The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	311280	317684	5249174	transposase	uncultured_Caudovirales_phage(66.67%)	8	NA	NA
VDY97481.1|311280_312822_+|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VDY97483.1|312836_313583_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VDY97485.1|313999_315013_-	putative permease	NA	NA	NA	NA	NA
VDY97487.1|315119_315416_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
VDY97489.1|315549_315723_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.6	2.0e-15
VDY97491.1|315731_315974_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	75.0	4.3e-16
VDY97493.1|315986_317276_-	arsenical pump membrane protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
VDY97495.1|317330_317684_-	DNA-binding transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 2
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	877729	940166	5249174	transposase,integrase	Moraxella_phage(20.0%)	60	875618:875632	891555:891569
875618:875632	attL	CAGTCATTCGCTTGT	NA	NA	NA	NA
VDY98689.1|877729_878365_-|integrase	integrase family protein	integrase	B7SYF8	Stenotrophomonas_phage	42.7	2.4e-34
VDY98691.1|878576_878996_-	ybl123	NA	A0A1B0VMI6	Pseudomonas_phage	50.4	1.2e-26
VDY98693.1|879290_879860_-	ybl125	NA	NA	NA	NA	NA
VDY98695.1|879956_880154_-	Aec78	NA	NA	NA	NA	NA
VDY98697.1|880165_880654_-	aec77	NA	NA	NA	NA	NA
VDY98699.1|880650_881025_-	phage protein	NA	NA	NA	NA	NA
VDY98701.1|881114_881483_-	antitoxin of the YeeV-YeeU toxin-antitoxin system; CP4-44 prophage	NA	NA	NA	NA	NA
VDY98703.1|881562_881784_-	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
VDY98705.1|881870_882347_-	putative DNA repair protein	NA	NA	NA	NA	NA
VDY98707.1|882361_882847_-	anti-restriction protein	NA	A9J566	Pseudomonas_phage	31.7	5.3e-13
VDY98709.1|882937_883756_-	CP4-57 prophage protein	NA	A0A2C9CX26	Yersinia_phage	39.1	4.2e-47
VDY98711.1|883844_884078_-	CP4-6 prophage protein	NA	NA	NA	NA	NA
VDY98713.1|884083_884761_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY98715.1|884908_885589_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VDY98717.1|885686_885863_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY98719.1|885791_886676_-	putative ATP/GTP-binding protein	NA	NA	NA	NA	NA
VDY98721.1|886860_887013_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY98723.1|887214_887388_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY98725.1|889621_889750_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VDY98727.1|890418_891003_+	malate transporter	NA	NA	NA	NA	NA
VDY98729.1|891927_892140_+	iron-regulated outer membrane virulence protein	NA	NA	NA	NA	NA
891555:891569	attR	ACAAGCGAATGACTG	NA	NA	NA	NA
VDY98731.1|892307_892931_+	iron-regulated outer membrane virulence protein	NA	NA	NA	NA	NA
VDY98733.1|892894_893827_+	iron-regulated outer membrane virulence protein	NA	NA	NA	NA	NA
VDY98735.1|893811_893973_+	iron-regulated outer membrane virulence protein	NA	NA	NA	NA	NA
VDY98737.1|894106_895315_+|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	49.7	5.4e-51
VDY98739.1|896375_896942_+	Protein of uncharacterised function (DUF3296)	NA	NA	NA	NA	NA
VDY98741.1|897189_897750_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY98743.1|897818_898052_+	putative regulatory protein	NA	NA	NA	NA	NA
VDY98745.1|898587_898866_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY98747.1|899132_899756_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VDY98749.1|899853_900087_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY98751.1|900450_902217_+	putative hemolysin activator ShlB-type	NA	A0A0R6PI85	Moraxella_phage	25.5	4.6e-22
VDY98753.1|902229_910197_+	hemagglutinin-related protein	NA	A0A0R6PJK4	Moraxella_phage	33.5	1.3e-28
VDY98755.1|910193_911957_+	hemagglutinin-related protein	NA	NA	NA	NA	NA
VDY98757.1|911953_912340_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY98759.1|912370_912748_+	protein encoded within IS	NA	A0A0P0ZBS5	Stx2-converting_phage	98.1	1.7e-56
VDY98761.1|912914_913385_+	ImpA-related N-terminal family protein	NA	NA	NA	NA	NA
VDY98763.1|913368_913896_+	TraG-like protein, N-terminal region	NA	NA	NA	NA	NA
VDY98765.1|913905_914262_+	TraG-like protein, N-terminal region	NA	NA	NA	NA	NA
VDY98767.1|914642_915689_+	modification methylase	NA	A0A0R6PG08	Moraxella_phage	43.0	2.0e-65
VDY98769.1|915729_918654_+	ATPase	NA	A0A1B5FPD5	Escherichia_phage	24.3	3.9e-34
VDY98771.1|918667_920335_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY98773.1|921015_921282_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY98775.1|921310_921631_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY98777.1|921769_921859_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY98779.1|922492_924031_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	2.6e-21
VDY98781.1|924090_924750_-	response regulator	NA	W8CYM9	Bacillus_phage	33.2	1.8e-24
VDY98783.1|924890_925490_+	putative transmembrane hydrogenase cytochrome b-type subunit oxidoreductase protein	NA	NA	NA	NA	NA
VDY98785.1|925489_926290_+	oxidoreductase	NA	NA	NA	NA	NA
VDY98787.1|926286_926529_+	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
VDY98789.1|927712_928138_+	hemolysin C	NA	NA	NA	NA	NA
VDY98791.1|928235_929594_+	hemolysin A	NA	NA	NA	NA	NA
VDY98793.1|929677_931309_+	hemolysin A	NA	NA	NA	NA	NA
VDY98795.1|931379_931928_+	alpha-hemolysin translocation ATP-binding protein HlyB	NA	NA	NA	NA	NA
VDY98797.1|931912_933502_+	alpha-hemolysin translocation ATP-binding protein HlyB	NA	W8CYL7	Bacillus_phage	31.0	4.3e-48
VDY98799.1|933520_934957_+	hemolysin D	NA	NA	NA	NA	NA
VDY98801.1|935397_935625_+	urea transporter	NA	NA	NA	NA	NA
VDY98803.1|935902_938947_+	cytotoxic necrotizing factor 1	NA	NA	NA	NA	NA
VDY98805.1|939467_939773_-|transposase	putative transposase	transposase	A0A077SLK2	Escherichia_phage	72.4	1.1e-37
VDY98807.1|939866_940166_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	1002940	1051602	5249174	protease,transposase	Bacillus_phage(28.57%)	53	NA	NA
VDY98953.1|1002940_1003462_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY98955.1|1003686_1004289_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.3e-61
VDY98957.1|1004423_1005182_-	peptidase	NA	NA	NA	NA	NA
VDY98959.1|1005459_1007451_+	transketolase	NA	NA	NA	NA	NA
VDY98961.1|1007670_1008450_-|protease	putative membrane protease	protease	A0A2C9D0H9	Yersinia_phage	58.1	3.6e-48
VDY98963.1|1008425_1008578_-|protease	putative membrane protease	protease	NA	NA	NA	NA
VDY98965.1|1008954_1009206_+	mannitol-specific cryptic PTS system IIIA component	NA	NA	NA	NA	NA
VDY98967.1|1009424_1009760_+	mannitol-specific cryptic PTS system EIICB component	NA	NA	NA	NA	NA
VDY98969.1|1009807_1010218_+	mannitol-specific cryptic PTS system EIICB component	NA	NA	NA	NA	NA
VDY98971.1|1010217_1010811_+	mannitol-specific cryptic PTS system EIICB component	NA	NA	NA	NA	NA
VDY98973.1|1010825_1011182_+	putative oxidoreductase	NA	NA	NA	NA	NA
VDY98975.1|1011178_1011997_+	putative oxidoreductase	NA	NA	NA	NA	NA
VDY98977.1|1012099_1012741_+	putative sugar-bisphosphatase	NA	NA	NA	NA	NA
VDY98979.1|1012776_1012968_+	putative sugar-bisphosphatase	NA	NA	NA	NA	NA
VDY98980.1|1013084_1013594_+	putative transcriptional regulator	NA	NA	NA	NA	NA
VDY98982.1|1013590_1014304_+	fructose transport system kinase	NA	NA	NA	NA	NA
VDY98984.1|1014275_1014953_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	4.9e-09
VDY98986.1|1014946_1015624_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VDY98988.1|1015611_1016319_-	ABC transporter permease	NA	NA	NA	NA	NA
VDY98990.1|1016319_1016898_-	ABC-type transport system	NA	NA	NA	NA	NA
VDY98992.1|1016920_1017352_-	DNA-binding protein	NA	NA	NA	NA	NA
VDY98994.1|1017723_1018743_+	erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
VDY98996.1|1018792_1019956_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
VDY98998.1|1020170_1021250_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
VDY99000.1|1021607_1022483_+	mechanosensitive channel MscS	NA	NA	NA	NA	NA
VDY99002.1|1022524_1023568_-	solute-binding family 7 protein	NA	NA	NA	NA	NA
VDY99004.1|1023622_1024045_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY99006.1|1024034_1024553_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY99008.1|1024756_1025392_+	arginine exporter	NA	NA	NA	NA	NA
VDY99010.1|1025484_1026225_+	oxidative stress defense protein	NA	NA	NA	NA	NA
VDY99012.1|1026392_1027289_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
VDY99014.1|1027285_1028764_-	putative acetyl-CoA hydrolase/transferase	NA	NA	NA	NA	NA
VDY99016.1|1028786_1029572_-	methylmalonyl-CoA decarboxylase	NA	NA	NA	NA	NA
VDY99018.1|1029582_1030578_-	LAO/AO transport system kinase	NA	NA	NA	NA	NA
VDY99020.1|1030570_1032715_-	methylmalonyl-CoA mutase	NA	NA	NA	NA	NA
VDY99022.1|1032918_1033812_-	chromosome initiation inhibitor	NA	NA	NA	NA	NA
VDY99025.1|1033953_1034151_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDY99027.1|1034232_1034892_+	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
VDY99029.1|1035147_1036380_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
VDY99031.1|1036768_1037371_-	5,10-methenyltetrahydrofolate synthetase	NA	NA	NA	NA	NA
VDY99033.1|1037616_1037946_-	Z-ring-associated protein	NA	NA	NA	NA	NA
VDY99035.1|1038113_1038692_+	YecA family protein	NA	NA	NA	NA	NA
VDY99037.1|1038717_1040043_+	proline aminopeptidase II	NA	NA	NA	NA	NA
VDY99039.1|1040039_1041218_+	2-octaprenyl-6-methoxyphenol hydroxylase	NA	NA	NA	NA	NA
VDY99041.1|1041240_1042443_+	putative monooxygenase	NA	NA	NA	NA	NA
VDY99043.1|1042891_1043986_+	aminomethyltransferase (glycine cleavage system protein)	NA	NA	NA	NA	NA
VDY99045.1|1044009_1044399_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
VDY99047.1|1044517_1047391_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	8.2e-263
VDY99049.1|1047554_1048988_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.7	5.1e-32
VDY99051.1|1049032_1049344_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDY99053.1|1049507_1050167_+	hemolysin (membrane protein)	NA	NA	NA	NA	NA
VDY99055.1|1050253_1050775_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY99057.1|1050999_1051602_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.3e-61
>prophage 4
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	1242501	1249252	5249174	transposase	uncultured_Mediterranean_phage(33.33%)	7	NA	NA
VDY99449.1|1242501_1243263_+	stationary phase survival protein SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	6.9e-60
VDY99451.1|1243256_1243883_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	4.4e-36
VDY99453.1|1244022_1245162_+	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
VDY99455.1|1245224_1246217_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
VDY99457.1|1246336_1246744_-	regulator	NA	NA	NA	NA	NA
VDY99459.1|1246949_1248491_+|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VDY99462.1|1248505_1249252_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 5
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	1458803	1465283	5249174		Escherichia_phage(62.5%)	9	NA	NA
VDY99870.1|1458803_1459577_-	exodeoxyribonuclease 7 large subunit	NA	A0A1V0SD82	Indivirus	55.4	8.4e-13
VDY99872.1|1459570_1460173_-	exodeoxyribonuclease 7 large subunit	NA	A0A1V0SC03	Catovirus	31.4	1.6e-14
VDY99874.1|1460334_1461801_+	inosine 5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
VDY99876.1|1461869_1463447_+	bifunctional GMP synthase/glutamine amidotransferase protein	NA	NA	NA	NA	NA
VDY99878.1|1463539_1464079_-	Uncharacterised protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
VDY99880.1|1464094_1464277_-	putative lipoprotein	NA	G9L6F1	Escherichia_phage	100.0	1.7e-25
VDY99882.1|1464294_1464609_-	putative lipoprotein	NA	G9L6F1	Escherichia_phage	100.0	3.9e-33
VDY99884.1|1464921_1465113_-	protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
VDY99886.1|1465130_1465283_+	Uncharacterised protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 6
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	1861269	1870714	5249174		Enterobacteria_phage(85.71%)	10	NA	NA
VDZ00726.1|1861269_1862196_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
VDZ00728.1|1862200_1862932_+	ABC transporter permease	NA	NA	NA	NA	NA
VDZ00730.1|1862912_1863020_-	putative inner membrane protein	NA	NA	NA	NA	NA
VDZ00732.1|1863079_1863811_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VDZ00734.1|1864032_1865718_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VDZ00736.1|1865714_1866434_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VDZ00738.1|1866480_1866951_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VDZ00740.1|1866991_1867453_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VDZ00742.1|1867577_1869581_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
VDZ00744.1|1869577_1870714_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
>prophage 7
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	2011181	2042115	5249174	transposase	Acidithiobacillus_phage(33.33%)	38	NA	NA
VDZ01011.1|2011181_2011841_-|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	45.5	5.2e-48
VDZ01013.1|2012002_2012356_-|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	35.4	1.4e-07
VDZ01015.1|2014164_2014473_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01017.1|2014777_2014924_-|transposase	putative transposase	transposase	NA	NA	NA	NA
VDZ01019.1|2015333_2015570_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01021.1|2016718_2017042_+	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	45.9	3.6e-10
VDZ01023.1|2017041_2017752_+	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A0B6VT43	Edwardsiella_phage	42.4	1.5e-48
VDZ01025.1|2018628_2019483_-|transposase	transposase insF	transposase	U5P429	Shigella_phage	40.5	2.8e-49
VDZ01027.1|2019553_2019778_-|transposase	putative transposase	transposase	NA	NA	NA	NA
VDZ01029.1|2020128_2020374_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01031.1|2020515_2020677_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01033.1|2020785_2020995_+	microcin H47 immunity protein	NA	NA	NA	NA	NA
VDZ01035.1|2020945_2021239_+	MchB protein	NA	NA	NA	NA	NA
VDZ01037.1|2021524_2023075_+	putative microcin H47 biosynthesis protein	NA	NA	NA	NA	NA
VDZ01039.1|2023100_2023553_+	putative microcin H47 activating protein	NA	NA	NA	NA	NA
VDZ01041.1|2023686_2024979_+	microcin H47 secretion protein	NA	NA	NA	NA	NA
VDZ01043.1|2024971_2025373_+	microcin H47 secretion ATP-binding protein	NA	NA	NA	NA	NA
VDZ01045.1|2025369_2027067_+	microcin H47 secretion ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	24.4	3.4e-14
VDZ01047.1|2027102_2027273_+	microcin M imunity protein McmI	NA	NA	NA	NA	NA
VDZ01049.1|2027771_2028395_-	microcin M activity protein McmM	NA	NA	NA	NA	NA
VDZ01051.1|2028556_2029015_-	membraneprotein	NA	NA	NA	NA	NA
VDZ01053.1|2029079_2029271_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01055.1|2029472_2029985_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01057.1|2030226_2030796_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VDZ01059.1|2031070_2031292_-	F1C and S fimbrial switch regulatory protein	NA	NA	NA	NA	NA
VDZ01061.1|2031709_2032039_+	major pilu subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
VDZ01063.1|2032211_2032304_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01065.1|2032410_2032953_+	S fimbrial adhesin major subunit SfaA	NA	NA	NA	NA	NA
VDZ01067.1|2033115_2033562_+	S fimbriae minor subunit SfaD	NA	NA	NA	NA	NA
VDZ01069.1|2033602_2034298_+	F1C periplasmic chaperone	NA	NA	NA	NA	NA
VDZ01071.1|2034367_2036677_+	F1C fimbrial usher	NA	NA	NA	NA	NA
VDZ01073.1|2036634_2036997_+	C-terminal part of outer membrane F1C fimbrial usher protein SfaF	NA	NA	NA	NA	NA
VDZ01075.1|2037009_2037537_+	S-fimbrial adhesin protein SfaG	NA	NA	NA	NA	NA
VDZ01077.1|2037558_2038062_+	S-fimbrial adhesin protein SfaS precursor	NA	NA	NA	NA	NA
VDZ01079.1|2038006_2039023_+	F1C fimbrial adhesin	NA	NA	NA	NA	NA
VDZ01081.1|2039326_2040067_+	putative EAL domain-containing protein	NA	NA	NA	NA	NA
VDZ01083.1|2040347_2040764_+	PapX protein	NA	NA	NA	NA	NA
VDZ01085.1|2041089_2042115_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	2385364	2442223	5249174	tRNA,lysis,integrase,coat,tail,terminase	Escherichia_phage(57.63%)	77	2379754:2379768	2420106:2420120
2379754:2379768	attL	ATCGCAGCAATAAAA	NA	NA	NA	NA
VDZ01848.1|2385364_2386174_-	putative signaling protein	NA	A0A127AWB9	Bacillus_phage	39.5	2.0e-17
VDZ01850.1|2386188_2386596_-	Sensory box-containing diguanylate cyclase	NA	NA	NA	NA	NA
VDZ01852.1|2386850_2387834_+	zinc transport protein	NA	NA	NA	NA	NA
VDZ01854.1|2388108_2388279_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01856.1|2388311_2389685_+	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
VDZ01858.1|2389813_2390749_-|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
VDZ01860.1|2390800_2392036_-|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	4.6e-239
VDZ01862.1|2392037_2392253_-	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VDZ01864.1|2392331_2392541_-	gydaC	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
VDZ01866.1|2392784_2393594_-	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
VDZ01868.1|2393586_2396187_-	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
VDZ01870.1|2396317_2396563_-	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	80.8	1.9e-27
VDZ01872.1|2396637_2396808_-	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
VDZ01874.1|2396807_2397029_-	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
VDZ01876.1|2397347_2397959_+	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VDZ01878.1|2397955_2398111_-	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
VDZ01880.1|2398121_2398256_-	Rac prophage protein	NA	NA	NA	NA	NA
VDZ01882.1|2398564_2399041_-	Rac prophage; putative DNA-binding transcriptional regulator	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
VDZ01884.1|2399164_2399461_+	Rac prophage; putative DNA-binding transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
VDZ01886.1|2399483_2399906_+	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
VDZ01888.1|2399919_2400339_+	phage protein	NA	A0A0U2RT81	Escherichia_phage	94.1	9.3e-67
VDZ01890.1|2400781_2401528_+	putative phage DNA replication protein	NA	V5UQI5	Shigella_phage	78.5	8.4e-111
VDZ01892.1|2401550_2402312_+	transcription regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
VDZ01894.1|2402327_2402732_+	putative prophage protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	2.1e-63
VDZ01896.1|2402830_2403988_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01898.1|2404102_2405281_-	Predicted type IV restriction endonuclease	NA	NA	NA	NA	NA
VDZ01900.1|2405959_2406559_+	phage protein	NA	A0A0U2RT94	Escherichia_phage	91.5	5.5e-105
VDZ01902.1|2406558_2406849_+	phage protein	NA	A0A0U2KD41	Escherichia_phage	86.5	1.1e-45
VDZ01904.1|2406845_2407388_+	antitermination protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
VDZ01906.1|2408432_2408861_+	TolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VDZ01908.1|2409011_2409407_+	tolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VDZ01910.1|2409658_2409874_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
VDZ01912.1|2409878_2410223_+	putative prophage protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
VDZ01914.1|2410188_2410461_-	ybl58	NA	NA	NA	NA	NA
VDZ01916.1|2410566_2411100_+	membrane-associated lysozyme; Qin prophage	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
VDZ01918.1|2411096_2411561_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	92.8	1.7e-69
VDZ01920.1|2411731_2413156_+	Rac prophage; potassium transporter subunit	NA	NA	NA	NA	NA
VDZ01922.1|2413293_2413986_+	ParB-like nuclease	NA	A0A2I7RQE2	Vibrio_phage	48.1	4.5e-34
VDZ01924.1|2414076_2415009_+	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	2.4e-83
VDZ01926.1|2414986_2415196_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01928.1|2415199_2416294_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	1.0e-112
VDZ01930.1|2416274_2416421_+|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	71.8	1.9e-11
VDZ01932.1|2416369_2416789_+|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	74.0	3.9e-41
VDZ01933.1|2416793_2417273_+|terminase	phage terminase	terminase	A0A2P1MXD8	Escherichia_phage	59.7	1.1e-42
VDZ01935.1|2417302_2417581_+|terminase	phage terminase	terminase	A0A2P1MXD8	Escherichia_phage	65.4	1.2e-14
VDZ01937.1|2417573_2417966_+	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	72.6	4.8e-49
VDZ01939.1|2418046_2418439_+	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	65.3	8.2e-33
VDZ01941.1|2418559_2418973_+	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	69.2	7.8e-42
VDZ01943.1|2418953_2419220_+	phage protein	NA	G8C7P5	Escherichia_phage	54.9	9.6e-09
VDZ01945.1|2419192_2419792_+	phage protein	NA	I6PD76	Cronobacter_phage	58.1	1.9e-57
VDZ01947.1|2419850_2420069_+	phage protein	NA	G8C7P5	Escherichia_phage	50.7	1.8e-13
VDZ01949.1|2420169_2420505_+	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	52.8	4.4e-19
2420106:2420120	attR	TTTTATTGCTGCGAT	NA	NA	NA	NA
VDZ01951.1|2420527_2420932_+	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	64.7	9.7e-45
VDZ01953.1|2421030_2422170_+|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
VDZ01955.1|2422212_2422389_+	Uncharacterised protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
VDZ01957.1|2422392_2422788_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01959.1|2422787_2423171_+	Uncharacterised protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
VDZ01961.1|2423171_2423552_+	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
VDZ01963.1|2423548_2423941_+	phage protein	NA	NA	NA	NA	NA
VDZ01965.1|2423967_2424930_+	Uncharacterised protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
VDZ01967.1|2424990_2425440_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01969.1|2425911_2428917_+|tail	putative phage tail length tape measure protein	tail	A0A1V0E821	Vibrio_phage	33.7	1.3e-93
VDZ01971.1|2429177_2429381_+|tail	putative phage minor tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	46.2	5.6e-09
VDZ01973.1|2429674_2429986_+|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	98.7	8.2e-36
VDZ01975.1|2430320_2431064_+|tail	putative tail fiber component K of prophage	tail	A0A291AWX4	Escherichia_phage	98.3	3.6e-106
VDZ01977.1|2431338_2431467_+	Tail assembly protein I	NA	A0A2R9YJH6	Escherichia_phage	100.0	4.3e-15
VDZ01979.1|2431527_2431695_+|tail	putative phage tail component	tail	A0A291AWT4	Escherichia_phage	100.0	1.7e-16
VDZ01981.1|2431660_2435008_+	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
VDZ01983.1|2435075_2435510_+	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	90.0	1.9e-67
VDZ01985.1|2435503_2435674_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	91.1	3.0e-24
VDZ01987.1|2435738_2436281_+|tail	putative tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	98.4	2.8e-63
VDZ01989.1|2436497_2436968_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ01991.1|2437104_2437755_+|tail	tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	54.1	1.8e-37
VDZ01994.1|2438083_2438605_+|tail	phage side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	76.0	8.9e-51
VDZ01996.1|2439687_2440545_-	iron/manganese transport system membrane protein SitD	NA	NA	NA	NA	NA
VDZ01999.1|2440541_2441399_-	iron ABC transporter permease	NA	NA	NA	NA	NA
VDZ02001.1|2441395_2442223_-	iron ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
>prophage 9
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	2628721	2683644	5249174	protease,lysis,transposase,integrase,tail,portal,head,terminase	Enterobacteria_phage(40.82%)	73	2666384:2666400	2681869:2681885
VDZ02352.1|2628721_2630185_-	putative sugar dehydrogenase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	3.3e-42
VDZ02354.1|2630795_2631029_+	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VDZ02356.1|2631345_2631936_+	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
VDZ02358.1|2632608_2633841_-|tail	putative tail fiber protein	tail	K7PHC9	Enterobacteria_phage	66.9	2.6e-48
VDZ02360.1|2634179_2635070_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ02362.1|2635631_2636231_-	outer membrane precursor Lom	NA	A5LH44	Enterobacteria_phage	97.0	1.8e-108
VDZ02364.1|2636301_2639715_-|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
VDZ02366.1|2639775_2640324_-	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	96.2	1.4e-91
VDZ02368.1|2640320_2641064_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	98.0	5.9e-149
VDZ02370.1|2641068_2641767_-|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	98.3	4.7e-132
VDZ02372.1|2641776_2642106_-|tail	Minor tail protein M	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
VDZ02374.1|2642105_2644781_-|tail	putative tail length tape measure protein from putative prophage	tail	A0A291AWX1	Escherichia_phage	99.6	0.0e+00
VDZ02376.1|2644815_2645172_-|tail	putative tail length tape measure protein from putative prophage	tail	A0A291AWX1	Escherichia_phage	100.0	4.1e-15
VDZ02378.1|2645143_2645461_-|tail	minor tail protein T of prophage	tail	A5LH37	Enterobacteria_phage	100.0	1.5e-53
VDZ02380.1|2645480_2645867_-|tail	minor tail component of prophage	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
VDZ02382.1|2645927_2646671_-|tail	Major tail protein V	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
VDZ02384.1|2646681_2647083_-|tail	Minor tail protein U	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
VDZ02386.1|2647079_2647658_-|tail	Minor tail protein Z (GPZ) of prophage	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
VDZ02388.1|2647669_2647945_-	prophage protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
VDZ02390.1|2647937_2648261_-	prophage protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
VDZ02392.1|2648347_2650375_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A291AWT6	Escherichia_phage	99.7	0.0e+00
VDZ02394.1|2650319_2651828_-|head,tail,portal	portal protein (head-tail preconnector protein) from prophage	head,tail,portal	A5LH29	Enterobacteria_phage	99.4	8.6e-288
VDZ02396.1|2651827_2652040_-	prophage protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
VDZ02397.1|2652036_2654136_-|terminase	terminase large subunit	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
VDZ02399.1|2654144_2654672_-|terminase	putative terminase small subunit	terminase	A5LH26	Enterobacteria_phage	100.0	2.1e-92
VDZ02401.1|2655056_2655224_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ02403.1|2655244_2655451_-	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
VDZ02405.1|2655751_2656162_+	putative envelope protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
VDZ02407.1|2656313_2656487_-	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VDZ02409.1|2657736_2658234_-	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	3.7e-06
VDZ02411.1|2658230_2658764_-	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VDZ02413.1|2658760_2659072_-	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VDZ02415.1|2659076_2659283_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VDZ02417.1|2660561_2660774_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
VDZ02419.1|2661008_2661194_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ02421.1|2661194_2661947_-	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VDZ02423.1|2661960_2662485_-	putative prophage protein	NA	Q8SBE5	Shigella_phage	69.9	1.0e-62
VDZ02425.1|2662506_2663010_-	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	45.8	1.9e-37
VDZ02427.1|2663356_2663608_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ02429.1|2663824_2663980_-	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VDZ02431.1|2664051_2664348_-	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	67.8	9.3e-29
VDZ02433.1|2664337_2664577_-	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
VDZ02435.1|2665108_2665441_+	Qin prophage protein	NA	NA	NA	NA	NA
VDZ02437.1|2665877_2666402_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ02439.1|2666358_2666763_-|transposase	transposase	transposase	NA	NA	NA	NA
2666384:2666400	attL	TTGCTGTTTTCAATATC	NA	NA	NA	NA
VDZ02441.1|2666710_2667220_-|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VDZ02443.1|2667253_2667673_-	exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
VDZ02445.1|2667713_2668679_-	ybl78	NA	U5P0A0	Shigella_phage	61.2	1.7e-55
VDZ02447.1|2668659_2669181_-	YdfX	NA	NA	NA	NA	NA
VDZ02449.1|2669184_2669391_-	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VDZ02451.1|2669417_2669876_+	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
VDZ02453.1|2670068_2670221_+	ydfA	NA	M4QQ57	Salicola_phage	52.1	2.3e-07
VDZ02455.1|2670226_2670478_+	putative prophage protein	NA	NA	NA	NA	NA
VDZ02457.1|2671289_2671478_+	division inhibition protein	NA	NA	NA	NA	NA
VDZ02459.1|2671474_2671666_+	putative prophage protein	NA	NA	NA	NA	NA
VDZ02461.1|2671759_2674231_+	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
VDZ02463.1|2674318_2674555_+	putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
VDZ02465.1|2674589_2674718_+|integrase	defective integrase; Qin prophage	integrase	S4TSP2	Salmonella_phage	80.6	1.3e-11
VDZ02467.1|2675074_2675563_+|integrase	defective integrase; Qin prophage	integrase	Q859D2	Escherichia_coli_phage	62.0	1.9e-55
VDZ02469.1|2675604_2675868_+|integrase	C-terminus fragment integrase	integrase	A0A286S1S8	Klebsiella_phage	72.2	2.6e-30
VDZ02471.1|2675887_2675998_-	protein, truncated	NA	NA	NA	NA	NA
VDZ02473.1|2676055_2676304_-	dehydrogenase	NA	NA	NA	NA	NA
VDZ02475.1|2676487_2676985_-	dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	3.4e-07
VDZ02477.1|2677085_2677754_-	starvation sensing protein RspA	NA	NA	NA	NA	NA
VDZ02479.1|2677896_2678142_-	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	48.5	8.5e-12
VDZ02481.1|2678526_2678823_-	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.8	4.5e-23
VDZ02483.1|2678950_2679298_+	protein	NA	NA	NA	NA	NA
VDZ02485.1|2679332_2679566_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VDZ02487.1|2679522_2679771_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VDZ02489.1|2679770_2679893_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VDZ02491.1|2679895_2680642_-	lipoprotein	NA	NA	NA	NA	NA
VDZ02493.1|2680713_2681019_+	protein	NA	NA	NA	NA	NA
VDZ02495.1|2681217_2683644_+	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.1	1.7e-213
2681869:2681885	attR	GATATTGAAAACAGCAA	NA	NA	NA	NA
>prophage 10
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	3067821	3132579	5249174	protease,integrase,transposase,tail,portal,head,terminase,capsid	Escherichia_phage(51.28%)	68	3085474:3085489	3115304:3115319
VDZ03388.1|3067821_3068070_-|tail	Qin prophage; side tail fiber assembly protein	tail	NA	NA	NA	NA
VDZ03390.1|3068066_3071222_-|tail	phage tail domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.7e-11
VDZ03392.1|3071286_3071886_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	95.5	7.7e-107
VDZ03394.1|3072114_3075432_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	93.1	0.0e+00
VDZ03396.1|3075492_3076041_-	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	96.2	1.4e-91
VDZ03398.1|3076037_3076637_-|tail	tail component	tail	K7PLW1	Enterobacteria_phage	98.5	1.4e-119
VDZ03400.1|3076785_3077484_-|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
VDZ03402.1|3077483_3077825_-|tail	prophage minor tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	1.2e-40
VDZ03404.1|3077817_3080628_-|tail	phage-related minor tail protein	tail	A0A1B5FPE2	Escherichia_phage	94.4	0.0e+00
VDZ03406.1|3080591_3081044_-|tail	phage-related minor tail protein	tail	A0A1B5FPE2	Escherichia_phage	99.2	1.3e-58
VDZ03408.1|3081090_3081369_-	prophage protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
VDZ03409.1|3081392_3081764_-|tail	tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
VDZ03411.1|3082073_3082532_-|tail	phage major tail subunit	tail	A0A1B5FP82	Escherichia_phage	93.6	1.1e-31
VDZ03414.1|3082540_3082885_-	putative prophage protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
VDZ03416.1|3082881_3083328_-	prophage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
VDZ03418.1|3083327_3083666_-|head,tail	putative prophage head-tail adaptor	head,tail	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
VDZ03420.1|3083674_3083980_-	phage protein	NA	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
VDZ03422.1|3083991_3084180_-	phage protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
VDZ03424.1|3084230_3085436_-|capsid	major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.3	1.0e-222
VDZ03426.1|3085450_3086101_-|head,protease	pro-head protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
3085474:3085489	attL	CATTCAGTGCAGAGCC	NA	NA	NA	NA
VDZ03428.1|3086078_3087320_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
VDZ03430.1|3087319_3087502_-	prophage protein	NA	A0A1B5FP99	Escherichia_phage	95.0	2.5e-24
VDZ03432.1|3087513_3089271_-|terminase	phage terminase	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
VDZ03434.1|3089431_3089752_-|terminase	putative prophage terminase, small subunit	terminase	A0A1B5FPA0	Escherichia_phage	97.9	6.2e-47
VDZ03436.1|3089899_3090250_-	putative prophage endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
VDZ03438.1|3090292_3090760_-	endopeptidase	NA	A0A1B5FPA1	Escherichia_phage	91.6	7.7e-70
VDZ03440.1|3090756_3091290_-	membrane-associated lysozyme; Qin prophage	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
VDZ03442.1|3091353_3091704_-	putative prophage protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
VDZ03444.1|3091708_3091924_-	Lysis protein S	NA	M1FN85	Enterobacteria_phage	98.6	5.3e-34
VDZ03446.1|3092736_3093426_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	50.6	1.8e-59
VDZ03448.1|3093422_3093788_-	Holliday junction resolvase	NA	V5URS4	Shigella_phage	66.7	1.6e-38
VDZ03450.1|3093788_3094058_-	phage protein	NA	U5P0K4	Shigella_phage	70.7	3.8e-29
VDZ03452.1|3094201_3094846_-	phage protein	NA	S5FV02	Shigella_phage	45.5	5.7e-47
VDZ03454.1|3095224_3095443_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ03456.1|3096554_3097250_+	e14 prophage; predicted inner membrane protein	NA	NA	NA	NA	NA
VDZ03458.1|3097262_3097916_+	S-adenosyl-L-methionine-dependent methyltransferases	NA	NA	NA	NA	NA
VDZ03460.1|3098230_3099130_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ03462.1|3099382_3099805_-	phage protein	NA	A0A0U2QQN3	Escherichia_phage	91.8	4.8e-63
VDZ03464.1|3099845_3100811_-	ybl78	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
VDZ03466.1|3100791_3101313_-	YdfX	NA	NA	NA	NA	NA
VDZ03468.1|3101296_3101524_-	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VDZ03470.1|3101604_3102012_+	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	51.9	1.6e-31
VDZ03472.1|3102180_3102336_+	putative prophage protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
VDZ03474.1|3102337_3102460_+	putative prophage protein	NA	NA	NA	NA	NA
VDZ03476.1|3102717_3102882_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ03478.1|3103281_3103470_+	division inhibition protein dicB	NA	NA	NA	NA	NA
VDZ03480.1|3103466_3103658_+	putative prophage protein	NA	NA	NA	NA	NA
VDZ03482.1|3103891_3106192_+	Exodeoxyribonuclease VIII from bacteriophage origin	NA	A0A0U2I1R6	Escherichia_phage	47.5	2.1e-99
VDZ03484.1|3106250_3106454_+	putative prophage protein	NA	NA	NA	NA	NA
VDZ03486.1|3106453_3107479_+|integrase	site-specific recombinase, phage integrase family	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
VDZ03488.1|3107713_3108148_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
VDZ03490.1|3108808_3108958_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ03492.1|3108971_3110960_+	adhesin	NA	NA	NA	NA	NA
VDZ03494.1|3110956_3111418_+	putative invasin	NA	NA	NA	NA	NA
VDZ03496.1|3111468_3116766_+	putative invasin	NA	NA	NA	NA	NA
3115304:3115319	attR	CATTCAGTGCAGAGCC	NA	NA	NA	NA
VDZ03498.1|3117520_3118291_-	ADP-heptose--LPS heptosyltransferase-like protein	NA	NA	NA	NA	NA
VDZ03500.1|3118605_3119922_+	shikimate transporter	NA	NA	NA	NA	NA
VDZ03502.1|3120023_3120851_+	AMP nucleosidase	NA	NA	NA	NA	NA
VDZ03504.1|3120847_3121477_+	AMP nucleosidase	NA	NA	NA	NA	NA
VDZ03506.1|3121819_3122536_+	putative cytoplasmic protein	NA	NA	NA	NA	NA
VDZ03508.1|3123163_3124618_-	multidrug efflux system	NA	NA	NA	NA	NA
VDZ03510.1|3124924_3125875_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDZ03512.1|3125976_3126894_-	Nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
VDZ03514.1|3127351_3128287_-	ErfK/YbiS/YcfS/YnhG family protein	NA	NA	NA	NA	NA
VDZ03516.1|3128348_3129428_-	Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
VDZ03518.1|3129439_3130183_-	cobalamin synthase	NA	NA	NA	NA	NA
VDZ03520.1|3130179_3130725_-	bifunctional adenosylcobalamin biosynthesis protein [includes adenosylcobinamide kinase; adenosylcobinamide-phosphate guanylyltransferase]	NA	NA	NA	NA	NA
VDZ03522.1|3132462_3132579_+|transposase	putative transposase, ISEc23	transposase	A0A0P0ZBS5	Stx2-converting_phage	71.4	1.2e-08
>prophage 11
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	3137408	3153311	5249174	transposase	Escherichia_phage(50.0%)	16	NA	NA
VDZ03538.1|3137408_3138788_-|transposase	transposase	transposase	NA	NA	NA	NA
VDZ03540.1|3139071_3139482_-	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VDZ03542.1|3139469_3139871_-	ybl85	NA	NA	NA	NA	NA
VDZ03544.1|3140130_3140652_-	malate transporter	NA	NA	NA	NA	NA
VDZ03546.1|3142213_3142366_+	InterPro motifs Prophage CP4-57 regulatory protein (AlpA)	NA	NA	NA	NA	NA
VDZ03548.1|3142511_3142712_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ03550.1|3142651_3143098_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ03552.1|3144039_3144819_-	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
VDZ03554.1|3144818_3145841_-|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
VDZ03556.1|3147460_3148612_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ03558.1|3148695_3148923_+	putative GTP-binding protein	NA	NA	NA	NA	NA
VDZ03560.1|3149101_3150358_+|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	47.8	6.0e-101
VDZ03562.1|3150656_3151403_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VDZ03564.1|3151493_3151697_-	putative exonuclease family protein	NA	NA	NA	NA	NA
VDZ03566.1|3152035_3152767_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VDZ03568.1|3152747_3153311_+|transposase	putative transposase	transposase	NA	NA	NA	NA
>prophage 12
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	3380862	3391774	5249174	tRNA	Escherichia_phage(42.86%)	10	NA	NA
VDZ04025.1|3380862_3381114_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	61.4	3.4e-24
VDZ04027.1|3381659_3381920_-	anaerobic dimethyl sulfoxide reductase chain A	NA	NA	NA	NA	NA
VDZ04029.1|3381999_3382290_-	anaerobic dimethyl sulfoxide reductase chain A	NA	NA	NA	NA	NA
VDZ04031.1|3382378_3382882_-	anaerobic dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	51.5	6.6e-43
VDZ04033.1|3383011_3383923_-	anaerobic dimethyl sulfoxide reductase chain A	NA	A0A077SK27	Escherichia_phage	49.6	3.6e-63
VDZ04035.1|3384161_3384347_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	59.3	7.1e-11
VDZ04037.1|3384289_3385453_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.1	2.6e-58
VDZ04039.1|3385543_3386887_-	putative ATPase	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
VDZ04041.1|3386897_3387509_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VDZ04043.1|3387667_3391774_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
>prophage 13
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	3756854	3817584	5249174	protease,lysis,transposase,coat,tail,portal,integrase,head,terminase,capsid	Enterobacteria_phage(62.9%)	86	3756386:3756432	3818155:3818201
3756386:3756432	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VDZ04733.1|3756854_3757808_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VDZ04734.1|3757994_3759479_+|protease	putative protease	protease	NA	NA	NA	NA
VDZ04735.1|3760036_3760693_+	methylase	NA	NA	NA	NA	NA
VDZ04736.1|3761396_3762938_+|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VDZ04737.1|3762952_3763699_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VDZ04738.1|3763752_3763917_-|tail	tail fiber chaperone; Qin prophage	tail	K7PMH7	Enterobacteria_phage	97.8	8.2e-19
VDZ04739.1|3763916_3766877_-|tail	putative tail fiber protein	tail	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
VDZ04740.1|3766941_3767541_-	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
VDZ04741.1|3767611_3770368_-|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	96.6	0.0e+00
VDZ04742.1|3770321_3771026_-|tail	tail component of prophage	tail	K7PKJ2	Enterobacteria_phage	98.3	7.2e-96
VDZ04743.1|3771097_3771658_-|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	94.6	6.8e-65
VDZ04744.1|3771654_3772398_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
VDZ04745.1|3772403_3773102_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
VDZ04746.1|3773101_3773431_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
VDZ04747.1|3773427_3775989_-|tail	tail component of prophage	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
VDZ04748.1|3775981_3776416_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VDZ04749.1|3776397_3776820_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
VDZ04750.1|3776835_3777576_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
VDZ04751.1|3777583_3777979_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
VDZ04752.1|3777975_3778554_-|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
VDZ04753.1|3778544_3778919_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
VDZ04754.1|3778930_3779326_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
VDZ04755.1|3779367_3780393_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
VDZ04756.1|3780448_3780781_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
VDZ04757.1|3780890_3782111_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	96.9	9.3e-200
VDZ04758.1|3782091_3782865_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	98.8	8.9e-140
VDZ04759.1|3783679_3783961_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ04760.1|3783972_3784515_-	gp1	NA	O64316	Escherichia_phage	48.8	3.4e-37
VDZ04761.1|3784716_3785100_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VDZ04762.1|3785111_3785453_-|head	putative head decoration protein from prophage	head	NA	NA	NA	NA
VDZ04763.1|3785462_3786503_-|head	putative major head protein from prophage	head	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
VDZ04764.1|3786720_3787143_-	putative prophage single-stranded DNA binding protein	NA	NA	NA	NA	NA
VDZ04765.1|3787139_3787397_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ04766.1|3787686_3788568_-	nucleic acid independent nucleoside triphosphatase; phage DNA primase	NA	Q7M2A8	Enterobacteria_phage	45.6	9.1e-64
VDZ04767.1|3788564_3789332_-	nucleic acid independent nucleoside triphosphatase; phage DNA primase	NA	NA	NA	NA	NA
VDZ04768.1|3789467_3789731_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ04769.1|3789748_3789970_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ04770.1|3789966_3790161_-	Uncharacterised protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
VDZ04771.1|3790160_3790346_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ04772.1|3790338_3790536_-	putative prophage protein	NA	NA	NA	NA	NA
VDZ04773.1|3790725_3791031_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ04774.1|3791164_3791680_-	putative prophage antirepressor	NA	A0A1W6JPH8	Morganella_phage	44.9	1.7e-14
VDZ04775.1|3791987_3792245_-	putative DNA binding protein from phage origin	NA	NA	NA	NA	NA
VDZ04776.1|3792246_3792432_-|integrase	putative integrase of prophage	integrase	NA	NA	NA	NA
VDZ04777.1|3793201_3793483_-|integrase	putative integrase of prophage	integrase	NA	NA	NA	NA
VDZ04778.1|3793747_3794713_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	84.9	6.6e-124
VDZ04779.1|3794709_3796632_-|terminase	terminase GpA	terminase	A0A0K2FJ14	Enterobacteria_phage	93.0	0.0e+00
VDZ04780.1|3796606_3797152_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
VDZ04781.1|3798094_3798388_+	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
VDZ04782.1|3798478_3798880_-	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	99.1	1.6e-55
VDZ04783.1|3798876_3799374_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
VDZ04784.1|3799373_3799589_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VDZ04785.1|3800176_3801274_+	outer membrane porin; DLP12 prophage	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
VDZ04786.1|3801462_3801846_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
VDZ04787.1|3801931_3802069_-	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	70.7	2.4e-08
VDZ04788.1|3802068_3802431_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
VDZ04789.1|3802427_3802718_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
VDZ04790.1|3802710_3802881_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
VDZ04791.1|3802880_3803336_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
VDZ04792.1|3803547_3803928_-	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VDZ04793.1|3803999_3804344_-	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VDZ04794.1|3804353_3804905_-	kinase inhibitor	NA	NA	NA	NA	NA
VDZ04795.1|3805369_3806896_-	site-specific invertase; DLP12 prophage	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
VDZ04796.1|3807152_3807485_-	Multidrug transporter emrE	NA	NA	NA	NA	NA
VDZ04797.1|3807552_3807855_-	Ren protein from phage origin	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
VDZ04798.1|3807851_3808553_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
VDZ04799.1|3808661_3808922_-	replication protein O of prophage CP-933X	NA	A0A1I9LJP3	Stx_converting_phage	98.7	5.4e-41
VDZ04800.1|3808918_3809299_-	replication protein O of prophage CP-933X	NA	NA	NA	NA	NA
VDZ04801.1|3809267_3809417_-	replication protein O	NA	A0A075B8J2	Enterobacteria_phage	77.8	1.8e-12
VDZ04802.1|3809359_3809569_-	replication protein O	NA	NA	NA	NA	NA
VDZ04803.1|3809565_3809946_-	bacteriophage regulatory protein CII	NA	K7PJT7	Enterobacteria_phage	73.3	3.0e-40
VDZ04804.1|3809902_3810106_-	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	64.7	5.6e-17
VDZ04805.1|3810136_3810364_-	represror Cro	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
VDZ04806.1|3810681_3811167_+	Regulatory protein CI from bacteriophage origin	NA	Q76H56	Enterobacteria_phage	90.4	7.0e-74
VDZ04807.1|3811273_3811438_+	Uncharacterised protein	NA	A0A1S5SA14	Streptococcus_phage	63.8	2.0e-09
VDZ04808.1|3812528_3812867_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ04809.1|3813454_3813661_+	prophage Kil protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
VDZ04810.1|3813737_3814034_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
VDZ04811.1|3814039_3814825_+	bacteriophage recombination protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
VDZ04812.1|3814821_3815214_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.0	9.0e-56
VDZ04813.1|3815407_3815503_+	DLP12 prophage; exonuclease	NA	A0A0N6WET1	Escherichia_phage	100.0	1.8e-10
VDZ04814.1|3815499_3815607_+	phage protein	NA	A0A1U8QQC1	Enterobacteria_phage	81.5	3.3e-05
VDZ04815.1|3815653_3815845_+	phage protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
VDZ04816.1|3816139_3816343_+	Uncharacterised protein	NA	M1FQW7	Enterobacteria_phage	100.0	2.9e-05
VDZ04817.1|3816499_3816856_+	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	97.8	7.7e-46
VDZ04818.1|3816978_3817584_+|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A088CD23	Shigella_phage	79.8	7.6e-86
3818155:3818201	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 14
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	3995562	4005520	5249174		Bacillus_phage(50.0%)	9	NA	NA
VDZ04974.1|3995562_3996615_-	phosphate regulon two-component system, sensor kinase	NA	W8CYF6	Bacillus_phage	31.2	1.3e-27
VDZ04975.1|3996569_3996857_-	phosphate regulon two-component system, sensor kinase	NA	NA	NA	NA	NA
VDZ04976.1|3996914_3997604_-	phosphate regulon two-component system, response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
VDZ04977.1|3997793_3998996_+	exonuclease SbcD	NA	R4JGS2	Bacillus_phage	24.1	4.8e-07
VDZ04978.1|3998992_4002136_+	exonuclease, dsDNA, ATP-dependent	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
VDZ04979.1|4002176_4003556_+	MFS transporter AraJ	NA	NA	NA	NA	NA
VDZ04980.1|4003577_4004486_-	fructokinase	NA	NA	NA	NA	NA
VDZ04981.1|4004543_4004846_+	exonuclease RdgC	NA	A0A067ZG66	Vibrio_phage	44.3	1.0e-11
VDZ04982.1|4004842_4005520_+	exonuclease RdgC	NA	S4TWL4	Salmonella_phage	69.3	5.7e-82
>prophage 15
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	4052709	4056992	5249174		Enterobacteria_phage(50.0%)	6	NA	NA
VDZ05033.1|4052709_4052907_+	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	95.9	8.3e-18
VDZ05034.1|4053007_4053421_+	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	99.1	1.7e-52
VDZ05035.1|4053383_4053755_+	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	86.3	2.1e-46
VDZ05036.1|4053920_4054091_+	beta-galactosidase	NA	Q37953	Phage_M13mp18	93.2	6.1e-17
VDZ05037.1|4054700_4054985_+	beta-D-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.8	9.8e-44
VDZ05038.1|4055033_4056992_+	beta-D-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
>prophage 16
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	4566989	4585617	5249174	transposase	Stx2-converting_phage(62.5%)	24	NA	NA
VDZ05565.1|4566989_4568531_+|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VDZ05566.1|4568545_4569292_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VDZ05567.1|4569349_4570429_-	CP4-44 prophage; antigen 43 (Ag43)phase-variable biofilm formation autotransporter	NA	NA	NA	NA	NA
VDZ05568.1|4570392_4571202_-	antigen 43, truncation	NA	NA	NA	NA	NA
VDZ05569.1|4571573_4572446_-	putative GTP-binding protein	NA	NA	NA	NA	NA
VDZ05570.1|4573674_4575159_+	CP4-57 prophage protein	NA	NA	NA	NA	NA
VDZ05571.1|4575480_4576083_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ05572.1|4576177_4576384_-	regulatory protein	NA	NA	NA	NA	NA
VDZ05573.1|4577507_4577708_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ05574.1|4577907_4578477_+	malate transporter	NA	NA	NA	NA	NA
VDZ05575.1|4578736_4579138_+	ybl85	NA	NA	NA	NA	NA
VDZ05576.1|4579125_4579245_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ05577.1|4579295_4579559_+	Protein of uncharacterised function (DUF3279)	NA	NA	NA	NA	NA
VDZ05578.1|4579558_4579795_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ05579.1|4580288_4580390_+	IS orf	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	1.5e-10
VDZ05580.1|4580401_4580635_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	3.8e-38
VDZ05581.1|4580728_4581007_+	IS encoded protein within CP-933O	NA	A0A0P0ZBS5	Stx2-converting_phage	95.7	1.7e-40
VDZ05582.1|4581156_4581654_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.2	1.0e-56
VDZ05583.1|4581783_4581930_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	47.5	4.3e-11
VDZ05584.1|4582297_4582717_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VDZ05585.1|4582704_4582842_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ05586.1|4582871_4583240_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VDZ05587.1|4583480_4583648_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ05588.1|4585407_4585617_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
>prophage 17
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	4592736	4600055	5249174	transposase	Shigella_phage(33.33%)	10	NA	NA
VDZ05597.1|4592736_4593168_+	Iron(III) dicitrate transport system permease protein fecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	29.1	5.9e-08
VDZ05598.1|4593168_4593927_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.3e-13
VDZ05599.1|4594491_4594749_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VDZ05600.1|4594831_4595485_-|transposase	putative transposase subunit	transposase	Q716C2	Shigella_phage	99.1	1.7e-128
VDZ05601.1|4595683_4595986_+	IS600 ORF1-like protein	NA	NA	NA	NA	NA
VDZ05602.1|4596021_4596840_+|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
VDZ05603.1|4596993_4598991_+	secondary glycine betaine transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
VDZ05604.1|4598935_4599094_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDZ05605.1|4599053_4599467_+	Predicted membrane protein (DUF2254)	NA	NA	NA	NA	NA
VDZ05606.1|4599401_4600055_-|transposase	putative transposase subunit	transposase	Q716C2	Shigella_phage	99.5	1.1e-130
>prophage 18
LR134081	Escherichia coli strain NCTC9033 genome assembly, chromosome: 1	5249174	5156988	5162317	5249174		Enterobacteria_phage(50.0%)	7	NA	NA
VDZ06165.1|5156988_5157438_-	dTDP-4-oxo-6-deoxy-D-glucose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	46.5	6.2e-08
VDZ06166.1|5157442_5158117_-	TDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
VDZ06167.1|5158094_5158976_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
VDZ06168.1|5158994_5159453_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.4	1.1e-36
VDZ06169.1|5159427_5160063_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.7e-54
VDZ06170.1|5160062_5161325_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
VDZ06171.1|5161321_5162317_-	UDP-N-acetylglucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	31.3	3.5e-27
