+|tail	minor tail protein T of prophage	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
VDZ31306.1|2508194_2511260_+|tail	putative tail length tape measure protein from putative prophage	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
VDZ31307.1|2511259_2511589_+|tail	Minor tail protein M	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
VDZ31308.1|2511598_2512297_+|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	98.7	3.3e-133
VDZ31309.1|2512446_2513046_+|tail	tail component	tail	K7PLW1	Enterobacteria_phage	96.5	2.0e-118
VDZ31310.1|2513042_2513591_+	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	97.8	5.8e-93
VDZ31311.1|2513651_2517065_+|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
VDZ31312.1|2517135_2517735_+	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	98.0	9.7e-110
VDZ31313.1|2517799_2520760_+|tail	putative tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	54.2	1.4e-55
>prophage 8
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	2716022	2769246	5295029	tRNA,lysis,coat,tail,integrase,terminase	Escherichia_phage(53.33%)	60	2707194:2707209	2768407:2768422
2707194:2707209	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
VDZ31470.1|2716022_2719094_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
VDZ31471.1|2719158_2719758_-	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
VDZ31472.1|2719828_2723242_-|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
VDZ31473.1|2723302_2723851_-	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	97.8	5.8e-93
VDZ31474.1|2723847_2724447_-|tail	tail component	tail	K7PLW1	Enterobacteria_phage	96.5	2.0e-118
VDZ31475.1|2724596_2725295_-|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	95.7	8.4e-129
VDZ31476.1|2725294_2725591_-|tail	putative phage minor tail protein	tail	H6WZM2	Escherichia_phage	52.0	1.8e-24
VDZ31477.1|2725625_2728859_-|tail	putative phage tail length tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	1.9e-111
VDZ31478.1|2729332_2729782_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31479.1|2729842_2730805_-	Uncharacterised protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
VDZ31480.1|2730831_2731224_-	phage protein	NA	NA	NA	NA	NA
VDZ31481.1|2731220_2731601_-	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
VDZ31482.1|2731601_2731985_-	Uncharacterised protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
VDZ31483.1|2731984_2732380_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31484.1|2732383_2732560_-	Uncharacterised protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
VDZ31485.1|2732602_2733742_-|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
VDZ31486.1|2733840_2734605_-	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
VDZ31487.1|2734709_2735825_-	phage protein	NA	I6PD76	Cronobacter_phage	54.4	3.2e-114
VDZ31488.1|2735805_2737212_-	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
VDZ31489.1|2737214_2738516_-|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
VDZ31490.1|2738496_2739591_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	7.7e-113
VDZ31491.1|2739594_2739804_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31492.1|2739781_2740714_-	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.2	4.6e-82
VDZ31493.1|2740706_2741495_-	ParB-like nuclease	NA	R4TG31	Halovirus	40.7	9.7e-49
VDZ31494.1|2741632_2743057_-	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VDZ31495.1|2743227_2743692_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	95.4	1.6e-72
VDZ31496.1|2743688_2744186_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
VDZ31497.1|2744185_2744401_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
VDZ31498.1|2744652_2745048_-	tolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VDZ31499.1|2745198_2745627_-	TolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VDZ31500.1|2746405_2746543_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31501.1|2746671_2747214_-	antitermination protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
VDZ31502.1|2747210_2747501_-	phage protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
VDZ31503.1|2747500_2748100_-	phage protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
VDZ31504.1|2748914_2749253_+	tellurite resistance protein	NA	NA	NA	NA	NA
VDZ31505.1|2749873_2750875_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31506.1|2750890_2751913_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31507.1|2752051_2752468_-	exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	91.9	3.6e-63
VDZ31508.1|2752483_2753245_-	transcription regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	90.1	2.0e-120
VDZ31509.1|2753267_2754014_-	putative phage DNA replication protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
VDZ31510.1|2754020_2754878_-	phage protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
VDZ31511.1|2754890_2755313_-	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
VDZ31512.1|2755309_2755564_-	putative phage regultory protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
VDZ31513.1|2755643_2756063_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
VDZ31514.1|2756353_2756488_+	Rac prophage protein	NA	NA	NA	NA	NA
VDZ31515.1|2756498_2756654_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
VDZ31516.1|2756650_2757262_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VDZ31517.1|2757580_2757802_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
VDZ31518.1|2757801_2757972_+	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
VDZ31519.1|2758046_2758322_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
VDZ31520.1|2758423_2761024_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
VDZ31521.1|2761016_2761826_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
VDZ31522.1|2762068_2762257_+	Rac prophage; predicted protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
VDZ31523.1|2762356_2762572_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VDZ31524.1|2762573_2763809_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
VDZ31525.1|2763860_2764796_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.1	3.8e-145
VDZ31526.1|2764924_2766298_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VDZ31527.1|2766330_2766501_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31528.1|2766775_2767759_-	zinc transport protein	NA	NA	NA	NA	NA
VDZ31529.1|2768013_2769246_+	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2768407:2768422	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 9
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	3091728	3127160	5295029	transposase	Saccharomonospora_phage(33.33%)	25	NA	NA
VDZ31844.1|3091728_3093057_+|transposase	transposase insG	transposase	NA	NA	NA	NA
VDZ31845.1|3093045_3093393_-|transposase	transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.9e-09
VDZ31846.1|3093839_3094910_-	phospholipase	NA	NA	NA	NA	NA
VDZ31847.1|3094906_3095812_-	Methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
VDZ31848.1|3095808_3098193_-	putative vimentin	NA	NA	NA	NA	NA
VDZ31849.1|3098303_3101150_-	putative antigen 43 precursor (fluffing protein)	NA	NA	NA	NA	NA
VDZ31850.1|3101521_3102394_-	putative GTP-binding protein	NA	NA	NA	NA	NA
VDZ31851.1|3102694_3102991_+	putative replication protein	NA	NA	NA	NA	NA
VDZ31852.1|3103281_3103515_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31853.1|3105364_3105907_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31854.1|3105942_3107079_-	Putative beta-lactamase hcpC precursor	NA	NA	NA	NA	NA
VDZ31855.1|3107740_3107923_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	67.2	1.1e-19
VDZ31856.1|3108029_3109292_-	cobalamin synthesis protein	NA	NA	NA	NA	NA
VDZ31857.1|3109492_3110284_-	Nickel uptake substrate-specific transmembrane region	NA	NA	NA	NA	NA
VDZ31858.1|3110302_3112273_-	putative outer membrane heme/hemoglobin receptor	NA	NA	NA	NA	NA
VDZ31859.1|3112618_3113512_+	Transposase for transposon Tn5	NA	NA	NA	NA	NA
VDZ31860.1|3113637_3113982_+|transposase	transposase	transposase	NA	NA	NA	NA
VDZ31861.1|3113969_3114086_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ31862.1|3115175_3115493_+|transposase	transposase InsG for insertion sequence element IS4	transposase	NA	NA	NA	NA
VDZ31863.1|3116382_3117498_+	IroB	NA	NA	NA	NA	NA
VDZ31864.1|3117637_3121297_+	IroC	NA	W8CYL7	Bacillus_phage	29.8	3.6e-45
VDZ31865.1|3121400_3122630_+	esterase	NA	NA	NA	NA	NA
VDZ31866.1|3122714_3123671_+	IroE protein	NA	NA	NA	NA	NA
VDZ31867.1|3123715_3125893_-	outer membrane receptor FepA	NA	NA	NA	NA	NA
VDZ31868.1|3126134_3127160_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	3297022	3357231	5295029	tRNA,transposase	Escherichia_phage(15.79%)	59	NA	NA
VDZ32022.1|3297022_3298315_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
VDZ32023.1|3298405_3299749_-	putative ATPase	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
VDZ32024.1|3299759_3300371_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VDZ32025.1|3300529_3304636_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
VDZ32026.1|3304770_3305265_-	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VDZ32027.1|3305809_3306775_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	3.2e-62
VDZ32028.1|3306897_3308664_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
VDZ32029.1|3308664_3310386_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
VDZ32030.1|3310427_3311132_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VDZ32031.1|3311416_3311635_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VDZ32032.1|3312125_3312968_-	putative restriction methylase	NA	NA	NA	NA	NA
VDZ32033.1|3313052_3313250_-	Aec78	NA	NA	NA	NA	NA
VDZ32034.1|3313261_3313753_-	aec77	NA	NA	NA	NA	NA
VDZ32035.1|3313749_3314124_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VDZ32036.1|3314214_3314568_-	antitoxin of the YeeV-YeeU toxin-antitoxin system; CP4-44 prophage	NA	NA	NA	NA	NA
VDZ32037.1|3314643_3314865_-	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
VDZ32038.1|3314927_3315404_-	putative DNA repair protein	NA	NA	NA	NA	NA
VDZ32039.1|3315419_3315893_-	antirestriction protein	NA	NA	NA	NA	NA
VDZ32040.1|3315986_3316232_-	antirestriction protein	NA	NA	NA	NA	NA
VDZ32041.1|3316231_3317053_-	CP4-57 prophage protein	NA	A0A2C9CX26	Yersinia_phage	37.8	8.8e-45
VDZ32042.1|3317273_3317684_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32043.1|3317699_3318383_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32044.1|3318516_3319587_-	patatin-like phospholipase family	NA	NA	NA	NA	NA
VDZ32045.1|3319583_3320489_-	Methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
VDZ32046.1|3320485_3322882_-	putative vimentin	NA	NA	NA	NA	NA
VDZ32047.1|3322992_3326112_-	CP4-44 prophage; antigen 43 (Ag43)phase-variable biofilm formation autotransporter	NA	NA	NA	NA	NA
VDZ32048.1|3326441_3327314_-	putative GTP-binding protein	NA	NA	NA	NA	NA
VDZ32049.1|3327644_3327803_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32050.1|3328039_3328129_-|transposase	IS66 transposase	transposase	NA	NA	NA	NA
VDZ32051.1|3328125_3328551_-|transposase	IS66 transposase	transposase	Q6H9S5	Enterobacteria_phage	92.5	1.1e-43
VDZ32052.1|3328708_3329950_-	TerF	NA	NA	NA	NA	NA
VDZ32053.1|3330154_3331135_-|transposase	IS5 transposase and trans-activator	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
VDZ32054.1|3331585_3332161_-	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
VDZ32055.1|3332229_3332808_-	TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
VDZ32056.1|3332856_3333897_-	TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
VDZ32057.1|3333919_3334375_-	TerB	NA	NA	NA	NA	NA
VDZ32058.1|3334397_3335555_-	TerA	NA	NA	NA	NA	NA
VDZ32059.1|3335554_3336136_-	TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
VDZ32060.1|3336458_3337517_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
VDZ32061.1|3337526_3338669_+	Protein of uncharacterised function (DUF3706)	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
VDZ32062.1|3338661_3339435_+	Predicted hydrolase (HAD superfamily)	NA	NA	NA	NA	NA
VDZ32063.1|3339436_3340516_+	putative ATP-binding protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	1.8e-37
VDZ32064.1|3340515_3341472_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
VDZ32065.1|3341482_3342691_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32066.1|3342708_3343176_+	TerW	NA	NA	NA	NA	NA
VDZ32067.1|3343481_3343643_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32068.1|3343639_3344278_+	TerY1	NA	NA	NA	NA	NA
VDZ32069.1|3344300_3344939_+	TerX	NA	NA	NA	NA	NA
VDZ32070.1|3344938_3345577_+	TerY2	NA	NA	NA	NA	NA
VDZ32071.1|3345661_3346702_+	TerY3	NA	NA	NA	NA	NA
VDZ32072.1|3346701_3348339_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32073.1|3348364_3349864_+	putative protein kinase	NA	NA	NA	NA	NA
VDZ32074.1|3349972_3350620_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	97.0	6.8e-109
VDZ32075.1|3352244_3352490_+|transposase	transposase	transposase	NA	NA	NA	NA
VDZ32076.1|3352607_3353546_-	cell density-dependent motility repressor	NA	NA	NA	NA	NA
VDZ32077.1|3353896_3354616_+	aspartate racemase	NA	NA	NA	NA	NA
VDZ32078.1|3354681_3355980_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
VDZ32079.1|3356223_3356937_-	IS600 orfB	NA	A0A0P0I4A4	Acinetobacter_phage	46.8	1.9e-59
VDZ32080.1|3357021_3357231_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
>prophage 11
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	3753264	3809160	5295029	protease,lysis,capsid,portal,tRNA,coat,tail,integrase,head,terminase	Enterobacteria_phage(61.54%)	67	3752796:3752842	3798963:3799009
3752796:3752842	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VDZ32429.1|3753264_3754218_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VDZ32430.1|3754404_3755889_+|protease	putative protease	protease	NA	NA	NA	NA
VDZ32431.1|3756446_3757103_+	methylase	NA	NA	NA	NA	NA
VDZ32432.1|3757741_3760702_-|tail	putative tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
VDZ32433.1|3760766_3761366_-	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
VDZ32434.1|3761436_3764850_-|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
VDZ32435.1|3764910_3765483_-|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	98.9	2.6e-83
VDZ32436.1|3765479_3766223_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
VDZ32437.1|3766228_3766927_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	8.9e-131
VDZ32438.1|3766926_3767256_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
VDZ32439.1|3767252_3769814_-|tail	tail component of prophage	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
VDZ32440.1|3769806_3770241_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VDZ32441.1|3770222_3770645_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
VDZ32442.1|3770660_3771401_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
VDZ32443.1|3771408_3771804_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
VDZ32444.1|3771800_3772379_-|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
VDZ32445.1|3772369_3772744_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
VDZ32446.1|3772755_3773151_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
VDZ32447.1|3773192_3774218_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
VDZ32448.1|3774273_3774606_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	98.2	7.1e-54
VDZ32449.1|3774615_3775935_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	98.9	2.1e-234
VDZ32450.1|3775915_3777517_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
VDZ32451.1|3777513_3777720_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VDZ32452.1|3777716_3779642_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
VDZ32453.1|3779616_3780162_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
VDZ32454.1|3781104_3781398_+	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
VDZ32455.1|3781429_3781891_-	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
VDZ32456.1|3781887_3782385_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
VDZ32457.1|3782384_3782600_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VDZ32458.1|3783188_3784271_+	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
VDZ32459.1|3784459_3784843_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
VDZ32460.1|3784928_3785066_-	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	70.7	1.1e-08
VDZ32461.1|3785065_3785428_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
VDZ32462.1|3785424_3785715_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
VDZ32463.1|3785707_3785878_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
VDZ32464.1|3785877_3786333_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
VDZ32465.1|3786554_3786956_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32466.1|3786934_3787351_-	HEPN domain	NA	NA	NA	NA	NA
VDZ32467.1|3787650_3788259_-	antirepressor protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
VDZ32468.1|3789011_3789359_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32469.1|3789563_3790265_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
VDZ32470.1|3790261_3791266_-	replication protein O	NA	M1FN81	Enterobacteria_phage	67.0	4.8e-109
VDZ32471.1|3791277_3791817_-	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
VDZ32472.1|3791886_3792117_-	Cro	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
VDZ32473.1|3792155_3792911_+	Regulatory protein CI from bacteriophage origin	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
VDZ32474.1|3792992_3793256_+	Uncharacterised protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
VDZ32475.1|3793433_3793712_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32476.1|3794262_3794469_+	prophage Kil protein	NA	K7P6H3	Enterobacteria_phage	83.8	3.5e-27
VDZ32477.1|3794544_3794841_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
VDZ32478.1|3794846_3795632_+	bacteriophage recombination protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
VDZ32479.1|3795628_3796309_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
VDZ32480.1|3796305_3796488_+	phage protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
VDZ32481.1|3796460_3796652_+	phage protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
VDZ32482.1|3796728_3796944_+	ybl17	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
VDZ32483.1|3797042_3797261_+	ybl16	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
VDZ32484.1|3797308_3797587_+	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
VDZ32485.1|3797785_3798949_+|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
VDZ32486.1|3799283_3799916_+	two component transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
3798963:3799009	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VDZ32487.1|3799918_3800434_-	fimbrial protein	NA	NA	NA	NA	NA
VDZ32488.1|3800444_3801452_-	fimbrial protein	NA	NA	NA	NA	NA
VDZ32489.1|3801464_3804074_-	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VDZ32490.1|3804104_3804797_-	fimbrial chaperone	NA	NA	NA	NA	NA
VDZ32491.1|3805016_3805559_-	fimbrial-like protein	NA	NA	NA	NA	NA
VDZ32492.1|3806029_3806896_+	5,10-methylene-tetrahydrofolate dehydrogenase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
VDZ32493.1|3806897_3807110_+	putative RNA-binding protein	NA	NA	NA	NA	NA
VDZ32494.1|3807217_3807739_+	putative membrane-bound metal-dependent hydrolase	NA	NA	NA	NA	NA
VDZ32495.1|3807774_3809160_-|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 12
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	3846744	3935487	5295029	protease,tRNA,transposase	Bacillus_phage(33.33%)	60	NA	NA
VDZ32528.1|3846744_3847662_+|protease	protease, membrane anchored	protease	NA	NA	NA	NA
VDZ32529.1|3847658_3848117_+	nodulation efficiency family protein	NA	NA	NA	NA	NA
VDZ32530.1|3848219_3848582_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32531.1|3848948_3849965_+	adhesin/invasin-like protein	NA	NA	NA	NA	NA
VDZ32532.1|3850049_3850472_+	putative lipoprotein	NA	NA	NA	NA	NA
VDZ32533.1|3850468_3850672_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ32534.1|3850675_3851083_-	DNA-binding transcriptional regulator CueR	NA	NA	NA	NA	NA
VDZ32535.1|3851079_3852255_-	type I secretion system protein	NA	NA	NA	NA	NA
VDZ32536.1|3852251_3854414_-	type I secretion system, ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	1.0e-23
VDZ32537.1|3854417_3875144_-	adhesin for cattle intestine colonization	NA	NA	NA	NA	NA
VDZ32538.1|3875246_3876602_-	putative type I secretion protein	NA	NA	NA	NA	NA
VDZ32539.1|3876939_3878232_-	putative amino acid permease	NA	NA	NA	NA	NA
VDZ32540.1|3878234_3879167_-	glutaminase 1	NA	NA	NA	NA	NA
VDZ32541.1|3879428_3881933_+	copper-transporting P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.4	1.3e-115
VDZ32542.1|3882114_3882636_+|transposase	transposase	transposase	NA	NA	NA	NA
VDZ32543.1|3882860_3883463_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.3e-61
VDZ32544.1|3883684_3884080_-	XRE family plasmid maintenance system antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	3.1e-40
VDZ32545.1|3885161_3885641_+|tRNA	protein YbaK containing prolyl-tRNA synthetase associated domain	tRNA	NA	NA	NA	NA
VDZ32546.1|3885677_3887330_-	protein UshA precursor [includes: UDP-sugar hydrolase; 5'-nucleotidase]	NA	NA	NA	NA	NA
VDZ32547.1|3887547_3888768_+	fosmidomycin resistance protein	NA	NA	NA	NA	NA
VDZ32548.1|3889005_3890682_+	putative transport protein	NA	NA	NA	NA	NA
VDZ32549.1|3890815_3892120_-	inosine-guanosine kinase	NA	NA	NA	NA	NA
VDZ32550.1|3892271_3893231_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.9e-15
VDZ32551.1|3893227_3894190_-	ferrochelatase	NA	NA	NA	NA	NA
VDZ32552.1|3894321_3895026_-	adenylate kinase	NA	NA	NA	NA	NA
VDZ32553.1|3895146_3897021_-	chaperone (heat shock protein)	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
VDZ32554.1|3897130_3897736_-	recombination and repair protein RecR	NA	NA	NA	NA	NA
VDZ32555.1|3897735_3898065_-	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDZ32556.1|3900183_3900735_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
VDZ32557.1|3900887_3901265_-	inner membrane protein	NA	NA	NA	NA	NA
VDZ32558.1|3901334_3901862_+	primosomal replication protein N	NA	NA	NA	NA	NA
VDZ32559.1|3901875_3902037_+	small protein involved in the cell envelope stress response	NA	NA	NA	NA	NA
VDZ32560.1|3902248_3905611_-	potassium efflux protein	NA	NA	NA	NA	NA
VDZ32561.1|3905738_3906386_-	acrAB operon repressor	NA	NA	NA	NA	NA
VDZ32562.1|3906527_3907721_+	acriflavin resistance protein A	NA	NA	NA	NA	NA
VDZ32563.1|3907743_3910893_+	acriflavin resistance protein B	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
VDZ32564.1|3911438_3911813_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDZ32565.1|3911838_3912057_+	hemolysin expression-modulating protein	NA	NA	NA	NA	NA
VDZ32566.1|3912228_3912780_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
VDZ32567.1|3912895_3913366_+	inner membrane protein	NA	NA	NA	NA	NA
VDZ32568.1|3913529_3915080_+	putative signal transduction protein	NA	NA	NA	NA	NA
VDZ32569.1|3915121_3915475_-	RNA signal recognition particle 4.5S RNA	NA	NA	NA	NA	NA
VDZ32570.1|3915853_3916165_+	methylated DNA-protein cysteine alkyltransferase	NA	NA	NA	NA	NA
VDZ32571.1|3916195_3916768_-	putative lipoprotein	NA	NA	NA	NA	NA
VDZ32572.1|3916985_3917846_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
VDZ32573.1|3917894_3919181_-	ammonia channel precursor (ammonia transporter)	NA	NA	NA	NA	NA
VDZ32574.1|3919210_3919549_-	glutamine synthetase	NA	NA	NA	NA	NA
VDZ32575.1|3919729_3921511_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	5.2e-42
VDZ32576.1|3921503_3923276_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
VDZ32577.1|3923305_3923764_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
VDZ32578.1|3923916_3924735_-	putative hydrolase	NA	NA	NA	NA	NA
VDZ32579.1|3924834_3926535_+	bacterial extracellular solute-binding protein, family 5	NA	NA	NA	NA	NA
VDZ32580.1|3926599_3927295_+	queuosine biosynthesis protein QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
VDZ32581.1|3927346_3927745_-	thioesterase protein YbaW	NA	NA	NA	NA	NA
VDZ32582.1|3927850_3928222_-	putative DNA uptake protein	NA	NA	NA	NA	NA
VDZ32583.1|3928372_3930244_-	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VDZ32584.1|3930435_3930708_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
VDZ32585.1|3930916_3933271_-|protease	DNA-binding ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
VDZ32586.1|3933458_3934733_-|protease	ATP-dependent specificity component of ClpP serine protease	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
VDZ32587.1|3934863_3935487_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 13
LR134092	Escherichia coli strain NCTC10444 genome assembly, chromosome: 1	5295029	4536977	4667412	5295029	tRNA,integrase,transposase	Shigella_phage(26.67%)	106	4572767:4572784	4651717:4651734
VDZ33116.1|4536977_4537223_+|transposase	transposase, IS4 family protein	transposase	NA	NA	NA	NA
VDZ33117.1|4538175_4540290_-	UvrD/REP helicase	NA	G3MA40	Bacillus_virus	24.1	5.9e-08
VDZ33118.1|4540286_4546628_-	helicase superfamily protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.1	2.9e-58
VDZ33119.1|4546627_4551559_-	Type I restriction-modification system methyltransferase subunit	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	20.8	2.4e-28
VDZ33120.1|4551561_4553625_-	helicase domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	22.9	4.8e-15
VDZ33121.1|4553774_4554419_-	helicase domain-containing protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	30.3	1.0e-11
VDZ33122.1|4554642_4560957_-	helicase superfamily protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.4	2.6e-35
VDZ33123.1|4560956_4564316_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33124.1|4564527_4566180_+	Apolipoprotein A1/A4/E domain	NA	NA	NA	NA	NA
VDZ33125.1|4566186_4566894_+	flagellar motor protein MotS	NA	NA	NA	NA	NA
VDZ33126.1|4566897_4568001_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33127.1|4568245_4568554_+	N-acetylneuraminate epimerase 2	NA	NA	NA	NA	NA
VDZ33128.1|4568540_4569413_+	putative restriction endonuclease	NA	NA	NA	NA	NA
VDZ33129.1|4570035_4572072_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33130.1|4572567_4572786_-	Uncharacterised protein	NA	NA	NA	NA	NA
4572767:4572784	attL	CGAAGGCCGGACTCGAAC	NA	NA	NA	NA
VDZ33131.1|4573024_4573171_-	putative restriction methylase	NA	NA	NA	NA	NA
VDZ33132.1|4573255_4573453_-	Aec78	NA	NA	NA	NA	NA
VDZ33133.1|4573472_4573961_-	aec77	NA	NA	NA	NA	NA
VDZ33134.1|4573957_4574335_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
VDZ33135.1|4574381_4574756_-	intergenic-region protein	NA	NA	NA	NA	NA
VDZ33136.1|4574835_4575057_-	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
VDZ33137.1|4575143_4575620_-	putative DNA repair protein	NA	NA	NA	NA	NA
VDZ33138.1|4575634_4576114_-	putative antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
VDZ33139.1|4576379_4577198_-	CP4-57 prophage protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
VDZ33140.1|4577287_4577521_-	CP4-6 prophage protein	NA	NA	NA	NA	NA
VDZ33141.1|4577526_4578204_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33142.1|4578351_4579032_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VDZ33143.1|4579129_4579267_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33144.1|4579234_4580119_-	putative ATP/GTP-binding protein	NA	NA	NA	NA	NA
VDZ33145.1|4580224_4581187_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33146.1|4581183_4582038_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33147.1|4584029_4584761_+	malate transporter	NA	NA	NA	NA	NA
VDZ33148.1|4585270_4585723_+	putative transferase	NA	NA	NA	NA	NA
VDZ33149.1|4586216_4586957_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VDZ33150.1|4588374_4588941_+	Protein of uncharacterised function (DUF3296)	NA	NA	NA	NA	NA
VDZ33151.1|4589187_4589763_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33152.1|4589831_4590068_+	putative regulatory protein	NA	NA	NA	NA	NA
VDZ33153.1|4590064_4590223_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33154.1|4590310_4590859_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33155.1|4591218_4591392_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33156.1|4592114_4592549_+	H-NS histone family protein	NA	NA	NA	NA	NA
VDZ33157.1|4592965_4593445_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33158.1|4593635_4594868_-	deoxyguanosinetriphosphate triphosphohydrolase-like protein	NA	NA	NA	NA	NA
VDZ33159.1|4595018_4595885_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VDZ33160.1|4595881_4596187_-|transposase	putative transposase-related protein	transposase	NA	NA	NA	NA
VDZ33161.1|4596328_4596538_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	97.1	2.8e-32
VDZ33162.1|4596538_4596832_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	89.0	4.2e-42
VDZ33163.1|4597317_4597839_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VDZ33164.1|4597835_4598789_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VDZ33165.1|4598875_4601200_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
VDZ33166.1|4601244_4602147_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VDZ33167.1|4602143_4603142_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VDZ33168.1|4603138_4604095_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VDZ33169.1|4604095_4604863_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VDZ33170.1|4605377_4605584_-|transposase	transposase (partial)	transposase	Q716C2	Shigella_phage	100.0	1.3e-34
VDZ33171.1|4605650_4606031_-|integrase	putative integrase	integrase	Q716C2	Shigella_phage	100.0	1.0e-72
VDZ33172.1|4606292_4607444_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VDZ33173.1|4607400_4607769_-	CP4-6 prophage; partial regulator of insertion element IS911A	NA	Q716C1	Shigella_phage	98.9	2.5e-39
VDZ33174.1|4608448_4608862_-	PGA biosynthesis protein	NA	NA	NA	NA	NA
VDZ33175.1|4608863_4610189_-	N-glycosyltransferase	NA	NA	NA	NA	NA
VDZ33176.1|4610181_4612200_-	lipoprotein YcdR	NA	NA	NA	NA	NA
VDZ33177.1|4612208_4614707_-	outer membrane protein PgaA	NA	NA	NA	NA	NA
VDZ33178.1|4615132_4616500_+	putative diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	3.3e-20
VDZ33179.1|4616677_4617031_+|transposase	transposase	transposase	F6MIM4	Haemophilus_phage	64.2	1.4e-10
VDZ33180.1|4617150_4617600_+|transposase	IS1414, transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	30.3	4.7e-08
VDZ33181.1|4617658_4618114_-|integrase	integrase core domain-containing protein	integrase	Q716C2	Shigella_phage	51.0	3.4e-38
VDZ33182.1|4618397_4618667_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ33183.1|4619044_4619683_-	ribose/galactose isomerase	NA	NA	NA	NA	NA
VDZ33184.1|4619914_4621087_+	putative oligogalacturonide lyase	NA	NA	NA	NA	NA
VDZ33185.1|4621115_4621916_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
VDZ33186.1|4621970_4622294_+	barrel cupin 2 domain-containing protein	NA	NA	NA	NA	NA
VDZ33187.1|4622659_4624174_+	putative oligogalacturonide transporter	NA	NA	NA	NA	NA
VDZ33188.1|4624175_4626410_+	exopolygalacturonate lyase	NA	NA	NA	NA	NA
VDZ33189.1|4626520_4627483_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33190.1|4628322_4628781_-	membraneprotein	NA	NA	NA	NA	NA
VDZ33191.1|4629021_4629927_-	IS2 element protein	NA	Q9ZXG3	Shigella_phage	97.0	4.2e-173
VDZ33192.1|4629884_4630250_-|transposase	transposase	transposase	Q76S41	Shigella_phage	99.2	3.6e-59
VDZ33193.1|4631158_4631284_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VDZ33194.1|4631326_4631572_+|transposase	putative transposase	transposase	Q2A0A7	Sodalis_phage	58.4	6.7e-17
VDZ33195.1|4631630_4632107_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VDZ33196.1|4632541_4637251_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33197.1|4637247_4639479_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33198.1|4639709_4639877_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33199.1|4640224_4640950_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VDZ33200.1|4641226_4641754_+	putative fimbrial protein FanC	NA	NA	NA	NA	NA
VDZ33201.1|4641853_4644262_+	putative fimbrial usher protein FanD	NA	NA	NA	NA	NA
VDZ33202.1|4644254_4644947_+	putative fimbrial assembly chaperone FanE	NA	NA	NA	NA	NA
VDZ33203.1|4644933_4645455_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33204.1|4645933_4646365_+	inner membrane protein	NA	NA	NA	NA	NA
VDZ33205.1|4646398_4647259_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ33206.1|4647543_4648272_+	heat resistant agglutinin 1	NA	NA	NA	NA	NA
VDZ33207.1|4648560_4649931_+	putative membrane-associated, metal-dependent hydrolase	NA	NA	NA	NA	NA
VDZ33208.1|4650259_4651525_-|integrase	phage integrase family site specific recombinase	integrase	Q7M297	Enterobacteria_phage	38.0	1.7e-79
VDZ33209.1|4651478_4651673_-	Su+6 (supP) amber suppressor transfer RNA-Leu	NA	NA	NA	NA	NA
VDZ33210.1|4651990_4653010_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.6e-43
4651717:4651734	attR	CGAAGGCCGGACTCGAAC	NA	NA	NA	NA
VDZ33211.1|4653013_4653577_-	D-gluconate kinase	NA	NA	NA	NA	NA
VDZ33212.1|4653793_4654825_+	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
VDZ33213.1|4654848_4655613_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
VDZ33214.1|4655674_4656994_+	Gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
VDZ33215.1|4657060_4658059_+	L-idonate regulatory protein	NA	NA	NA	NA	NA
VDZ33216.1|4658136_4659639_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
VDZ33217.1|4659799_4660882_-	putative permease	NA	NA	NA	NA	NA
VDZ33218.1|4660881_4661961_-	putative permease	NA	NA	NA	NA	NA
VDZ33219.1|4662248_4663760_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
VDZ33220.1|4664113_4664557_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VDZ33221.1|4664556_4667412_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
