The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134078	Escherichia coli strain NCTC9085 genome assembly, chromosome: 1	4969367	827352	877729	4969367	transposase	Escherichia_phage(30.77%)	41	NA	NA
VDY82832.1|827352_828375_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.7e-199
VDY82834.1|828374_829154_+	insertion sequence IS100, ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
VDY82835.1|829453_831058_+	CP4-57 prophage protein	NA	NA	NA	NA	NA
VDY82836.1|832205_832355_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY82838.1|832599_833166_+	Protein of uncharacterised function (DUF3296)	NA	NA	NA	NA	NA
VDY82840.1|833413_833974_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY82842.1|834042_834276_+	putative regulatory protein	NA	NA	NA	NA	NA
VDY82844.1|834542_835091_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY82846.1|835358_835982_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VDY82848.1|836079_836313_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY82849.1|836676_838443_+	putative hemolysin activator ShlB-type	NA	A0A0R6PI85	Moraxella_phage	25.5	4.6e-22
VDY82851.1|838455_839514_+	hemagglutinin-related protein	NA	A0A0R6PJK4	Moraxella_phage	38.4	8.8e-29
VDY82852.1|839531_840119_+	hemagglutinin-related protein	NA	NA	NA	NA	NA
VDY82854.1|840109_841069_+	hemagglutinin-related protein	NA	NA	NA	NA	NA
VDY82855.1|841068_848181_+	hemagglutinin-related protein	NA	NA	NA	NA	NA
VDY82856.1|848177_848564_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY82858.1|848594_848972_+	protein encoded within IS	NA	A0A0P0ZBS5	Stx2-converting_phage	98.1	1.7e-56
VDY82860.1|849276_849609_+	ImpA-related N-terminal family protein	NA	NA	NA	NA	NA
VDY82862.1|849592_850120_+	TraG-like protein, N-terminal region	NA	NA	NA	NA	NA
VDY82864.1|850129_850486_+	TraG-like protein, N-terminal region	NA	NA	NA	NA	NA
VDY82866.1|850866_851577_+	modification methylase	NA	A0A0R6PG08	Moraxella_phage	36.8	2.6e-29
VDY82868.1|851951_854876_+	ATPase	NA	A0A1B5FPD5	Escherichia_phage	24.3	3.9e-34
VDY82870.1|854889_856557_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY82872.1|857237_857504_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY82873.1|857601_857853_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY82875.1|857991_858081_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY82877.1|858781_860254_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	1.9e-21
VDY82879.1|860254_860974_-	response regulator	NA	W8CYM9	Bacillus_phage	35.2	3.3e-35
VDY82881.1|861114_861714_+	putative transmembrane hydrogenase cytochrome b-type subunit oxidoreductase protein	NA	NA	NA	NA	NA
VDY82883.1|861713_861902_+	oxidoreductase	NA	NA	NA	NA	NA
VDY82884.1|861943_862309_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VDY82886.1|862266_863172_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	99.7	3.3e-178
VDY82888.1|863280_863820_+	oxidoreductase	NA	NA	NA	NA	NA
VDY82890.1|863847_864090_+	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
VDY82891.1|865273_865786_+	hemolysin C	NA	NA	NA	NA	NA
VDY82892.1|865797_868872_+	hemolysin A	NA	NA	NA	NA	NA
VDY82894.1|869079_871065_+	alpha-hemolysin translocation ATP-binding protein HlyB	NA	W8CYL7	Bacillus_phage	29.7	6.0e-47
VDY82896.1|871083_872520_+	hemolysin D	NA	NA	NA	NA	NA
VDY82898.1|873465_876510_+	cytotoxic necrotizing factor 1	NA	NA	NA	NA	NA
VDY82900.1|876883_877336_-|transposase	putative transposase	transposase	A0A077SLK2	Escherichia_phage	82.6	3.1e-68
VDY82901.1|877429_877729_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
LR134078	Escherichia coli strain NCTC9085 genome assembly, chromosome: 1	4969367	1170568	1179324	4969367	tRNA,integrase	Escherichia_phage(71.43%)	7	1164143:1164155	1182644:1182656
1164143:1164155	attL	ATTCTGGTATGTT	NA	NA	NA	NA
VDY83411.1|1170568_1171207_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
VDY83413.1|1171203_1172466_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
VDY83415.1|1172462_1173371_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
VDY83417.1|1173566_1174334_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
VDY83419.1|1174384_1175041_-	serine/threonine-specific protein phosphatase 2	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
VDY83421.1|1175146_1177714_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.2e-31
VDY83423.1|1178346_1179324_+|integrase	phage integrase	integrase	A0A0R6PGY7	Moraxella_phage	27.9	6.2e-13
1182644:1182656	attR	AACATACCAGAAT	NA	NA	NA	NA
>prophage 3
LR134078	Escherichia coli strain NCTC9085 genome assembly, chromosome: 1	4969367	1639282	1649578	4969367		Pseudomonas_phage(33.33%)	7	NA	NA
VDY84312.1|1639282_1640359_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
VDY84314.1|1640561_1641212_+	pH-inducible protein involved in stress response (putative kinase)	NA	NA	NA	NA	NA
VDY84316.1|1641265_1641520_-	putative ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
VDY84318.1|1641519_1642650_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
VDY84320.1|1642839_1644375_-	ribonucleoside-diphosphate reductase	NA	A0A2D1GNB1	Pseudoalteromonas_phage	61.5	5.8e-183
VDY84322.1|1644328_1645126_-	ribonucleoside-diphosphate reductase	NA	A0A1W5PTL2	Pseudoalteromonas_phage	70.2	1.6e-107
VDY84324.1|1645801_1649578_+	adhesin	NA	A0A2L1IV18	Escherichia_phage	26.9	2.6e-22
>prophage 4
LR134078	Escherichia coli strain NCTC9085 genome assembly, chromosome: 1	4969367	1769140	1778579	4969367		Enterobacteria_phage(85.71%)	9	NA	NA
VDY84508.1|1769140_1770067_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
VDY84509.1|1770071_1770842_+	ABC transporter permease	NA	NA	NA	NA	NA
VDY84511.1|1770971_1771679_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.4	7.0e-107
VDY84512.1|1771900_1773586_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VDY84513.1|1773582_1774302_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VDY84514.1|1774348_1774819_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
VDY84515.1|1774859_1775321_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
VDY84517.1|1775931_1777446_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	95.6	3.0e-280
VDY84518.1|1777442_1778579_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 5
LR134078	Escherichia coli strain NCTC9085 genome assembly, chromosome: 1	4969367	2756010	2802455	4969367	integrase,coat,head,capsid,tRNA,portal,holin,terminase,tail	Enterobacteria_phage(55.56%)	62	2781848:2781862	2801672:2801686
VDY86379.1|2756010_2759424_-|tail	phage tail domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.3e-12
VDY86381.1|2759488_2760088_-	outer membrane precursor Lom	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
VDY86383.1|2760154_2763358_-	Host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	87.5	0.0e+00
VDY86385.1|2763612_2764185_-|tail	phage tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	3.0e-84
VDY86387.1|2764181_2764925_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
VDY86389.1|2764930_2765629_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
VDY86391.1|2765628_2765958_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
VDY86393.1|2765954_2768249_-|tail	tail component of prophage	tail	A0A0K2FI43	Enterobacteria_phage	89.8	0.0e+00
VDY86395.1|2768507_2768942_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VDY86397.1|2768923_2769346_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
VDY86399.1|2769361_2770102_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
VDY86401.1|2770109_2770505_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VDY86403.1|2770501_2771080_-|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
VDY86405.1|2771091_2771445_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
VDY86407.1|2771456_2771855_-	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
VDY86409.1|2771896_2772922_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
VDY86411.1|2772977_2773310_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
VDY86413.1|2773319_2774639_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	98.9	1.3e-234
VDY86415.1|2774619_2776221_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.9e-310
VDY86417.1|2776217_2776424_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VDY86419.1|2776420_2778346_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
VDY86421.1|2778320_2778866_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
VDY86423.1|2779342_2779696_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86425.1|2779818_2780145_-	truncated TonB-like membrane protein encoded within prophage	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
VDY86427.1|2780625_2780919_+	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
VDY86429.1|2780950_2781412_-	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	98.7	4.1e-76
VDY86431.1|2781408_2781885_-	phage endolysin	NA	K7PKV2	Enterobacteria_phage	95.6	3.3e-84
2781848:2781862	attL	TCGAGGAAAGCTTTA	NA	NA	NA	NA
VDY86433.1|2781871_2782177_-|holin	Putative holin protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
VDY86435.1|2782498_2783188_-	Putative antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	1.9e-56
VDY86437.1|2783184_2783322_-	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	72.1	2.2e-09
VDY86439.1|2783321_2783684_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	93.2	6.2e-59
VDY86441.1|2783680_2783971_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	94.8	6.7e-48
VDY86443.1|2783963_2784134_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
VDY86445.1|2784133_2784589_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
VDY86447.1|2785036_2786080_+	exported protein precursor	NA	NA	NA	NA	NA
VDY86449.1|2786429_2787956_-	site-specific invertase; DLP12 prophage	NA	Q3HQV4	Burkholderia_phage	30.8	2.7e-31
VDY86451.1|2788211_2788544_-	Multidrug transporter emrE	NA	NA	NA	NA	NA
VDY86452.1|2788611_2788914_-	Ren protein from phage origin	NA	A0A0N6WES4	Escherichia_phage	94.6	7.5e-42
VDY86454.1|2788910_2789612_-	replication protein P of bacteriophage	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	5.4e-128
VDY86456.1|2789608_2789983_-	phage protein	NA	A0A1I9LJP3	Stx_converting_phage	98.4	4.0e-69
VDY86458.1|2790098_2790614_-	replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	60.7	4.7e-36
VDY86460.1|2790625_2791165_-	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
VDY86462.1|2791195_2791423_-	represror Cro	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
VDY86464.1|2791740_2792226_+	Regulatory protein CI from bacteriophage origin	NA	Q76H56	Enterobacteria_phage	84.5	3.1e-74
VDY86466.1|2792308_2792572_+	Uncharacterised protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
VDY86468.1|2792749_2793028_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86470.1|2793577_2793784_+	prophage Kil protein	NA	K7P6H3	Enterobacteria_phage	83.8	3.5e-27
VDY86472.1|2793859_2794156_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
VDY86474.1|2794161_2794629_+	bacteriophage recombination protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	2.2e-40
VDY86476.1|2794625_2794946_+	Bet protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	1.1e-51
VDY86478.1|2794942_2795623_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	7.9e-132
VDY86480.1|2795619_2795748_+	phage protein	NA	A0A1U8QQC1	Enterobacteria_phage	92.9	1.7e-16
VDY86482.1|2796042_2796258_+	ybl17	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
VDY86484.1|2796356_2796578_+	putative C4-type zinc finger protein	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
VDY86486.1|2796577_2796910_+	phage related protein	NA	A5VWB6	Enterobacteria_phage	95.7	1.0e-47
VDY86488.1|2796887_2797127_+	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	86.1	4.1e-35
VDY86490.1|2797266_2797503_+	excisionase	NA	NA	NA	NA	NA
VDY86492.1|2797492_2798635_+|integrase	prophage lambda integrase	integrase	O21929	Phage_21	99.4	2.6e-204
VDY86494.1|2798748_2799999_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
VDY86496.1|2800170_2800824_+	ribosomal large subunit pseudouridine synthase E (rRNA pseudouridylate synthase E)	NA	NA	NA	NA	NA
VDY86498.1|2800833_2801295_+	putative NUDIX-family hydrolase	NA	NA	NA	NA	NA
VDY86500.1|2801348_2802455_+|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
2801672:2801686	attR	TAAAGCTTTCCTCGA	NA	NA	NA	NA
>prophage 6
LR134078	Escherichia coli strain NCTC9085 genome assembly, chromosome: 1	4969367	2916524	2928231	4969367	transposase	Shigella_phage(40.0%)	13	NA	NA
VDY86736.1|2916524_2916707_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	67.2	1.1e-19
VDY86738.1|2916813_2918076_-	cobalamin synthesis protein	NA	NA	NA	NA	NA
VDY86740.1|2918273_2919179_-	IS2 element protein	NA	Q9ZXG3	Shigella_phage	99.7	3.3e-178
VDY86742.1|2919136_2919502_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VDY86744.1|2919612_2920404_-	Nickel uptake substrate-specific transmembrane region	NA	NA	NA	NA	NA
VDY86746.1|2920422_2922393_-	putative outer membrane heme/hemoglobin receptor	NA	NA	NA	NA	NA
VDY86748.1|2922738_2923632_+	Transposase for transposon Tn5	NA	NA	NA	NA	NA
VDY86750.1|2923757_2924102_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VDY86752.1|2924089_2924206_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86753.1|2924664_2925099_-	putative inner membrane protein	NA	NA	NA	NA	NA
VDY86754.1|2926018_2926336_+|transposase	transposase insG	transposase	NA	NA	NA	NA
VDY86756.1|2926463_2926922_-|transposase	transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
VDY86758.1|2927208_2928231_+|transposase	transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 7
LR134078	Escherichia coli strain NCTC9085 genome assembly, chromosome: 1	4969367	2939648	2972407	4969367	transposase	Shigella_phage(50.0%)	41	NA	NA
VDY86770.1|2939648_2940674_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY86771.1|2940999_2941500_-	PapX protein	NA	NA	NA	NA	NA
VDY86772.1|2941697_2942438_-	putative EAL domain-containing protein	NA	NA	NA	NA	NA
VDY86773.1|2942741_2943704_-	F1C fimbrial adhesin	NA	NA	NA	NA	NA
VDY86774.1|2943776_2944268_-	F1C minor fimbrial subunit protein G presursor	NA	NA	NA	NA	NA
VDY86776.1|2944289_2944817_-	S-fimbrial adhesin protein SfaG	NA	NA	NA	NA	NA
VDY86777.1|2944829_2947460_-	F1C fimbrial usher	NA	NA	NA	NA	NA
VDY86778.1|2947531_2948227_-	F1C periplasmic chaperone	NA	NA	NA	NA	NA
VDY86779.1|2948267_2948522_-	S fimbriae minor subunit SfaD	NA	NA	NA	NA	NA
VDY86780.1|2948466_2948715_-	S fimbriae minor subunit SfaD	NA	NA	NA	NA	NA
VDY86782.1|2948878_2949427_-	S-fimbrial adhesin, major subunit SfaA	NA	NA	NA	NA	NA
VDY86783.1|2949533_2949626_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86784.1|2949801_2950167_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VDY86785.1|2950124_2951030_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	99.7	3.3e-178
VDY86786.1|2951136_2951466_-	major pilu subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
VDY86787.1|2951882_2952104_+	F1C and S fimbrial switch regulatory protein	NA	NA	NA	NA	NA
VDY86789.1|2952378_2952948_-	putative DNA-binding protein	NA	NA	NA	NA	NA
VDY86790.1|2953189_2953702_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86791.1|2953903_2954095_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86792.1|2954159_2954618_+	membraneprotein	NA	NA	NA	NA	NA
VDY86793.1|2954717_2955404_+	microcin M activity protein McmM	NA	NA	NA	NA	NA
VDY86795.1|2955853_2956075_-	microcin M imunity protein McmI	NA	NA	NA	NA	NA
VDY86797.1|2956110_2958207_-	microcin H47 secretion ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	24.4	4.2e-14
VDY86799.1|2958199_2959474_-	microcin H47 secretion protein	NA	NA	NA	NA	NA
VDY86801.1|2959626_2960079_-	putative microcin H47 activating protein	NA	NA	NA	NA	NA
VDY86803.1|2960104_2961655_-	putative microcin H47 biosynthesis protein	NA	NA	NA	NA	NA
VDY86805.1|2961926_2962220_-	MchB protein	NA	NA	NA	NA	NA
VDY86807.1|2962170_2962380_-	microcin H47 immunity protein	NA	NA	NA	NA	NA
VDY86809.1|2962488_2962650_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86811.1|2962791_2963037_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86812.1|2963387_2963612_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VDY86813.1|2963682_2964537_+|transposase	transposase insF	transposase	U5P429	Shigella_phage	41.0	3.6e-49
VDY86814.1|2965413_2966448_-	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A0B6VT43	Edwardsiella_phage	42.5	6.3e-72
VDY86816.1|2967597_2967834_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86818.1|2968245_2968617_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VDY86820.1|2968698_2969007_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86822.1|2969430_2969718_-	putative lipoprotein	NA	NA	NA	NA	NA
VDY86824.1|2970272_2970512_+	Cea-like protein	NA	NA	NA	NA	NA
VDY86826.1|2970588_2971152_-	putative exonuclease family protein	NA	K7RFY5	Vibrio_phage	35.4	4.1e-17
VDY86828.1|2971173_2971863_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VDY86830.1|2972176_2972407_+|transposase	putative transposase	transposase	NA	NA	NA	NA
>prophage 8
LR134078	Escherichia coli strain NCTC9085 genome assembly, chromosome: 1	4969367	3150675	3238004	4969367	plate,integrase,capsid,tRNA,portal,protease,terminase,tail	Salmonella_phage(55.93%)	94	3203240:3203266	3238079:3238105
VDY87143.1|3150675_3151968_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
VDY87145.1|3152058_3153402_-	putative ATPase	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
VDY87147.1|3153412_3154024_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VDY87149.1|3154182_3158250_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
VDY87151.1|3158384_3158879_-	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VDY87153.1|3159318_3160389_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.6e-62
VDY87155.1|3160511_3162278_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
VDY87157.1|3162278_3164000_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
VDY87159.1|3164041_3164746_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VDY87161.1|3165030_3165249_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VDY87163.1|3165932_3168209_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
VDY87165.1|3168239_3168560_-|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
VDY87167.1|3168882_3169107_+	stationary phase/starvation inducible regulatory protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
VDY87169.1|3169179_3171126_-	macrolide export ATP-binding/permease protein	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
VDY87171.1|3171122_3172220_-	macrolide-specific efflux protein	NA	NA	NA	NA	NA
VDY87173.1|3172352_3173345_+	virulence protein	NA	NA	NA	NA	NA
VDY87175.1|3173341_3175000_-	nucleoside triphosphate hydrolase domain	NA	NA	NA	NA	NA
VDY87177.1|3175425_3176121_+	aquaporin Z	NA	NA	NA	NA	NA
VDY87179.1|3176614_3177298_+	transporter	NA	NA	NA	NA	NA
VDY87181.1|3177326_3177515_+	transporter	NA	NA	NA	NA	NA
VDY87183.1|3177658_3179311_+	hydroxylamine reductase	NA	NA	NA	NA	NA
VDY87185.1|3179322_3180291_+	HCP oxidoreductase, NADH-dependent	NA	NA	NA	NA	NA
VDY87187.1|3180423_3182142_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
VDY87189.1|3182178_3183180_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
VDY87191.1|3183190_3184621_+	NAD(P)-binding Rossmann-fold domain	NA	NA	NA	NA	NA
VDY87193.1|3184683_3185733_+	nucleotide di-P-sugar epimerase or dehydratase	NA	NA	NA	NA	NA
VDY87195.1|3185729_3186560_-	putative N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
VDY87197.1|3186556_3186880_-	conserved protein, UPF0145 family	NA	NA	NA	NA	NA
VDY87199.1|3187005_3187521_+	lipoprotein	NA	NA	NA	NA	NA
VDY87201.1|3187738_3188467_+	arginine transport system ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
VDY87203.1|3188484_3189216_+	arginine ABC transporter, substrate-binding protein	NA	NA	NA	NA	NA
VDY87205.1|3189222_3189939_+	arginine transport system permease	NA	NA	NA	NA	NA
VDY87207.1|3189938_3190607_+	arginine ABC transporter permease	NA	NA	NA	NA	NA
VDY87209.1|3190832_3191564_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDY87211.1|3191592_3192720_-	23S rRNA (uracil-5-)-methyltransferase	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
VDY87213.1|3192760_3193249_-	inner membrane protein	NA	NA	NA	NA	NA
VDY87215.1|3193308_3194154_-	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VDY87217.1|3194150_3195095_-	putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VDY87219.1|3195104_3196238_-	putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
VDY87221.1|3196332_3197445_-	putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDY87223.1|3197794_3198271_-	TPR repeat-containing protein	NA	NA	NA	NA	NA
VDY87225.1|3198358_3199261_-	ribosomal protein S6 modification protein	NA	I3ULC9	Synechococcus_phage	34.4	2.0e-37
VDY87227.1|3199321_3200044_-	nitroreductase A	NA	NA	NA	NA	NA
VDY87229.1|3200027_3200315_-	inner membrane protein	NA	NA	NA	NA	NA
VDY87231.1|3200474_3200732_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
VDY87233.1|3200761_3201139_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
VDY87235.1|3201408_3203094_+	putative transport protein with two RCK domains	NA	NA	NA	NA	NA
3203240:3203266	attL	ATGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
VDY87237.1|3203330_3203549_-	prophage P2 OGR-like protein	NA	Q53ZE7	Salmonella_virus	69.0	9.8e-20
VDY87239.1|3203639_3204740_-	Late control protein D protein	NA	E5G6Q3	Salmonella_phage	85.2	1.0e-176
VDY87241.1|3204736_3205222_-|tail	bacteriophage tail protein GpU	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
VDY87243.1|3205218_3208296_-|tail	TP901 family phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
VDY87245.1|3208422_3208725_-|tail	tail E family protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
VDY87247.1|3208779_3209295_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
VDY87249.1|3209304_3210477_-|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	4.6e-204
VDY87251.1|3210603_3211176_-	site-specific DNA recombinase; e14 prophage	NA	A0A0F7LA37	Escherichia_phage	85.7	2.7e-85
VDY87253.1|3211206_3211755_+|tail	tail collar domain-containing protein	tail	A0A0F7LCR3	Escherichia_phage	60.2	1.4e-51
VDY87255.1|3211754_3212357_+|tail	tail fiber assembly	tail	M1SV83	Escherichia_phage	88.5	8.0e-96
VDY87257.1|3212328_3212772_-|tail	Caudovirales tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	51.0	1.6e-37
VDY87259.1|3212774_3214277_-|tail	phage-related tail fiber protein-like protein	tail	M1TAS6	Escherichia_phage	79.8	3.0e-155
VDY87261.1|3214273_3214879_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
VDY87263.1|3214871_3215780_-|plate	Baseplate assembly protein GpJ	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
VDY87265.1|3215766_3216126_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.0	4.0e-50
VDY87267.1|3216122_3216701_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
VDY87269.1|3216769_3217216_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
VDY87271.1|3217208_3217640_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
VDY87273.1|3217735_3218164_-	regulatory protein	NA	E5G6N2	Salmonella_phage	75.9	4.2e-46
VDY87275.1|3218160_3218538_-	membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	6.7e-16
VDY87277.1|3218539_3219052_-	glycoside hydrolase family protein	NA	E5G6N1	Salmonella_phage	90.5	5.8e-87
VDY87279.1|3219032_3219248_-	putative secretory protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
VDY87281.1|3219251_3219455_-|tail	tail X family protein	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
VDY87283.1|3219454_3219919_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	88.3	2.4e-76
VDY87285.1|3220024_3220666_-|terminase	small terminase subunit	terminase	E5G6M7	Salmonella_phage	95.6	5.9e-105
VDY87287.1|3220669_3221728_-|capsid	P2 family phage major capsid protein	capsid	E5G6M6	Salmonella_phage	93.7	9.9e-182
VDY87289.1|3221744_3222578_-|capsid	capsid scaffolding	capsid	A0A1S6KZW9	Salmonella_phage	84.8	8.2e-123
VDY87291.1|3222720_3224487_+	Terminase, ATPase subunit	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
VDY87293.1|3224486_3225431_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	91.2	1.1e-152
VDY87295.1|3225583_3226249_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY87297.1|3226248_3226683_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY87299.1|3226695_3227802_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY87301.1|3228154_3228832_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY87303.1|3228945_3229179_-	Prophage protein	NA	E5G6M1	Salmonella_phage	98.7	6.1e-36
VDY87305.1|3229189_3229378_-	Uncharacterised protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
VDY87307.1|3229530_3231945_-	putative replication protein for prophage	NA	E5G6L9	Salmonella_phage	96.6	0.0e+00
VDY87309.1|3231941_3232799_-	site-specific DNA-methyltransferase	NA	E5G6L8	Salmonella_phage	97.9	1.2e-161
VDY87311.1|3232795_3233023_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	1.7e-35
VDY87313.1|3233022_3233256_-	Protein of uncharacterised function (DUF2732)	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
VDY87315.1|3233323_3233665_-	Uncharacterised protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
VDY87317.1|3233628_3233829_-	Protein of uncharacterised function (DUF2724)	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
VDY87319.1|3233836_3234346_-	phage regulatory protein CII	NA	E5G6L3	Salmonella_phage	98.2	2.9e-86
VDY87321.1|3234410_3234614_-	regulator for prophage	NA	NA	NA	NA	NA
VDY87323.1|3234759_3235329_+	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
VDY87325.1|3235344_3235527_+	Uncharacterised protein	NA	A0A0R6PI25	Moraxella_phage	55.9	8.5e-09
VDY87327.1|3235540_3236872_+	putative KAP-NTPase protein	NA	R9TRQ8	Vibrio_phage	27.1	3.2e-20
VDY87329.1|3236951_3238004_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3238079:3238105	attR	ATGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
>prophage 9
LR134078	Escherichia coli strain NCTC9085 genome assembly, chromosome: 1	4969367	4243309	4266359	4969367	transposase	Enterobacteria_phage(42.86%)	17	NA	NA
VDY90464.1|4243309_4243675_-|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VDY90466.1|4244993_4245563_+	malate transporter	NA	NA	NA	NA	NA
VDY90468.1|4245730_4246114_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VDY90470.1|4246110_4246536_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VDY90472.1|4247007_4247574_+	malate transporter	NA	NA	NA	NA	NA
VDY90474.1|4247961_4248318_+	transcriptional regulator	NA	NA	NA	NA	NA
VDY90476.1|4248420_4248933_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90478.1|4249021_4249294_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VDY90480.1|4249280_4249646_+	putative DNA-binding protein	NA	NA	NA	NA	NA
VDY90482.1|4250346_4252164_+	putative hemolysin activator ShlB-type	NA	NA	NA	NA	NA
VDY90484.1|4252124_4261994_+	putative member of ShlA/HecA/FhaA exoprotein family	NA	A0A0R6PJK4	Moraxella_phage	36.9	9.7e-29
VDY90486.1|4261999_4262374_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90488.1|4262629_4263802_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.2	1.2e-228
VDY90490.1|4263801_4264599_+|transposase	Putative transposase	transposase	U5N3V8	Enterobacteria_phage	99.2	7.3e-145
VDY90492.1|4264638_4265343_-|transposase	IS66 family transposase orfB	transposase	A0A0P0ZBS5	Stx2-converting_phage	49.8	2.2e-44
VDY90494.1|4265362_4265710_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	75.7	4.4e-46
VDY90496.1|4265894_4266359_-|transposase	putative transposase subunit	transposase	Q6H9S5	Enterobacteria_phage	60.5	6.4e-08
>prophage 10
LR134078	Escherichia coli strain NCTC9085 genome assembly, chromosome: 1	4969367	4273232	4316855	4969367	tRNA,integrase,transposase	Macacine_betaherpesvirus(12.5%)	32	4270722:4270736	4304999:4305013
4270722:4270736	attL	ACGGTTGGTGAAACG	NA	NA	NA	NA
VDY90506.1|4273232_4273853_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY90508.1|4274812_4275319_+	PixA protein	NA	NA	NA	NA	NA
VDY90510.1|4275404_4275992_+	PixH protein	NA	NA	NA	NA	NA
VDY90512.1|4276112_4278623_+	fimbrial usher protein PixC	NA	NA	NA	NA	NA
VDY90514.1|4278691_4279423_+	PixD protein	NA	NA	NA	NA	NA
VDY90516.1|4279458_4280022_+	PixJ protein	NA	NA	NA	NA	NA
VDY90518.1|4280105_4280456_+	PixF protein	NA	NA	NA	NA	NA
VDY90520.1|4280645_4281638_+	PixG protein	NA	NA	NA	NA	NA
VDY90522.1|4281690_4282473_+	inner membrane protein	NA	NA	NA	NA	NA
VDY90524.1|4282537_4283227_-|transposase	putative transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.5	1.8e-06
VDY90526.1|4283897_4289408_-	putative DEAD-box helicase-like protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.9	1.8e-48
VDY90528.1|4289404_4290448_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90530.1|4290459_4292343_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90532.1|4292354_4294001_-	Competence protein	NA	NA	NA	NA	NA
VDY90534.1|4294022_4295237_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90536.1|4295613_4296585_+|transposase	putative transposase	transposase	NA	NA	NA	NA
VDY90538.1|4296825_4298097_+	putative membrane-associated, metal-dependent hydrolase	NA	NA	NA	NA	NA
VDY90540.1|4298361_4299624_-|integrase	phage integrase family site specific recombinase	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
VDY90542.1|4300090_4301110_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
VDY90544.1|4301113_4301677_-	D-gluconate kinase	NA	NA	NA	NA	NA
VDY90546.1|4301893_4302925_+	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
VDY90548.1|4302948_4303713_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
VDY90550.1|4303777_4305097_+	Gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
4304999:4305013	attR	ACGGTTGGTGAAACG	NA	NA	NA	NA
VDY90552.1|4305163_4306162_+	L-idonate regulatory protein	NA	NA	NA	NA	NA
VDY90554.1|4306239_4307742_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.2	1.4e-83
VDY90556.1|4307902_4308985_-	putative permease	NA	NA	NA	NA	NA
VDY90558.1|4308984_4310064_-	putative permease	NA	NA	NA	NA	NA
VDY90560.1|4310351_4311863_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	1.7e-46
VDY90562.1|4312105_4312627_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY90564.1|4312851_4313454_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.7e-61
VDY90566.1|4313556_4314000_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VDY90568.1|4313999_4316855_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	3.0e-140
