The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	786331	840284	5468700	integrase,transposase	Salmonella_phage(21.43%)	48	799665:799687	822171:822193
VDY84137.1|786331_786853_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY84139.1|787077_787680_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.3e-61
VDY84141.1|787754_788564_+	prepilin peptidase A	NA	NA	NA	NA	NA
VDY84143.1|788629_789040_+	type II secretion system lipoprotein	NA	NA	NA	NA	NA
VDY84145.1|789198_790017_+	type II secretion protein GspC	NA	NA	NA	NA	NA
VDY84147.1|790046_792107_+	type II secretion system protein D	NA	NA	NA	NA	NA
VDY84149.1|792106_793600_+	type II secretion system protein E	NA	NA	NA	NA	NA
VDY84151.1|793599_794823_+	type II secretion system protein F	NA	NA	NA	NA	NA
VDY84153.1|794839_795295_+	general secretion pathway protein G precursor (epsG-like)	NA	NA	NA	NA	NA
VDY84155.1|795298_795862_+	type II secretion system protein H	NA	NA	NA	NA	NA
VDY84157.1|795858_796230_+	type II secretion system protein I	NA	NA	NA	NA	NA
VDY84159.1|796226_796832_+	type II secretion protein GspJ	NA	NA	NA	NA	NA
VDY84161.1|796828_797806_+	type II secretion system protein K	NA	NA	NA	NA	NA
VDY84163.1|797802_798981_+	type II secretion system protein L	NA	NA	NA	NA	NA
VDY84165.1|798982_799519_+	general secretion pathway protein YghD	NA	NA	NA	NA	NA
799665:799687	attL	TAGTGGTGCCCGGACTCGGAATC	NA	NA	NA	NA
VDY84167.1|799874_800351_-|transposase	transposase, ORF B, IS3 family, IS407 group	transposase	S5WIU1	Leptospira_phage	49.7	3.3e-36
VDY84169.1|801102_803334_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY84171.1|803330_808046_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY84173.1|808057_810256_-	putative ATP-dependent helicase	NA	NA	NA	NA	NA
VDY84175.1|810252_811569_-	putative ATP/GTP binding protein	NA	NA	NA	NA	NA
VDY84177.1|811572_813900_-	Tellurite resistance protein	NA	NA	NA	NA	NA
VDY84179.1|814083_815151_-	Nucleotidyl transferase of uncharacterised function (DUF1814)	NA	NA	NA	NA	NA
VDY84181.1|815150_815768_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY84183.1|815966_818084_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VDY84185.1|819680_820562_+	DNA-binding prophage protein	NA	NA	NA	NA	NA
VDY84187.1|820743_821595_-|integrase	integrase family protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.1	8.3e-46
VDY84189.1|821591_822011_-	ybl123	NA	A0A1B0VMI6	Pseudomonas_phage	50.4	2.7e-26
VDY84191.1|822320_823199_+	chromosome partitioning protein	NA	NA	NA	NA	NA
822171:822193	attR	TAGTGGTGCCCGGACTCGGAATC	NA	NA	NA	NA
VDY84193.1|823192_823309_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY84195.1|824194_824593_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY84197.1|824789_826178_+	DnaB family helicase	NA	O80281	Escherichia_phage	49.7	2.0e-113
VDY84199.1|826167_827793_+	putative ATP/GTP binding protein	NA	NA	NA	NA	NA
VDY84201.1|827782_828514_+	Protein of uncharacterised function (DUF2786)	NA	NA	NA	NA	NA
VDY84203.1|828510_829089_+	Protein of uncharacterised function (DUF2857)	NA	NA	NA	NA	NA
VDY84205.1|829085_829334_+	Uncharacterised protein	NA	A0A291LBA3	Klebsiella_phage	45.3	9.2e-06
VDY84207.1|829343_829601_+	Uncharacterised protein	NA	A0A1V0E5L1	Salmonella_phage	78.8	1.9e-30
VDY84209.1|829587_830196_+	enterohemolysin 2	NA	A0A2H4FN96	Salmonella_phage	59.6	4.2e-36
VDY84211.1|830346_830904_+	EA22-like protein; similarities with EA22 from lambda (modular protein involved in blocking host replication)	NA	A0A076GCN9	Escherichia_phage	73.6	4.9e-15
VDY84213.1|830900_831116_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY84215.1|831112_831340_+	Uncharacterised protein	NA	Q8HAA4	Salmonella_phage	60.3	1.2e-15
VDY84217.1|831602_832889_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY84219.1|833115_833835_+	integrating conjugative element protein, PFL_4669 family	NA	NA	NA	NA	NA
VDY84221.1|833858_835871_+	DNA topoisomerase TopB	NA	A0A1X9I6W8	Streptococcus_phage	29.6	1.2e-39
VDY84223.1|836153_837362_+|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
VDY84225.1|837928_838393_+	Protein of uncharacterised function (DUF3577)	NA	NA	NA	NA	NA
VDY84227.1|838486_838708_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY84229.1|838720_839278_+	Single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	60.3	1.2e-53
VDY84231.1|839324_840284_+|transposase	putative transposase	transposase	Q2A0A7	Sodalis_phage	37.9	5.3e-41
>prophage 2
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	865019	873405	5468700	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
VDY84287.1|865019_866228_+|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
VDY84289.1|866284_866539_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY84291.1|866566_866758_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY84293.1|866772_867207_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
VDY84295.1|867203_867554_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
VDY84297.1|867584_868526_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	7.4e-88
VDY84299.1|868631_869084_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.1	2.3e-34
VDY84301.1|869261_870395_-|transposase	transposase, IS110 family protein	transposase	NA	NA	NA	NA
VDY84303.1|871356_873405_+	iron-regulated outer membrane virulence protein	NA	A0A0P0I887	Acinetobacter_phage	33.5	8.5e-12
>prophage 3
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	1264823	1347890	5468700	integrase,terminase,lysis,capsid,tRNA,head,transposase,protease,tail	Enterobacteria_phage(41.67%)	99	1282374:1282393	1336507:1336526
VDY85052.1|1264823_1265426_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.3e-61
VDY85054.1|1265650_1266172_-|transposase	transposase	transposase	NA	NA	NA	NA
VDY85056.1|1266253_1267534_-	4-aminobutyrate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
VDY85058.1|1267547_1268996_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VDY85060.1|1269018_1270287_-	hydroxyglutarate oxidase	NA	NA	NA	NA	NA
VDY85062.1|1270306_1271284_-	Protein CsiD	NA	NA	NA	NA	NA
VDY85064.1|1271618_1273871_-	alpha-amylase	NA	NA	NA	NA	NA
VDY85066.1|1275257_1276631_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY85068.1|1277542_1282129_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
1282374:1282393	attL	CACGTGCATTTTACGTGCAT	NA	NA	NA	NA
VDY85070.1|1282659_1283001_+	Uncharacterised protein	NA	J9Q6E9	Salmonella_phage	33.6	2.1e-08
VDY85072.1|1283012_1283780_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY85074.1|1283821_1285000_-|integrase	integrase	integrase	I6PDJ1	Cronobacter_phage	88.2	2.8e-201
VDY85076.1|1284954_1285164_-	phage excisionase	NA	I6PBM8	Cronobacter_phage	88.2	9.1e-31
VDY85078.1|1285172_1285319_-	bacteriophage protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	6.3e-23
VDY85080.1|1285322_1285565_-	bacteriophage protein	NA	Q6H9Z8	Enterobacteria_phage	86.2	1.2e-31
VDY85082.1|1285649_1286015_-	putative prophage protein	NA	Q9EY98	Enterobacteria_phage	97.5	6.6e-69
VDY85084.1|1286011_1286512_-	putative prophage protein	NA	Q1MVF7	Enterobacteria_phage	78.9	4.0e-48
VDY85086.1|1286703_1287318_-	putative EA22-like protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	94.5	3.4e-73
VDY85088.1|1287314_1287482_-	prophage protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
VDY85090.1|1287478_1287760_-	Gene 24 protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
VDY85092.1|1288102_1288585_-	prophage protein	NA	K7P6T5	Enterobacteria_phage	96.9	4.6e-78
VDY85094.1|1288568_1289471_-	RecT family protein	NA	K7PKG9	Enterobacteria_phage	88.1	2.6e-146
VDY85096.1|1289467_1289776_-	prophage protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
VDY85098.1|1289756_1289864_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY85100.1|1289860_1290025_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY85102.1|1290021_1290192_-	putative phage regulatory protein CIII	NA	A0A192Y6R1	Salmonella_phage	82.1	2.5e-18
VDY85104.1|1290418_1290619_-	restriction alleviation protein	NA	A0A0K2FJE6	Enterobacteria_phage	97.0	2.7e-32
VDY85106.1|1290744_1291011_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY85108.1|1291019_1291352_-	prophage protein	NA	Q716D8	Shigella_phage	99.1	1.4e-54
VDY85110.1|1291704_1292109_-	prophage protein	NA	Q716D7	Shigella_phage	98.5	1.1e-69
VDY85112.1|1292105_1292738_-	putative prophage repressor	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
VDY85114.1|1292841_1293057_+	regulatory protein cro (antirepressor)	NA	Q716D6	Shigella_phage	100.0	1.4e-31
VDY85116.1|1293173_1293455_+	transcriptional activator protein	NA	K7PMG0	Enterobacteria_phage	98.9	7.4e-44
VDY85118.1|1293489_1293651_+	prophage protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
VDY85120.1|1293637_1294459_+	phage replication Protein	NA	K7PJZ3	Enterobacterial_phage	99.6	3.4e-153
VDY85122.1|1294455_1295832_+	phage replicative DNA Helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	9.7e-254
VDY85124.1|1295904_1296231_+	Uncharacterised protein	NA	Q716D0	Shigella_phage	98.1	6.1e-58
VDY85126.1|1296326_1296428_+	Uncharacterised protein	NA	Q716C9	Shigella_phage	100.0	2.9e-11
VDY85128.1|1296439_1296754_+	phage protein	NA	K7PKU8	Enterobacteria_phage	96.2	1.1e-51
VDY85130.1|1296756_1296993_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
VDY85132.1|1296949_1297396_+	putative prophage protein ninB	NA	Q8VNP6	Enterobacteria_phage	97.3	1.5e-78
VDY85134.1|1297852_1298536_+	Ant antirepressor protein from prophage	NA	Q8HA19	Enterobacteria_phage	86.1	6.1e-108
VDY85136.1|1298610_1299333_+	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	98.8	3.3e-128
VDY85138.1|1299332_1299938_+	bacteriophage Lambda NinG protein	NA	A0A1I9LJQ2	Stx_converting_phage	99.0	1.9e-97
VDY85140.1|1299981_1300500_+	antitermination protein	NA	Q716B8	Shigella_phage	98.8	5.9e-95
VDY85142.1|1301259_1303242_+	YjhS	NA	A0A0P0ZBH7	Stx2-converting_phage	58.8	3.4e-215
VDY85144.1|1303601_1303892_+	Protein of uncharacterised function (DUF826)	NA	A0A1I9LJR2	Stx_converting_phage	67.7	8.3e-06
VDY85146.1|1303967_1304183_+|lysis	putative lysis protein S	lysis	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
VDY85148.1|1304186_1304822_+	phage protein	NA	Q08JA0	Stx2-converting_phage	83.3	2.4e-50
VDY85150.1|1304769_1305030_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY85152.1|1305141_1305675_+	membrane-associated lysozyme; Qin prophage	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.1e-99
VDY85154.1|1305867_1306014_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY85156.1|1306028_1306160_+	Uncharacterised protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
VDY85158.1|1306222_1306630_+	Endopeptidase (Lysis protein) from bacteriophage origin	NA	Q9EYC9	Enterobacteria_phage	89.6	5.9e-58
VDY85160.1|1307192_1307702_+	prophage Qin DNA packaging protein NU1-like protein	NA	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
VDY85162.1|1307673_1309602_+|terminase	terminase large subunit (Gp2)	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.0e-261
VDY85164.1|1309585_1309792_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
VDY85166.1|1309788_1311381_+|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	61.5	2.2e-185
VDY85168.1|1311370_1312876_+|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	54.3	2.1e-100
VDY85170.1|1312912_1313260_+|head	phage head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	2.2e-21
VDY85172.1|1313317_1314346_+|head	phage major head protein	head	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
VDY85174.1|1314397_1314781_+	phage protein	NA	NA	NA	NA	NA
VDY85176.1|1314773_1315127_+|capsid	Tail attachment protein (Minor capsid protein FII)	capsid	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
VDY85177.1|1315142_1315676_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
VDY85179.1|1315672_1316068_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	5.2e-59
VDY85181.1|1316075_1316828_+|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
VDY85183.1|1316841_1317273_+|tail	tail component of prophage CP-933O	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
VDY85185.1|1317299_1317713_+|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
VDY85187.1|1317693_1320267_+|tail	Minor tail protein precursor H	tail	A0A2R9YJM8	Escherichia_phage	82.7	0.0e+00
VDY85189.1|1320263_1320593_+|tail	Minor tail protein M	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
VDY85191.1|1320592_1321291_+|tail	minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	8.4e-129
VDY85193.1|1321347_1321884_-|protease	putative Clp protease	protease	NA	NA	NA	NA
VDY85195.1|1321883_1322132_-	putative regulatory protein (mnt like)	NA	G0ZNE9	Cronobacter_phage	46.2	8.9e-09
VDY85197.1|1322445_1323360_+	putative antirepressor protein from phage origin	NA	A5VW58	Enterobacteria_phage	61.2	2.8e-92
VDY85199.1|1323414_1324152_+	cell wall-associated hydrolases (invasion-associated proteins)	NA	A0A0P0ZDT1	Stx2-converting_phage	89.4	2.3e-137
VDY85201.1|1324148_1324370_+|tail	putative tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.5	1.6e-30
VDY85203.1|1324427_1325174_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VDY85205.1|1325188_1326730_-|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VDY85207.1|1326998_1327316_+|tail	putative tail assembly protein	tail	Q687E9	Enterobacteria_phage	92.2	4.0e-46
VDY85209.1|1327570_1331101_+	Host specificity protein J from prophage	NA	A0A0P0ZEQ8	Stx2-converting_phage	83.9	0.0e+00
VDY85211.1|1331283_1332846_+|tail	putative tail fiber protein from prophage	tail	Q9LA62	Enterobacterial_phage	99.1	5.4e-59
VDY85213.1|1332862_1333444_+|tail	putative phage tail fiber protein	tail	Q9MCI9	Enterobacteria_phage	94.8	4.0e-100
VDY85215.1|1334239_1335322_+	putative immunoglobulin-binding protein from phage origin	NA	A0A2L1IV32	Escherichia_phage	72.8	2.2e-120
VDY85218.1|1335411_1335885_+	Uncharacterised protein	NA	Q9LA59	Enterobacterial_phage	95.5	4.4e-81
VDY85220.1|1335889_1336063_+	Uncharacterised protein	NA	A0A2L1IV33	Escherichia_phage	67.2	6.4e-14
VDY85222.1|1336099_1336348_-	putative damage-inducible protein dinI-like	NA	S5MQI1	Escherichia_phage	85.2	1.5e-32
VDY85224.1|1337195_1337678_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1336507:1336526	attR	CACGTGCATTTTACGTGCAT	NA	NA	NA	NA
VDY85226.1|1337836_1338286_+	putative oligoketide cyclase/lipid transport protein	NA	NA	NA	NA	NA
VDY85228.1|1338275_1338566_+	RnfH family protein	NA	NA	NA	NA	NA
VDY85230.1|1338627_1338969_-	putative outer membrane assembly lipoprotein	NA	NA	NA	NA	NA
VDY85232.1|1339117_1340779_-	DNA repair protein	NA	NA	NA	NA	NA
VDY85234.1|1340864_1341743_-	inorganic polyphosphate/ATP-NAD kinase	NA	NA	NA	NA	NA
VDY85236.1|1341865_1342459_+	heat shock protein	NA	NA	NA	NA	NA
VDY85238.1|1342513_1343755_-	inner membrane protein, UPF0053 family	NA	NA	NA	NA	NA
VDY85240.1|1343820_1344687_-	putative magnesium transport protein	NA	NA	NA	NA	NA
VDY85242.1|1344778_1346140_+	signal recognition particle protein	NA	NA	NA	NA	NA
VDY85244.1|1346276_1346525_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
VDY85247.1|1346543_1347092_+	16S rRNA-processing protein RimM	NA	NA	NA	NA	NA
VDY85251.1|1347122_1347890_+|tRNA	tRNA (guanine-1-)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	1462248	1468675	5468700	transposase	Escherichia_phage(66.67%)	7	NA	NA
VDY85513.1|1462248_1463715_+	inosine 5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
VDY85515.1|1463783_1465361_+	bifunctional GMP synthase/glutamine amidotransferase protein	NA	NA	NA	NA	NA
VDY85517.1|1465453_1465993_-	Uncharacterised protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
VDY85519.1|1466008_1466524_-	putative lipoprotein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
VDY85521.1|1466837_1467029_-	protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
VDY85523.1|1467046_1467199_+	Uncharacterised protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
VDY85525.1|1467466_1468675_-|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
>prophage 5
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	1774646	1803893	5468700	integrase,capsid,head,transposase,tail	Enterobacteria_phage(33.33%)	35	1774048:1774062	1806489:1806503
1774048:1774062	attL	TTATCAAGCGTGATG	NA	NA	NA	NA
VDY86093.1|1774646_1775168_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY86095.1|1775392_1775995_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.3e-61
VDY86097.1|1776122_1776611_-	ecotin	NA	NA	NA	NA	NA
VDY86099.1|1776744_1776909_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86101.1|1777017_1777512_+	ferredoxin-type protein	NA	NA	NA	NA	NA
VDY86103.1|1777501_1777765_+	NapD protein	NA	NA	NA	NA	NA
VDY86105.1|1777761_1780248_+	periplasmic nitrate reductase	NA	NA	NA	NA	NA
VDY86107.1|1780254_1780950_+	ferredoxin-type protein	NA	NA	NA	NA	NA
VDY86109.1|1780936_1781800_+	ferredoxin-type protein NapH	NA	NA	NA	NA	NA
VDY86111.1|1781796_1782246_+	citrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
VDY86113.1|1782255_1782858_+	cytochrome C-type protein	NA	NA	NA	NA	NA
VDY86115.1|1782876_1783494_+	heme exporter ATP-binding protein (cytochrome C-type biogenesis protein)	NA	G3M9Y6	Bacillus_virus	25.5	1.5e-12
VDY86117.1|1783490_1784153_+	heme exporter protein B	NA	NA	NA	NA	NA
VDY86119.1|1784194_1784932_+	Heme exporter protein C	NA	NA	NA	NA	NA
VDY86121.1|1784928_1785138_+	heme exporter protein D (cytochrome C-type biogenesis protein)	NA	NA	NA	NA	NA
VDY86123.1|1785134_1785614_+	cytochrome C-type biogenesis protein	NA	NA	NA	NA	NA
VDY86125.1|1785610_1787554_+	cytochrome C-type biogenesis protein	NA	NA	NA	NA	NA
VDY86127.1|1787550_1788108_+	thiol:disulfide interchange protein (cytochrome C-type biogenesis protein)	NA	NA	NA	NA	NA
VDY86129.1|1788104_1789157_+	cytochrome C-type biogenesis protein	NA	NA	NA	NA	NA
VDY86131.1|1789191_1789839_-	transcriptional regulator NarP	NA	NA	NA	NA	NA
VDY86133.1|1790158_1792750_+	autotransporter	NA	NA	NA	NA	NA
VDY86135.1|1793896_1794178_-	putative prophage protein	NA	NA	NA	NA	NA
VDY86137.1|1794433_1794976_-	phage DNA packaging protein Nu1	NA	O64316	Escherichia_phage	44.2	1.8e-33
VDY86139.1|1795183_1795597_-|head,tail	putative head-tail preconnector protein from prophage	head,tail	NA	NA	NA	NA
VDY86141.1|1795609_1795945_-|head	prophage head protein	head	NA	NA	NA	NA
VDY86143.1|1795957_1797013_-|capsid	prophage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.1	2.3e-69
VDY86145.1|1797012_1797219_-	putative prophage protein	NA	NA	NA	NA	NA
VDY86147.1|1797459_1797732_-	transcriptional activator	NA	NA	NA	NA	NA
VDY86149.1|1797721_1797985_-	putative prophage protein	NA	NA	NA	NA	NA
VDY86151.1|1798273_1800022_-	nucleic acid independent nucleoside triphosphatase; phage DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.5	9.2e-92
VDY86153.1|1800018_1800318_-	putative prophage protein	NA	NA	NA	NA	NA
VDY86155.1|1800324_1800645_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86157.1|1801389_1801569_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86159.1|1801948_1802155_-	putative transcriptional regulator	NA	NA	NA	NA	NA
VDY86161.1|1802651_1803893_-|integrase	integrase from prophage	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
1806489:1806503	attR	TTATCAAGCGTGATG	NA	NA	NA	NA
>prophage 6
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	1872600	1882045	5468700		Enterobacteria_phage(85.71%)	10	NA	NA
VDY86282.1|1872600_1873527_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
VDY86284.1|1873531_1874263_+	ABC transporter permease	NA	NA	NA	NA	NA
VDY86286.1|1874243_1874351_-	putative inner membrane protein	NA	NA	NA	NA	NA
VDY86288.1|1874410_1875142_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
VDY86290.1|1875363_1877049_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VDY86292.1|1877045_1877765_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VDY86294.1|1877811_1878282_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VDY86296.1|1878322_1878784_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
VDY86298.1|1878908_1880912_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
VDY86300.1|1880908_1882045_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
>prophage 7
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	2036342	2087906	5468700	integrase,terminase,capsid,head,transposase,tail	Escherichia_phage(37.78%)	60	2029766:2029781	2077018:2077033
2029766:2029781	attL	ATTATCCTTCACCTCA	NA	NA	NA	NA
VDY86555.1|2036342_2037368_-|integrase	site-specific recombinase, phage integrase family	integrase	A0A192Y7M7	Salmonella_phage	57.3	8.9e-103
VDY86557.1|2037367_2037571_-	putative prophage protein	NA	NA	NA	NA	NA
VDY86559.1|2037629_2040080_-	putative exonuclease from phage origin	NA	K7PLW7	Enterobacteria_phage	59.6	2.7e-57
VDY86561.1|2040175_2040364_-	phage protein	NA	NA	NA	NA	NA
VDY86563.1|2040360_2040549_-	Cell division inhibition protein dicB from bacteriophage origin	NA	NA	NA	NA	NA
VDY86565.1|2041083_2041458_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86567.1|2041469_2041622_-	ydfA	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
VDY86569.1|2041827_2042235_-	transcriptional repressor DicA	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
VDY86571.1|2042311_2042539_+	DNA-binding transcriptional regulator DicC	NA	NA	NA	NA	NA
VDY86573.1|2042522_2043074_+	phage regulatory protein CII	NA	NA	NA	NA	NA
VDY86575.1|2043045_2044086_+	replication protein	NA	A0A0U2RT81	Escherichia_phage	86.2	7.4e-89
VDY86577.1|2044117_2044540_+	replication protein in prophage	NA	A0A0U2JGJ0	Escherichia_phage	98.6	3.4e-77
VDY86579.1|2045286_2046129_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86581.1|2046723_2047590_-|transposase	IS3 element transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
VDY86583.1|2047586_2047886_-|transposase	transposase	transposase	NA	NA	NA	NA
VDY86585.1|2048428_2049802_+	ATP-binding protein	NA	NA	NA	NA	NA
VDY86587.1|2049788_2050424_+	HNH endonuclease	NA	NA	NA	NA	NA
VDY86589.1|2051109_2051361_+	putative prophage protein	NA	NA	NA	NA	NA
VDY86591.1|2051427_2051706_+	putative prophage protein	NA	I6PCV7	Cronobacter_phage	46.9	2.2e-11
VDY86593.1|2051707_2052757_+	putative prophage protein	NA	U5P0K4	Shigella_phage	55.2	4.5e-110
VDY86595.1|2052769_2053132_+	crossover junction endodeoxyribonuclease rusA (Holliday junction nuclease rusA) (Holliday juction resolvase)(Gp67)	NA	V5URS4	Shigella_phage	61.1	4.0e-34
VDY86597.1|2053124_2053814_+	Antitermination protein Q	NA	I6PDF8	Cronobacter_phage	47.6	1.0e-54
VDY86599.1|2053903_2054224_+	lipoprotein	NA	S5MQK8	Escherichia_phage	94.7	3.9e-33
VDY86601.1|2054486_2055074_+	AraC family regulatory protein	NA	NA	NA	NA	NA
VDY86603.1|2056304_2058284_+	YjhS	NA	Q6H9W1	Enterobacteria_phage	60.1	1.7e-219
VDY86605.1|2058643_2058934_+	Protein of uncharacterised function (DUF826)	NA	A0A1I9LJR2	Stx_converting_phage	67.7	8.3e-06
VDY86607.1|2059019_2059226_+	Lysis protein S from bacteriophage origin	NA	A0A0P0ZC45	Stx2-converting_phage	80.9	3.3e-25
VDY86609.1|2059230_2059764_+	putative membrane-associated lysozyme; Qin prophage	NA	A0A1U9AJ98	Stx1_converting_phage	88.7	1.2e-90
VDY86611.1|2059956_2060103_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86613.1|2060117_2060249_+	Uncharacterised protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
VDY86615.1|2060311_2060719_+	Endopeptidase (Lysis protein) from bacteriophage origin	NA	Q9EYC9	Enterobacteria_phage	89.6	5.9e-58
VDY86617.1|2061314_2061821_+	putative phage DNA packaging protein	NA	O64316	Escherichia_phage	47.9	3.7e-33
VDY86619.1|2061792_2063406_+|terminase	terminase large subunit (Gp2)	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	6.3e-204
VDY86621.1|2063377_2063722_+|terminase	terminase large subunit (Gp2)	terminase	A0A2I6TC92	Escherichia_phage	58.3	9.4e-25
VDY86623.1|2063705_2063912_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	56.9	7.9e-11
VDY86625.1|2063908_2065501_+|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	61.1	1.4e-184
VDY86627.1|2065490_2066996_+|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
VDY86629.1|2067032_2067380_+|head	phage head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	1.3e-21
VDY86631.1|2067437_2068466_+|head	phage major head protein	head	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
VDY86633.1|2068517_2068901_+	DNA packaging protein	NA	NA	NA	NA	NA
VDY86635.1|2068893_2069247_+|capsid	Tail attachment protein (Minor capsid protein FII)	capsid	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
VDY86637.1|2069262_2069796_+|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	4.5e-58
VDY86639.1|2069792_2070188_+|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	7.4e-58
VDY86641.1|2070195_2070942_+|tail	major tail protein V	tail	Q687F6	Enterobacteria_phage	79.6	9.7e-91
VDY86643.1|2070963_2071395_+|tail	minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.3	7.6e-40
VDY86645.1|2071421_2071835_+|tail	minor tail protein T	tail	Q687F4	Enterobacteria_phage	86.9	2.9e-44
VDY86647.1|2071815_2074377_+|tail	tail component of prophage	tail	A0A2R9YJM8	Escherichia_phage	85.3	0.0e+00
VDY86649.1|2074373_2074703_+|tail	Minor tail protein M	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
VDY86651.1|2074702_2075401_+|tail	minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	1.9e-128
VDY86653.1|2075411_2076155_+|tail	tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	92.7	7.0e-142
VDY86655.1|2076151_2076733_+|tail	putative tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.1	1.2e-93
VDY86657.1|2076982_2080513_+	host specificity protein	NA	A0A0P0ZCI5	Stx2-converting_phage	84.0	0.0e+00
2077018:2077033	attR	TGAGGTGAAGGATAAT	NA	NA	NA	NA
VDY86659.1|2080882_2082436_+|tail	putative tail fiber protein from prophage	tail	Q9LA62	Enterobacterial_phage	98.3	3.5e-58
VDY86661.1|2082452_2083031_+|tail	putative phage tail fiber protein	tail	Q7BQC6	Enterobacteria_phage	91.5	2.2e-95
VDY86663.1|2083511_2084648_+	putative immunoglobulin-binding protein from phage origin	NA	A0A2L1IV32	Escherichia_phage	64.2	1.1e-106
VDY86665.1|2084736_2085210_+	Uncharacterised protein	NA	Q9LA59	Enterobacterial_phage	93.6	7.0e-79
VDY86667.1|2085214_2085388_+	Uncharacterised protein	NA	A0A2L1IV33	Escherichia_phage	63.8	2.7e-12
VDY86669.1|2085558_2085771_+	Uncharacterised protein	NA	S5MBX6	Escherichia_phage	97.1	7.1e-31
VDY86671.1|2086118_2086670_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86673.1|2087375_2087906_-	cytochrome	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 8
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	2139602	2176493	5468700	terminase,capsid,portal,head,tail,plate	Enterobacteria_phage(67.65%)	52	NA	NA
VDY86823.1|2139602_2140748_-	late control gene D protein from prophage	NA	A0A0A7NQ97	Enterobacteria_phage	74.3	3.6e-153
VDY86825.1|2140889_2142095_+|tail	Major tail sheath protein FI	tail	A0A0A7NV69	Enterobacteria_phage	72.8	8.1e-164
VDY86827.1|2142094_2142607_+|tail	major tail sheath protein FII from prophage	tail	A0A0A7NPV8	Enterobacteria_phage	62.9	3.1e-56
VDY86829.1|2142658_2143039_+|tail	putative phage tail protein	tail	NA	NA	NA	NA
VDY86831.1|2143186_2146018_+|tail	putative tail protein from prophage; putative tail length tape measure motif	tail	F1BUT7	Erwinia_phage	52.0	5.8e-104
VDY86833.1|2146029_2146494_+|tail	tail fiber protein	tail	A0A0A7NV65	Enterobacteria_phage	79.2	6.9e-63
VDY86838.1|2146529_2147132_-|tail	putative phage tail fiber protein	tail	Q7BQC6	Enterobacteria_phage	82.1	9.9e-86
VDY86840.1|2147148_2148738_-|tail	putative phage tail fiber protein	tail	Q37842	Escherichia_phage	54.1	2.0e-53
VDY86842.1|2148734_2149454_-|tail	tail protein I (GpI) from prophage	tail	A0A0F7LDF3	Escherichia_phage	52.4	6.1e-50
VDY86844.1|2149446_2150343_-|plate	Baseplate assembly protein GpJ from prophage	plate	A0A0A7NPY5	Enterobacteria_phage	65.1	1.5e-101
VDY86846.1|2150329_2150698_-|plate	Baseplate assembly protein GpW from prophage	plate	A0A0A7NQ90	Enterobacteria_phage	52.2	4.7e-30
VDY86848.1|2150694_2151276_-|plate	Baseplate assembly protein GpV from prophage	plate	A0A0A7NRZ3	Enterobacteria_phage	58.5	4.3e-62
VDY86850.1|2151272_2151908_-|tail	putative phage tail completion protein S	tail	A0A0A7NV60	Enterobacteria_phage	45.7	3.6e-46
VDY86853.1|2151904_2152375_-|tail	phage tail completion protein R	tail	A0A0A7NPU6	Enterobacteria_phage	58.0	8.3e-48
VDY86855.1|2152547_2152712_-	Protein of uncharacterised function (DUF1378)	NA	S5MBZ5	Escherichia_phage	53.7	1.3e-08
VDY86860.1|2152776_2154747_-	YjhS	NA	Q20GJ1	Phage_258-320	55.8	3.7e-198
VDY86862.1|2154865_2155300_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86864.1|2155296_2155836_-	prophage lysozyme	NA	A0A1S5Q8G1	Aeromonas_phage	41.1	1.7e-28
VDY86866.1|2155819_2156110_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86868.1|2156112_2156313_-|tail	tail protein X from prophage	tail	A0A0A7NV57	Enterobacteria_phage	66.2	4.6e-16
VDY86870.1|2156312_2156807_-|head	putative phage head completion protein L	head	A0A0A7NPU2	Enterobacteria_phage	70.6	7.9e-57
VDY86872.1|2156915_2157725_-|terminase	putative phage terminase (endonuclease subunit)	terminase	A0A0A7NPX9	Enterobacteria_phage	59.7	4.3e-68
VDY86874.1|2157774_2158869_-|capsid	capsid proteins (GpN)	capsid	A0A0A7NQ82	Enterobacteria_phage	61.0	1.1e-119
VDY86876.1|2158884_2159721_-|capsid	putative capsid scaffolding protein (GpO)	capsid	A0A0A7NRY7	Enterobacteria_phage	56.8	1.3e-83
VDY86878.1|2159878_2161612_+|terminase	terminase, ATPase subunit (GpP)	terminase	A0A0A7NV54	Enterobacteria_phage	71.4	2.6e-248
VDY86880.1|2161617_2162661_+|portal	putative portal vertex protein (GpQ) from prophage	portal	A0A0A7NPT9	Enterobacteria_phage	70.5	4.6e-147
VDY86882.1|2163479_2163752_+	putative transmembrane protein	NA	NA	NA	NA	NA
VDY86884.1|2163801_2164119_-	Single-stranded DNA-binding protein (fragment)	NA	NA	NA	NA	NA
VDY86886.1|2164151_2164490_-	Protein ren (modular protein) from prophage	NA	K7P7K7	Enterobacteria_phage	41.4	6.9e-12
VDY86888.1|2164486_2164657_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86890.1|2164705_2165110_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86892.1|2165106_2167620_-	putative endonuclease from prophage, replication protein A (GpA)	NA	A0A0A7NQ77	Enterobacteria_phage	51.3	4.1e-210
VDY86894.1|2167616_2168033_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86896.1|2168101_2168323_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	85.9	1.5e-23
VDY86898.1|2169144_2169495_-	phage protein	NA	A0A2I6TCY5	Escherichia_phage	65.5	5.6e-25
VDY86900.1|2169485_2169704_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86902.1|2169700_2169937_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86904.1|2169972_2170953_-	DNA adenine methylase from prophage	NA	A0A0M4QWR0	Salmonella_phage	45.2	3.7e-66
VDY86906.1|2170968_2171178_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86908.1|2171187_2171769_-	putative ribonuclease (polynucleotidyl transferase) from prophage	NA	K7PM77	Enterobacteria_phage	37.8	7.4e-30
VDY86910.1|2171768_2171999_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86912.1|2172214_2172340_-	Uncharacterised protein	NA	A0A0A7NPW7	Enterobacteria_phage	73.0	6.0e-06
VDY86914.1|2172336_2172576_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86916.1|2172594_2172810_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86918.1|2172823_2173147_-	Uncharacterised protein	NA	A0A0A7NV42	Enterobacteria_phage	50.0	4.5e-21
VDY86920.1|2173172_2173367_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86922.1|2173434_2173638_-	phage regulator DNA-binding protein)	NA	P79674	Haemophilus_phage	50.0	1.4e-07
VDY86924.1|2173709_2173847_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY86926.1|2173936_2174341_+	regulator	NA	Q6QID2	Burkholderia_phage	52.7	7.2e-24
VDY86928.1|2174356_2175001_+	putative transmembrane protein	NA	NA	NA	NA	NA
VDY86930.1|2175199_2175457_+	ybl33	NA	NA	NA	NA	NA
VDY86932.1|2175419_2176493_+	Integrase	NA	Q94N03	Haemophilus_virus	59.1	1.5e-105
>prophage 9
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	2496952	2602822	5468700	integrase,terminase,portal,protease,coat,tail	Escherichia_phage(45.74%)	115	2495662:2495679	2515177:2515194
2495662:2495679	attL	TGTGTTGCACCAGCGGGT	NA	NA	NA	NA
VDY87561.1|2496952_2497774_-|protease	putative protease	protease	NA	NA	NA	NA
VDY87563.1|2498055_2498364_-	acid shock protein	NA	NA	NA	NA	NA
VDY87565.1|2498787_2500041_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VDY87567.1|2500147_2501041_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDY87569.1|2501175_2502396_+	protein Mlc (making large colonies protein)	NA	NA	NA	NA	NA
VDY87571.1|2502520_2503216_+	dithiobiotin synthetase	NA	NA	NA	NA	NA
VDY87573.1|2503168_2504425_-	voltage-gated ClC-type chloride channel	NA	NA	NA	NA	NA
VDY87575.1|2504619_2505234_-	anaerobic dimethyl sulfoxide reductase maturation protein (twin-arginine leader-binding protein)	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
VDY87577.1|2505276_2506131_-	putative dimethyl sulfoxide reductase, anchor subunit	NA	NA	NA	NA	NA
VDY87579.1|2506132_2506687_-	anaerobic dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
VDY87581.1|2506724_2507888_-|integrase	prophage DLP12 integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
VDY87583.1|2508149_2508401_-	bacteriophage protein	NA	G9L6F5	Escherichia_phage	91.6	3.9e-36
VDY87585.1|2508448_2509129_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	97.8	7.4e-130
VDY87587.1|2509125_2509911_-	bacteriophage recombination protein	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
VDY87589.1|2509916_2510213_-	putative host-nuclease inhibitor protein Gam of bacteriophage	NA	V5URU8	Shigella_phage	93.9	5.8e-47
VDY87591.1|2510209_2512282_-	Exodeoxyribonuclease VIII (putative partial) from phage origin	NA	V5UQJ3	Shigella_phage	85.7	0.0e+00
VDY87593.1|2512389_2512776_-	Uncharacterised protein	NA	V5USC5	Shigella_phage	79.7	3.3e-50
VDY87595.1|2512859_2513081_-	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
VDY87597.1|2513537_2513747_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY87599.1|2513715_2514075_-	Uncharacterised protein	NA	A0A088CBI5	Shigella_phage	73.5	2.7e-38
VDY87601.1|2514212_2514494_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY87603.1|2514502_2514808_-	regulatory protein N (early gene regulator)	NA	C6ZCW1	Enterobacteria_phage	83.5	1.4e-35
VDY87605.1|2515141_2515363_+	Uncharacterised protein	NA	NA	NA	NA	NA
2515177:2515194	attR	TGTGTTGCACCAGCGGGT	NA	NA	NA	NA
VDY87607.1|2515515_2516085_-	phage repressor protein CI	NA	A0A0N7C1P9	Escherichia_phage	100.0	3.8e-103
VDY87609.1|2516333_2516558_+	antirepressor protein Cro	NA	A0A0N7C1T6	Escherichia_phage	100.0	1.2e-36
VDY87611.1|2516674_2516971_+	regulatory protein CII from prophage	NA	A0A088CBI6	Shigella_phage	99.0	1.2e-47
VDY87613.1|2516985_2517204_+	Uncharacterised protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
VDY87615.1|2517224_2518313_+	replication protein	NA	V5URT9	Shigella_phage	97.2	7.5e-201
VDY87617.1|2518319_2519060_+	replication protein	NA	A0A088CBP4	Shigella_phage	98.0	4.0e-137
VDY87619.1|2519085_2519856_+	putative phage regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.6e-80
VDY87621.1|2519871_2520303_+	putative prophage protein	NA	A0A088CBK9	Shigella_phage	78.3	8.7e-60
VDY87623.1|2520335_2520827_-	Uncharacterised protein	NA	V5URE2	Shigella_phage	98.8	7.5e-84
VDY87625.1|2521008_2521254_+	Uncharacterised protein	NA	A0A088CC19	Shigella_phage	95.1	1.3e-36
VDY87627.1|2521308_2521617_-	putative transcriptional regulator from the CI family	NA	A0A088CD40	Shigella_phage	90.2	2.2e-41
VDY87629.1|2522253_2522928_+	putative antirepressor protein Ant from prophage	NA	A0A088CD42	Shigella_phage	76.8	9.0e-88
VDY87631.1|2522982_2523393_+	putative ninB protein	NA	A0A088CBP6	Shigella_phage	97.8	5.2e-70
VDY87633.1|2523601_2523895_+	82 prophage-derived uncharacterized protein ybcO	NA	A0A088CE53	Shigella_phage	96.9	1.2e-49
VDY87635.1|2523891_2524254_+	prophage holliday junction resolvase	NA	A0A088CBJ1	Shigella_phage	97.5	5.0e-61
VDY87637.1|2524250_2524451_+	Protein ninH from prophage	NA	A0A0P0ZGE1	Escherichia_phage	74.2	1.6e-21
VDY87639.1|2524443_2524686_+	bacteriophage protein	NA	A0A1B5FPC2	Escherichia_phage	70.5	1.8e-14
VDY87641.1|2524685_2525300_+	Uncharacterised protein	NA	A0A1V0E5R2	Salmonella_phage	86.4	1.5e-97
VDY87643.1|2526267_2528241_+	YjhS	NA	A0A0N7CGH9	Escherichia_phage	58.5	2.4e-213
VDY87645.1|2528601_2528892_+	Protein of uncharacterised function (DUF826)	NA	A0A0N7KZI7	Stx2-converting_phage	64.6	7.0e-05
VDY87647.1|2528977_2529184_+	Lysis protein S	NA	M1FN85	Enterobacteria_phage	94.1	3.1e-31
VDY87649.1|2529188_2529722_+	putative membrane-associated lysozyme; Qin prophage	NA	A0A1U9AJ98	Stx1_converting_phage	88.7	6.9e-91
VDY87651.1|2529914_2530061_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY87653.1|2530075_2530207_+	Uncharacterised protein	NA	A0A0N7BYT9	Escherichia_phage	93.0	1.0e-11
VDY87655.1|2530214_2530682_+	endopeptidase Rz	NA	Q6H9V3	Enterobacteria_phage	94.2	3.3e-73
VDY87657.1|2530983_2531832_+|terminase	small subunit terminase	terminase	A0A2L1IV66	Escherichia_phage	82.6	1.5e-95
VDY87659.1|2531815_2533522_+|terminase	putative large subunit terminase	terminase	A0A2L1IV76	Escherichia_phage	99.6	0.0e+00
VDY87661.1|2533521_2535666_+|portal	putative portal protein	portal	A0A2L1IV74	Escherichia_phage	98.0	0.0e+00
VDY87663.1|2535822_2536830_+	Uncharacterised protein	NA	A0A2L1IV47	Escherichia_phage	96.1	1.1e-174
VDY87665.1|2536852_2538067_+	Uncharacterised protein	NA	A0A088CC32	Shigella_phage	99.0	1.4e-232
VDY87667.1|2538121_2538514_+	Uncharacterised protein	NA	A0A088CD63	Shigella_phage	88.5	1.2e-55
VDY87668.1|2538564_2539026_+	Uncharacterised protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
VDY87670.1|2539009_2539573_+	Uncharacterised protein	NA	A0A2L1IV64	Escherichia_phage	98.9	2.4e-102
VDY87672.1|2539572_2540223_+	Uncharacterised protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
VDY87674.1|2540219_2542097_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	96.3	4.8e-62
VDY87676.1|2542108_2542702_+|tail	putative phage tail fiber protein	tail	Q9LA61	Enterobacterial_phage	73.6	1.8e-76
VDY87678.1|2543498_2544779_+	Immunoglobulin-binding protein from phage origin	NA	A0A2L1IV32	Escherichia_phage	41.4	7.8e-56
VDY87680.1|2544867_2545338_+	Uncharacterised protein	NA	A0A2L1IV29	Escherichia_phage	100.0	7.7e-86
VDY87682.1|2545337_2545520_+	Uncharacterised protein	NA	A0A2L1IV33	Escherichia_phage	100.0	5.0e-25
VDY87684.1|2545701_2547327_+	Uncharacterised protein	NA	A0A2L1IV27	Escherichia_phage	99.8	0.0e+00
VDY87686.1|2547323_2548016_+|tail	tail tip fiber protein	tail	A0A2L1IV54	Escherichia_phage	99.1	8.3e-129
VDY87688.1|2548012_2548591_+|tail	tail tip fiber protein	tail	A0A2L1IV54	Escherichia_phage	97.4	3.1e-97
VDY87690.1|2548892_2549510_+	Uncharacterised protein	NA	A0A2L1IV83	Escherichia_phage	97.6	2.4e-119
VDY87692.1|2549589_2550327_+	outer membrane precursor Lom	NA	A0A2L1IV31	Escherichia_phage	80.8	4.1e-110
VDY87694.1|2550559_2550700_+	small toxic polypeptide	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
VDY87696.1|2550756_2551158_+	Uncharacterised protein	NA	A0A2L1IV61	Escherichia_phage	99.2	1.6e-71
VDY87698.1|2551251_2551908_+	Uncharacterised protein	NA	A0A088CD74	Shigella_phage	97.7	4.8e-102
VDY87700.1|2551910_2552357_+	Uncharacterised protein	NA	A0A2R2Z357	Escherichia_phage	98.0	2.6e-75
VDY87702.1|2552366_2552618_+	proteobacterial sortase system OmpA family protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
VDY87704.1|2552628_2553891_+	Uncharacterised protein	NA	A0A2R2Z372	Escherichia_phage	86.0	5.1e-177
VDY87706.1|2553975_2562345_+	Uncharacterised protein	NA	A0A0P0ZCC7	Stx2-converting_phage	90.5	0.0e+00
VDY87708.1|2562531_2563020_+	phage protein	NA	NA	NA	NA	NA
VDY87710.1|2563108_2563753_-	transcriptional regulator IbrB	NA	A0A0F7L444	uncultured_marine_virus	51.7	1.3e-54
VDY87712.1|2563737_2564922_-	putative phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	1.7e-60
VDY87714.1|2565160_2565790_-	phage anti-repressor protein	NA	A0A0P0ZCA2	Stx2-converting_phage	87.6	4.0e-98
VDY87716.1|2566039_2566324_-	phage anti-repressor protein AntB	NA	G9L6G2	Escherichia_phage	79.8	1.0e-37
VDY87718.1|2566739_2566853_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
VDY87720.1|2566863_2569260_-	putative dimethyl sulfoxide reductase, olydopterin dinucleotide binding subunit	NA	A0A077SK27	Escherichia_phage	48.6	4.8e-208
VDY87722.1|2569347_2571774_-	putative dimethyl sulfoxide reductase, oxidoreductase subunit	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
VDY87724.1|2571972_2572278_-	protein	NA	NA	NA	NA	NA
VDY87726.1|2572349_2573096_+	lipoprotein	NA	NA	NA	NA	NA
VDY87728.1|2573098_2573659_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
VDY87730.1|2573693_2574035_-	protein	NA	NA	NA	NA	NA
VDY87732.1|2574169_2574520_+	inner membrane protein	NA	A0A218MNG8	uncultured_virus	55.6	6.2e-24
VDY87734.1|2574700_2575915_+	starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	5.3e-46
VDY87736.1|2575926_2576325_+	dehydrogenase	NA	A0A2L1IV26	Escherichia_phage	81.2	2.3e-06
VDY87738.1|2576259_2576553_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	92.8	8.3e-46
VDY87740.1|2576876_2577812_+	ParB-like nuclease	NA	R4TG31	Halovirus	39.6	6.7e-49
VDY87742.1|2577804_2578737_+	Uncharacterised protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.2	4.6e-82
VDY87744.1|2578714_2578924_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY87746.1|2578927_2580022_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	7.7e-113
VDY87748.1|2580002_2581304_+|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
VDY87750.1|2581306_2582713_+	Uncharacterised protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
VDY87752.1|2582693_2583809_+	phage protein	NA	I6PD76	Cronobacter_phage	54.1	1.3e-112
VDY87754.1|2583913_2584678_+	Uncharacterised protein	NA	G8C7P6	Escherichia_phage	66.1	5.6e-86
VDY87756.1|2584776_2585916_+|coat	P22 coat protein - gene protein 5	coat	G8C7P7	Escherichia_phage	75.0	4.4e-159
VDY87758.1|2585958_2586135_+	Uncharacterised protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
VDY87760.1|2586138_2586534_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY87762.1|2586533_2586917_+	Uncharacterised protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
VDY87764.1|2586917_2587298_+	Uncharacterised protein	NA	A0A059VF88	Pseudomonas_phage	43.6	6.5e-19
VDY87766.1|2587294_2587687_+	phage protein	NA	NA	NA	NA	NA
VDY87768.1|2587713_2588676_+	Uncharacterised protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
VDY87770.1|2588736_2589186_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY87772.1|2589657_2591916_+|tail	putative phage tail length tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.8	1.2e-78
VDY87774.1|2591954_2592890_+|tail	putative phage tail length tape measure protein	tail	Q6H9T7	Enterobacteria_phage	39.9	4.8e-55
VDY87776.1|2592924_2593221_+|tail	putative phage minor tail protein	tail	H6WZM2	Escherichia_phage	54.1	1.3e-25
VDY87778.1|2593220_2593919_+|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	93.5	6.0e-127
VDY87780.1|2594068_2594668_+|tail	tail component	tail	C6ZCZ3	Enterobacteria_phage	97.0	3.9e-119
VDY87782.1|2594664_2595213_+	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	98.9	9.0e-94
VDY87784.1|2595273_2598687_+|tail	tail component of prophage CP-933K	tail	K7PKJ2	Enterobacteria_phage	97.5	0.0e+00
VDY87786.1|2598756_2599356_+	outer membrane precursor Lom	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	2.4e-108
VDY87788.1|2599420_2602822_+|tail	phage tail domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.2e-12
>prophage 10
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	2792920	2836128	5468700	integrase,terminase,lysis,capsid,portal,head,transposase,coat,tail	Enterobacteria_phage(46.34%)	50	2825037:2825052	2839989:2840004
VDY88108.1|2792920_2795881_-|tail	putative tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	53.6	1.5e-54
VDY88110.1|2795945_2796545_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	93.5	1.2e-104
VDY88112.1|2796612_2800092_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
VDY88114.1|2800152_2800725_-|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	98.9	2.6e-83
VDY88116.1|2800721_2801465_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.4	3.3e-147
VDY88118.1|2801470_2802169_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
VDY88120.1|2802168_2802498_-|tail	Minor tail protein M	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
VDY88122.1|2802494_2805074_-|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.0	0.0e+00
VDY88124.1|2805066_2805501_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.3e-63
VDY88126.1|2805482_2805905_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	4.3e-72
VDY88128.1|2805920_2806661_-|tail	Major tail protein V	tail	A0A2I6TC77	Escherichia_phage	98.0	1.2e-130
VDY88130.1|2806668_2807064_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VDY88134.1|2807060_2807639_-|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
VDY88136.1|2807650_2808004_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
VDY88138.1|2808015_2808411_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
VDY88140.1|2808452_2809478_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
VDY88142.1|2809533_2809866_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
VDY88144.1|2809875_2811195_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
VDY88146.1|2811175_2812777_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
VDY88148.1|2812773_2812980_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VDY88150.1|2812976_2814449_-|terminase	phage terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	1.1e-290
VDY88152.1|2814396_2814903_-|terminase	phage terminase, large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	5.7e-95
VDY88156.1|2814877_2815423_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	6.8e-94
VDY88158.1|2816102_2816513_+	Qin prophage	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
VDY88160.1|2816663_2816837_-	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VDY88162.1|2818086_2818584_-	Qin prophage protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
VDY88164.1|2818580_2819114_-	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
VDY88166.1|2819110_2819422_-	Qin prophage protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
VDY88168.1|2819426_2819633_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
VDY88170.1|2819674_2819794_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY88172.1|2820911_2821124_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
VDY88174.1|2821545_2822298_-	lambdoid prophage Qin antitermination protein Q-like protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
VDY88176.1|2822311_2823361_-	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
VDY88179.1|2823707_2823959_-	putative prophage protein	NA	NA	NA	NA	NA
VDY88181.1|2824175_2824331_-	putative host cell-killing modulation protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
VDY88183.1|2824402_2824690_-	toxin of the RelE-RelB toxin-antitoxin system	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
VDY88185.1|2824689_2824929_-	antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of relBEF	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
2825037:2825052	attL	TGTCCGCTTTGTGCCA	NA	NA	NA	NA
VDY88187.1|2825809_2827018_-|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
VDY88189.1|2827554_2828868_-|integrase,transposase	putative integrase/transposase	integrase,transposase	NA	NA	NA	NA
VDY88191.1|2829202_2829382_-	membrane protein	NA	NA	NA	NA	NA
VDY88193.1|2830539_2830833_+	IS1 protein InsB	NA	U5P0U6	Shigella_phage	92.8	8.3e-46
VDY88195.1|2831256_2831721_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	94.7	2.4e-71
VDY88197.1|2831717_2832215_-	phage lysozome	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
VDY88199.1|2832214_2832430_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
VDY88201.1|2832681_2833077_-	tolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VDY88203.1|2833316_2833655_-	TolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VDY88205.1|2834433_2834571_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY88207.1|2834699_2835242_-	antitermination protein	NA	A0A0U2S606	Escherichia_phage	75.1	8.3e-76
VDY88209.1|2835238_2835529_-	phage protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
VDY88211.1|2835528_2836128_-	phage protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
2839989:2840004	attR	TGGCACAAAGCGGACA	NA	NA	NA	NA
>prophage 11
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	2840078	2855649	5468700	integrase,transposase,tRNA	Escherichia_phage(73.68%)	21	2832629:2832642	2858737:2858750
2832629:2832642	attL	GAACATCATCAAAT	NA	NA	NA	NA
VDY88219.1|2840078_2840495_-	exclusion protein	NA	A0A0U2QQN3	Escherichia_phage	91.9	3.6e-63
VDY88221.1|2840510_2841272_-	transcription regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
VDY88223.1|2841294_2842041_-	putative phage DNA replication protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
VDY88225.1|2842047_2842905_-	phage protein	NA	A0A0U2RT81	Escherichia_phage	84.6	2.2e-70
VDY88227.1|2842917_2843340_-	Protein of uncharacterised function (DUF1019)	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
VDY88229.1|2843336_2843591_-	putative phage regultory protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
VDY88231.1|2843670_2844090_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
VDY88233.1|2844380_2844515_+	Rac prophage protein	NA	NA	NA	NA	NA
VDY88235.1|2844525_2844681_+	Rac prophage; predicted protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
VDY88237.1|2844677_2845289_-	prophage CP-933R superinfection exclusion protein	NA	NA	NA	NA	NA
VDY88239.1|2845607_2845829_+	FtsZ inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
VDY88241.1|2845828_2845999_+	Rac prophage; zinc-binding protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
VDY88243.1|2846073_2846349_+	putative bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
VDY88245.1|2846450_2849051_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
VDY88247.1|2849043_2849853_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
VDY88249.1|2850095_2850284_+	Rac prophage; predicted protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
VDY88251.1|2850383_2850599_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
VDY88253.1|2850600_2851836_+|integrase	phage integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
VDY88255.1|2851887_2852823_+|tRNA	C32 tRNA thiolase	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
VDY88257.1|2852940_2854149_+|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
VDY88259.1|2854275_2855649_-	ATP-independent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
2858737:2858750	attR	GAACATCATCAAAT	NA	NA	NA	NA
>prophage 12
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	2942178	3019926	5468700	integrase,terminase,lysis,portal,head,transposase,protease,tail	Enterobacteria_phage(24.14%)	80	2957995:2958022	3020063:3020090
VDY88430.1|2942178_2943228_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
VDY88432.1|2943447_2944206_+	putative short chain dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
VDY88434.1|2944202_2944793_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
VDY88436.1|2944832_2945708_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
VDY88438.1|2945920_2947816_-	putative inner membrane protein	NA	NA	NA	NA	NA
VDY88440.1|2947843_2948464_-	putative RNA binding protein	NA	NA	NA	NA	NA
VDY88442.1|2948460_2949342_-	putative phosphoesterase	NA	NA	NA	NA	NA
VDY88444.1|2949615_2951178_+	anthranilate synthase component I	NA	NA	NA	NA	NA
VDY88446.1|2951177_2952773_+	anthranilate synthase component II [includes: glutamine amidotransferase; anthranilate phosphoribosyltransferase]	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
VDY88448.1|2952776_2954135_+	tryptophan biosynthesis protein [includes: indole-3-glycero phosphate synthase; N-(5'-phospho ribosyl)anthranilate isomerase]	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
VDY88450.1|2954146_2955340_+	tryptophan synthase	NA	NA	NA	NA	NA
VDY88452.1|2955339_2956146_+	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
VDY88454.1|2956526_2956706_+	protein	NA	NA	NA	NA	NA
VDY88456.1|2956791_2957292_+	YciF protein	NA	NA	NA	NA	NA
VDY88458.1|2957337_2957844_+	protein YciE	NA	NA	NA	NA	NA
2957995:2958022	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
VDY88460.1|2958756_2962764_-	peptidase S6, IgA endopeptidase from phage origin	NA	Q9LA58	Enterobacterial_phage	99.3	0.0e+00
VDY88462.1|2962855_2963038_-	Uncharacterised protein	NA	Q9K335	Enterobacterial_phage	100.0	1.0e-25
VDY88464.1|2963037_2963508_-	Uncharacterised protein	NA	Q9LA55	Enterobacteria_phage	100.0	5.9e-86
VDY88466.1|2963596_2964778_-	Immunoglobulin-binding protein from prophage P-EibA	NA	Q9LA60	Enterobacterial_phage	93.1	4.1e-152
VDY88468.1|2965241_2965988_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VDY88470.1|2966002_2967544_-|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VDY88472.1|2968045_2968621_-|tail	putative phage tail fiber protein	tail	Q9LA61	Enterobacterial_phage	100.0	2.2e-106
VDY88474.1|2968634_2970077_-|tail	putative tail fiber protein from prophage	tail	Q9LA62	Enterobacterial_phage	99.6	7.1e-82
VDY88476.1|2970227_2970827_-	putative Lom-like outer membrane protein of phage origin	NA	Q9LA63	Enterobacterial_phage	89.4	9.5e-97
VDY88478.1|2970894_2974368_-	host specificity protein	NA	A0A0P0ZCI5	Stx2-converting_phage	95.9	0.0e+00
VDY88480.1|2974710_2975292_-|tail	putative tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.9	2.3e-92
VDY88482.1|2975288_2976032_-|tail	tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	94.7	1.1e-142
VDY88484.1|2976042_2976741_-|tail	minor tail protein L	tail	H6WZM3	Escherichia_phage	95.7	2.7e-127
VDY88486.1|2976937_2978101_-	outer membrane porin protein from phage origin	NA	Q1MVN1	Enterobacteria_phage	59.6	7.4e-130
VDY88488.1|2978307_2978649_-|tail	phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	92.9	5.8e-59
VDY88490.1|2978641_2981884_-|tail	putative tail component of prophage	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.6	0.0e+00
VDY88492.1|2981931_2982141_-|tail	putative tail assembly protein of prophage	tail	H6WZM0	Escherichia_phage	100.0	1.5e-33
VDY88494.1|2982236_2982611_-|tail	tail assembly chaperone encoded by prophage CP-933N	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
VDY88496.1|2982616_2983333_-|tail	major tail subunit encoded within prophage CP-933V	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	1.9e-128
VDY88498.1|2983399_2983744_-	putative structural component of prophage	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
VDY88500.1|2983740_2984187_-	putative structural component HK97 gp of phage origin	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
VDY88502.1|2984183_2984534_-|head,tail	putative phage head-tail adaptor	head,tail	A0A0P0ZCU6	Stx2-converting_phage	98.3	1.7e-58
VDY88504.1|2984544_2984871_-	DNA packaging protein	NA	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.6e-53
VDY88506.1|2984867_2986253_-|portal	putative portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	81.8	2.0e-81
VDY88508.1|2986249_2986945_-|portal	portal protein	portal	H6WZL2	Escherichia_phage	99.6	2.0e-122
VDY88510.1|2986941_2987613_-|portal	Putative phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	95.0	7.5e-119
VDY88512.1|2987558_2987780_-	Uncharacterised protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
VDY88514.1|2987824_2989762_-|head,protease	putative major head protein/prohead protease	head,protease	H6WZL0	Escherichia_phage	99.8	0.0e+00
VDY88516.1|2989825_2991487_-|terminase	putative phage terminase, large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
VDY88518.1|2991483_2992047_-|terminase	putative terminase subunit encoded by prophage	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
VDY88520.1|2992338_2992704_-	putative endonuclease from phage origin	NA	B6ETE5	Enterobacteria_phage	95.9	3.5e-62
VDY88522.1|2992745_2992946_+	prophage protein	NA	H6WZK6	Escherichia_phage	93.9	2.4e-28
VDY88524.1|2993077_2993404_-	putative tonB-like membrane protein from phage origin	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
VDY88526.1|2993748_2993973_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY88528.1|2993969_2994464_-	Endopeptidase (Lysis protein) from bacteriophage origin	NA	Q9ZXB6	Enterobacteria_phage	77.2	1.5e-60
VDY88530.1|2994682_2994814_-	Uncharacterised protein	NA	A0A0P0ZG36	Escherichia_phage	74.4	7.5e-07
VDY88532.1|2995106_2995640_-	membrane-associated lysozyme; Qin prophage	NA	B6DZ92	Enterobacteria_phage	94.9	1.5e-98
VDY88534.1|2995765_2996011_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY88536.1|2996059_2997268_+|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
VDY88538.1|2997278_2997827_-	phage protein	NA	Q08JA0	Stx2-converting_phage	88.3	5.9e-53
VDY88540.1|2997831_2998047_-|lysis	putative lysis protein S	lysis	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
VDY88542.1|2998122_2998413_-	Protein of uncharacterised function (DUF826)	NA	NA	NA	NA	NA
VDY88544.1|2998772_3000761_-	YjhS	NA	Q6H9W1	Enterobacteria_phage	59.7	1.9e-218
VDY88546.1|3001286_3001715_-	TolA protein (fragment) of prophage	NA	NA	NA	NA	NA
VDY88548.1|3002195_3003254_-	DNA methylase	NA	A0A0N7KZF8	Stx2-converting_phage	91.5	1.4e-191
VDY88550.1|3003404_3003602_-	lipoprotein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
VDY88552.1|3003828_3004650_-	phage antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.1e-79
VDY88554.1|3004646_3005027_-	Holliday juction resolvase	NA	V5URS4	Shigella_phage	62.7	9.4e-34
VDY88556.1|3005027_3006086_-	phage protein	NA	A0A291AWV9	Escherichia_phage	47.1	2.9e-88
VDY88558.1|3006530_3007409_-	Type-2 restriction enzyme NgoMIV	NA	NA	NA	NA	NA
VDY88560.1|3008725_3009412_-	putative prophage protein	NA	NA	NA	NA	NA
VDY88562.1|3009565_3009991_-	phage protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
VDY88564.1|3010006_3010777_-	putative phage regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
VDY88566.1|3010798_3011545_-	putative replication protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
VDY88568.1|3011551_3012493_-	putative prophage replication protein	NA	U5P0A0	Shigella_phage	51.6	4.3e-80
VDY88570.1|3012515_3012941_-	putative prophage protein	NA	NA	NA	NA	NA
VDY88572.1|3012924_3013248_-	antirepressor	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
VDY88574.1|3013372_3013849_+	Rac prophage; putative DNA-binding transcriptional regulator	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
VDY88576.1|3014086_3014317_+	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	1.7e-06
VDY88578.1|3014415_3014862_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY88580.1|3014921_3015110_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY88582.1|3015565_3015754_+	Cell division inhibition protein dicB from bacteriophage origin	NA	NA	NA	NA	NA
VDY88584.1|3015750_3015939_+	phage protein	NA	NA	NA	NA	NA
VDY88586.1|3016034_3018506_+	exonuclease from phage origin	NA	K7PLW7	Enterobacteria_phage	58.7	3.4e-55
VDY88588.1|3018795_3019926_+|integrase	integrase for prophage CP-933O	integrase	O21940	Phage_21	51.4	3.4e-103
3020063:3020090	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 13
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	3328280	3382316	5468700	integrase,terminase,lysis,capsid,head,protease,tail	Escherichia_phage(39.22%)	64	3330571:3330586	3387490:3387505
VDY88903.1|3328280_3328868_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
VDY88904.1|3328864_3329572_-	Ni/Fe-hydrogenase 1 b-type cytochrome subunit	NA	NA	NA	NA	NA
VDY88905.1|3329590_3331384_-	hydrogenase-1 large subunit	NA	NA	NA	NA	NA
3330571:3330586	attL	TAATGAAGTCTGCCGT	NA	NA	NA	NA
VDY88906.1|3331380_3332499_-	hydrogenase 1, small subunit	NA	NA	NA	NA	NA
VDY88907.1|3333858_3334332_-	Uncharacterised protein	NA	Q9LA52	Enterobacteria_phage	100.0	7.5e-89
VDY88908.1|3334418_3335876_-	Immunoglobulin-binding protein from prophage P-EibD	NA	Q9LA53	Enterobacteria_phage	93.4	2.7e-153
VDY88909.1|3336234_3336813_-|tail	putative phage tail fiber protein	tail	Q7BQC6	Enterobacteria_phage	98.4	1.6e-104
VDY88910.1|3336832_3338323_-|tail	putative tail fiber protein from prophage	tail	Q9LA62	Enterobacterial_phage	99.1	5.1e-59
VDY88911.1|3338507_3342038_-	Host specificity protein J from prophage	NA	A0A0P0ZCI5	Stx2-converting_phage	82.5	0.0e+00
VDY88912.1|3342280_3342862_-|tail	putative tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	94.8	1.3e-90
VDY88913.1|3342858_3343602_-|tail	tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	93.1	4.1e-142
VDY88914.1|3343612_3344311_-|tail	minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	1.9e-128
VDY88915.1|3344310_3344640_-|tail	Minor tail protein M	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
VDY88916.1|3344636_3347210_-|tail	Minor tail protein precursor H	tail	A0A2R9YJM8	Escherichia_phage	82.7	0.0e+00
VDY88917.1|3347190_3347604_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
VDY88918.1|3347630_3348062_-|tail	minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.0	1.3e-39
VDY88919.1|3348083_3348830_-|tail	major tail protein V	tail	Q687F6	Enterobacteria_phage	83.2	4.3e-91
VDY88920.1|3348837_3349233_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	5.2e-59
VDY88921.1|3349229_3349763_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
VDY88922.1|3349777_3350131_-|capsid	Tail attachment protein (Minor capsid protein FII)	capsid	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
VDY88923.1|3350123_3350492_-	putative DNA packaging protein from phage origin	NA	NA	NA	NA	NA
VDY88924.1|3350543_3351572_-|head	phage major head protein	head	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
VDY88925.1|3351629_3351977_-|head	phage head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
VDY88926.1|3352013_3353519_-|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
VDY88927.1|3353508_3355101_-|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
VDY88928.1|3355097_3355304_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	56.9	7.9e-11
VDY88929.1|3355287_3357216_-|terminase	terminase large subunit (Gp2)	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	1.5e-260
VDY88930.1|3357187_3357736_-	phage DNA packaging protein Nu1	NA	K7PJS9	Enterobacteria_phage	63.9	4.5e-61
VDY88931.1|3358291_3358699_-	Endopeptidase (Lysis protein) from bacteriophage origin	NA	Q9EYC9	Enterobacteria_phage	89.6	5.9e-58
VDY88932.1|3358761_3358893_-	Uncharacterised protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
VDY88933.1|3358907_3359054_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY88934.1|3359246_3359780_-	membrane-associated lysozyme; Qin prophage	NA	B6DZ92	Enterobacteria_phage	96.0	1.4e-99
VDY88935.1|3359891_3360152_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY88936.1|3360099_3360735_-	phage protein	NA	Q08JA0	Stx2-converting_phage	85.0	4.1e-50
VDY88937.1|3360738_3360954_-|lysis	putative lysis protein S	lysis	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
VDY88938.1|3361029_3361320_-	Protein of uncharacterised function (DUF826)	NA	A0A1I9LJR2	Stx_converting_phage	67.7	6.3e-06
VDY88939.1|3361679_3363668_-	YjhS	NA	Q6H9W1	Enterobacteria_phage	60.0	2.4e-221
VDY88940.1|3364160_3364325_-	TciB/TerA-like protein	NA	H6WZJ7	Escherichia_phage	100.0	2.6e-17
VDY88941.1|3364321_3364753_-	TciA/TerB-like protein	NA	H6WZJ6	Escherichia_phage	95.8	3.6e-66
VDY88942.1|3365213_3366272_-	DNA methylase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
VDY88943.1|3366422_3366620_-	lipoprotein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
VDY88944.1|3366837_3367398_-	late gene regulator	NA	A0A0U2S606	Escherichia_phage	69.7	4.3e-67
VDY88945.1|3367406_3367766_-	putative crossover junction endodeoxyribonuclease RusA	NA	V5URS4	Shigella_phage	60.9	8.0e-35
VDY88946.1|3367778_3368828_-	putative prophage protein	NA	U5P0K4	Shigella_phage	54.9	5.0e-109
VDY88947.1|3369896_3370814_-	putative prophage protein	NA	A0A1U9AJ59	Stx1_converting_phage	72.9	2.2e-113
VDY88948.1|3370810_3371326_-	Uncharacterised protein	NA	G9L6B3	Escherichia_phage	97.7	2.3e-99
VDY88949.1|3371327_3371876_-	EA22-like protein	NA	A0A1I9LJM5	Stx_converting_phage	95.8	4.2e-59
VDY88950.1|3371862_3372177_-	Uncharacterised protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
VDY88951.1|3372207_3372447_-	Uncharacterised protein	NA	A0A1I9LJV1	Stx_converting_phage	91.2	6.8e-22
VDY88952.1|3372436_3372739_-	phage protein	NA	A0A0U2SAZ1	Escherichia_phage	91.9	9.1e-48
VDY88953.1|3372735_3373128_-	putative phage regulatory protein	NA	A0A088CBK9	Shigella_phage	62.6	2.9e-38
VDY88954.1|3373143_3373869_-	transcription regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	64.0	1.1e-78
VDY88955.1|3373902_3374364_-	replication protein in prophage	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
VDY88956.1|3374356_3375367_-	replication protein	NA	A0A0U2RT81	Escherichia_phage	86.7	5.9e-168
VDY88957.1|3375453_3375891_-	phage regulatory protein CII	NA	A0A0U2RXZ9	Escherichia_phage	54.8	7.3e-30
VDY88958.1|3376278_3376650_+	repressor protein encoded by cryptic prophage CP-933P	NA	NA	NA	NA	NA
VDY88959.1|3376670_3376856_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY88960.1|3376914_3377145_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY88961.1|3377351_3377585_+	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	2.3e-06
VDY88962.1|3378068_3378257_+	Cell division inhibition protein dicB from bacteriophage origin	NA	NA	NA	NA	NA
VDY88963.1|3378253_3378442_+	phage protein	NA	NA	NA	NA	NA
VDY88964.1|3378537_3381009_+	exonuclease from phage origin	NA	K7PLW7	Enterobacteria_phage	60.9	6.5e-59
VDY88965.1|3381076_3381319_+	putative excisionase	NA	NA	NA	NA	NA
VDY88966.1|3381296_3382316_+|integrase	integrase from prophage	integrase	A0A192Y7M7	Salmonella_phage	49.4	3.7e-85
3387490:3387505	attR	ACGGCAGACTTCATTA	NA	NA	NA	NA
>prophage 14
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	3471931	3500992	5468700	integrase,capsid,tRNA,head,protease,tail	uncultured_Mediterranean_phage(16.67%)	28	3497004:3497018	3501653:3501667
VDY89044.1|3471931_3473224_-|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
VDY89045.1|3473314_3474658_-	putative ATPase	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
VDY89046.1|3474668_3475280_-	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VDY89047.1|3475438_3479545_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
VDY89048.1|3479679_3480174_-	leucine-responsive transcriptional regulator	NA	NA	NA	NA	NA
VDY89049.1|3480718_3481684_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
VDY89050.1|3481806_3483573_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
VDY89051.1|3483573_3485295_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	25.2	8.4e-21
VDY89052.1|3485336_3486041_+|tRNA	leucyl/phenylalanyl-tRNA-protein transferase	tRNA	NA	NA	NA	NA
VDY89053.1|3486325_3486544_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VDY89054.1|3487289_3489566_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
VDY89055.1|3489596_3489917_-|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
VDY89056.1|3490614_3490797_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY89057.1|3491237_3491336_-	putative prophage protein	NA	NA	NA	NA	NA
VDY89058.1|3491998_3492412_-|head,tail	putative head-tail preconnector protein from prophage	head,tail	NA	NA	NA	NA
VDY89059.1|3492424_3492760_-|head	prophage head protein	head	NA	NA	NA	NA
VDY89060.1|3492772_3493828_-|capsid	prophage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.1	2.3e-69
VDY89061.1|3493827_3494034_-	putative prophage protein	NA	NA	NA	NA	NA
VDY89062.1|3494274_3494547_-	transcriptional activator	NA	NA	NA	NA	NA
VDY89063.1|3494557_3494968_-	putative prophage single stranded DNA-binding protein	NA	NA	NA	NA	NA
VDY89064.1|3494964_3495312_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY89065.1|3495675_3497811_-	putative prophage protein	NA	A0A1W6JPG0	Morganella_phage	52.5	2.5e-176
3497004:3497018	attL	CAAAATGCCAGCCCG	NA	NA	NA	NA
VDY89066.1|3497807_3498107_-	putative prophage protein	NA	NA	NA	NA	NA
VDY89067.1|3498113_3498434_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY89068.1|3498426_3498630_-	putative prophage protein	NA	NA	NA	NA	NA
VDY89069.1|3498820_3499000_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY89070.1|3499134_3499344_-	prophage CP4-57 regulatory protein, AlpA family	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	1.8e-15
VDY89071.1|3499753_3500992_-|integrase	site-specific recombinase, phage integrase family	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.0	9.0e-126
3501653:3501667	attR	CAAAATGCCAGCCCG	NA	NA	NA	NA
>prophage 15
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	3855276	3903807	5468700	integrase,terminase,lysis,capsid,portal,head,transposase,protease,coat,tail	Enterobacteria_phage(57.89%)	63	3854806:3854852	3903821:3903867
3854806:3854852	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
VDY89387.1|3855276_3856230_+|protease	outer membrane protease	protease	NA	NA	NA	NA
VDY89388.1|3856416_3857901_+|protease	putative protease	protease	NA	NA	NA	NA
VDY89389.1|3858458_3859115_+	methylase	NA	NA	NA	NA	NA
VDY89390.1|3859753_3863155_-|tail	phage tail domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.2e-12
VDY89391.1|3863219_3863819_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
VDY89392.1|3863886_3865149_-	putative host specificity protein	NA	Q9EYE7	Enterobacteria_phage	93.9	7.3e-224
VDY89393.1|3865316_3866858_+|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VDY89394.1|3866872_3867619_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VDY89395.1|3867852_3869952_-	Host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.7	0.0e+00
VDY89396.1|3870012_3870585_-|tail	phage tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
VDY89397.1|3870581_3871325_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
VDY89398.1|3871330_3872029_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
VDY89399.1|3872028_3872358_-|tail	Minor tail protein M	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
VDY89400.1|3872354_3874934_-|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.5	0.0e+00
VDY89401.1|3874926_3875361_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
VDY89402.1|3875342_3875765_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
VDY89403.1|3875780_3876521_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
VDY89404.1|3876528_3876924_-|tail	phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
VDY89405.1|3876920_3877499_-|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
VDY89406.1|3877510_3877864_-|capsid	minor capsid protein	capsid	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
VDY89407.1|3877875_3878274_-	phage DNA packaging protein	NA	A0A0K2FIR1	Enterobacteria_phage	97.0	2.1e-60
VDY89408.1|3878315_3879341_-|head,coat	phage major head protein (major coat protein)	head,coat	C6ZCY2	Enterobacteria_phage	97.1	9.9e-187
VDY89409.1|3879396_3879729_-	Head decoration protein from bacteriophage origin	NA	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
VDY89410.1|3879738_3881058_-|capsid	minor capsid protein C from bacteriophage origin	capsid	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
VDY89411.1|3881038_3882640_-|capsid,portal	phage portal protein (minor capsid protein)	capsid,portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
VDY89412.1|3882636_3882843_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
VDY89413.1|3882839_3883055_-|tail	bacteriophage tail assembly protein	tail	A0A2I6TC92	Escherichia_phage	100.0	6.1e-30
VDY89414.1|3883008_3884766_-|terminase	terminase GpA	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
VDY89415.1|3884740_3885286_-	prophage qsr' DNA packaging protein NU1-like protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	6.8e-94
VDY89416.1|3886232_3886526_+	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
VDY89417.1|3886557_3887019_-	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	98.7	3.5e-75
VDY89418.1|3887015_3887513_-	phage lysozome	NA	A0A1B5FP97	Escherichia_phage	95.8	7.9e-89
VDY89419.1|3887512_3887728_-|lysis	lysis protein S from lambdoid prophage	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
VDY89420.1|3888301_3889384_+	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
VDY89421.1|3889572_3889956_-	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	5.2e-56
VDY89422.1|3890041_3890179_-	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	70.7	1.1e-08
VDY89423.1|3890178_3890541_-	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	94.9	1.6e-59
VDY89424.1|3890537_3890828_-	DLP12 prophage	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
VDY89425.1|3890820_3890991_-	prophage protein NinE	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
VDY89426.1|3890990_3891446_-	DLP12 prophage; DNA base-flipping protein	NA	I6PD71	Cronobacter_phage	66.9	1.1e-60
VDY89427.1|3891633_3892143_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY89428.1|3892192_3892387_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY89429.1|3892438_3893245_-	Uncharacterised protein	NA	M9NZE4	Enterobacteria_phage	28.9	8.5e-16
VDY89430.1|3893241_3893655_-	putative bacteriophage protein	NA	K7PHN2	Enterobacterial_phage	78.2	1.4e-27
VDY89431.1|3893670_3893883_-	Uncharacterised protein	NA	Q286X0	Escherichia_phage	76.6	6.4e-16
VDY89432.1|3893879_3894080_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY89433.1|3894076_3894370_-	Ren protein from phage origin	NA	A0A0N6WES4	Escherichia_phage	94.6	1.9e-42
VDY89434.1|3894366_3895068_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.4	4.6e-127
VDY89435.1|3895064_3896084_-	replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	9.7e-110
VDY89436.1|3896080_3896620_-	bacteriophage regulatory protein CII	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
VDY89437.1|3896689_3896920_-	Cro	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
VDY89438.1|3896958_3897714_+	Regulatory protein CI from bacteriophage origin	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
VDY89439.1|3897780_3898644_+	protein 40A	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
VDY89440.1|3899121_3899328_+	prophage Kil protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
VDY89441.1|3899403_3899700_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
VDY89442.1|3899704_3900490_+	bacteriophage recombination protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
VDY89443.1|3900486_3901167_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.3	5.6e-130
VDY89444.1|3901163_3901346_+	phage protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
VDY89445.1|3901318_3901510_+	phage protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
VDY89446.1|3901586_3901802_+	ybl17	NA	A0A1I9LJM7	Stx_converting_phage	98.6	3.8e-32
VDY89447.1|3901900_3902119_+	ybl16	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
VDY89448.1|3902166_3902445_+	bacteriophage protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
VDY89449.1|3902643_3903807_+|integrase	site-specific recombinase, phage integrase family protein	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
3903821:3903867	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 16
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	4559781	4611783	5468700	integrase,terminase,capsid,head,tail	Enterobacteria_phage(37.74%)	58	4587597:4587612	4618225:4618240
VDY90107.1|4559781_4559943_-	protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
VDY90109.1|4560069_4560675_-	periplasmic protein	NA	NA	NA	NA	NA
VDY90111.1|4561067_4562654_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
VDY90114.1|4562873_4563122_+	putative damage-inducible protein dinI-like	NA	S5MQI1	Escherichia_phage	92.6	1.2e-34
VDY90118.1|4563176_4563350_-	Uncharacterised protein	NA	A0A2L1IV33	Escherichia_phage	67.2	6.4e-14
VDY90122.1|4563354_4563828_-	Uncharacterised protein	NA	Q9LA59	Enterobacterial_phage	93.6	7.0e-79
VDY90129.1|4563917_4565048_-	putative immunoglobulin-binding protein from phage origin	NA	A0A2L1IV32	Escherichia_phage	68.0	4.0e-112
VDY90136.1|4565529_4566105_-|tail	putative phage tail fiber protein	tail	Q7BQC6	Enterobacteria_phage	91.4	1.6e-93
VDY90143.1|4566124_4567678_-|tail	putative tail fiber protein from prophage	tail	Q9LA62	Enterobacterial_phage	99.1	5.4e-59
VDY90149.1|4567862_4571393_-	Host specificity protein J from prophage	NA	A0A0P0ZCI5	Stx2-converting_phage	83.2	0.0e+00
VDY90154.1|4571647_4572229_-|tail	putative tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.4	3.1e-92
VDY90159.1|4572225_4572969_-|tail	tail fiber component K	tail	Q6H9T4	Enterobacteria_phage	93.9	2.2e-143
VDY90165.1|4572979_4573678_-|tail	minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	1.9e-128
VDY90170.1|4573677_4574007_-|tail	Minor tail protein M	tail	Q687F2	Enterobacteria_phage	99.1	1.6e-58
VDY90174.1|4574003_4576583_-|tail	putative phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
VDY90176.1|4576563_4576977_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	84.2	1.9e-43
VDY90178.1|4577003_4577435_-|tail	tail component of prophage CP-933O	tail	A0A0K2FIQ8	Enterobacteria_phage	66.7	1.5e-40
VDY90180.1|4577448_4578201_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	94.0	3.1e-129
VDY90182.1|4578208_4578604_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
VDY90184.1|4578600_4579176_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
VDY90186.1|4579191_4579545_-|capsid	Tail attachment protein (Minor capsid protein FII)	capsid	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
VDY90188.1|4579537_4579921_-	phage protein	NA	NA	NA	NA	NA
VDY90190.1|4579972_4581001_-|head	phage major head protein	head	C6ZCY2	Enterobacteria_phage	61.9	2.9e-114
VDY90192.1|4581058_4581406_-|head	phage head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	2.2e-21
VDY90194.1|4581442_4582948_-|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	54.3	4.6e-100
VDY90196.1|4582937_4583186_-|capsid	capsid protein of prophage	capsid	E4WL21	Enterobacteria_phage	61.8	1.4e-17
VDY90198.1|4583146_4584529_-|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	62.3	2.9e-149
VDY90200.1|4584525_4584732_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
VDY90202.1|4584715_4586644_-|terminase	terminase large subunit (Gp2)	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.9e-260
VDY90204.1|4586615_4587125_-	prophage Qin DNA packaging protein NU1-like protein	NA	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
4587597:4587612	attL	AAGGGATATCAGTTAA	NA	NA	NA	NA
VDY90206.1|4587930_4588452_-	phage protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
VDY90208.1|4588653_4589112_-	endopeptidase	NA	A0A2L1IV55	Escherichia_phage	80.1	3.9e-58
VDY90210.1|4589119_4589251_-	Uncharacterised protein	NA	A0A0N7BYT9	Escherichia_phage	93.0	1.0e-11
VDY90212.1|4589265_4589412_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90214.1|4589604_4590138_-	putative membrane-associated lysozyme; Qin prophage	NA	A0A1U9AJ98	Stx1_converting_phage	89.3	4.0e-91
VDY90216.1|4590142_4590349_-	Lysis protein S from bacteriophage origin	NA	A0A0P0ZC45	Stx2-converting_phage	80.9	3.3e-25
VDY90218.1|4590434_4590725_-	Protein of uncharacterised function (DUF826)	NA	A0A1I9LJR2	Stx_converting_phage	66.7	5.4e-05
VDY90220.1|4591084_4593064_-	YjhS	NA	Q6H9W1	Enterobacteria_phage	60.4	5.3e-221
VDY90222.1|4594118_4594316_-	lipoprotein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
VDY90224.1|4594520_4594913_-	putative antitermination protein Q	NA	S5M7R9	Escherichia_phage	92.1	1.4e-61
VDY90226.1|4594930_4595920_-	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	97.6	2.9e-191
VDY90228.1|4595927_4596743_-	KilA-N domain family protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
VDY90230.1|4596905_4597301_-	putative Crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
VDY90232.1|4597297_4597624_-	putative LexA repressor	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
VDY90234.1|4597620_4598274_-	putative phage AdoMet-dependent methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
VDY90236.1|4598368_4599352_-	putative replication protein from phage (modular protein)	NA	Q8SBF1	Shigella_phage	87.9	6.4e-50
VDY90238.1|4599348_4599648_-	transcriptional regulator	NA	NA	NA	NA	NA
VDY90240.1|4599644_4599869_-	Uncharacterised protein	NA	A5LH70	Enterobacteria_phage	90.5	1.9e-34
VDY90242.1|4601010_4601568_-	phage regulatory protein	NA	Q8SBF4	Shigella_phage	95.7	4.8e-95
VDY90244.1|4601611_4601812_-	DNA-binding transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
VDY90246.1|4601902_4602577_+	phage repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
VDY90248.1|4603263_4603626_+	CPS-53 (KpLE1) prophage protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
VDY90250.1|4603691_4604516_+	CPS-53 (KpLE1) prophage protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
VDY90252.1|4604643_4605180_+	CPS-53 (KpLE1) prophage protein	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
VDY90254.1|4605170_4605533_+	CPS-53 (KpLE1) prophage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
VDY90256.1|4605532_4606153_+	phage protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
VDY90258.1|4606549_4610377_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90260.1|4610559_4611783_-|integrase	site-specific recombinase, phage integrase family protein	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
4618225:4618240	attR	TTAACTGATATCCCTT	NA	NA	NA	NA
>prophage 17
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	4694085	4712826	5468700	transposase	Stx2-converting_phage(50.0%)	18	NA	NA
VDY90419.1|4694085_4694832_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
VDY90421.1|4694846_4696388_-|transposase	transposase for ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
VDY90423.1|4696502_4699100_-	putative antigen 43 precursor (fluffing protein)	NA	NA	NA	NA	NA
VDY90425.1|4699471_4700344_-	putative GTP-binding protein	NA	NA	NA	NA	NA
VDY90427.1|4700428_4701346_-	ybl124	NA	NA	NA	NA	NA
VDY90429.1|4701902_4702031_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90431.1|4702546_4703149_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90433.1|4703244_4703451_-	putative regulatory protein	NA	NA	NA	NA	NA
VDY90435.1|4705103_4705673_+	malate transporter	NA	NA	NA	NA	NA
VDY90437.1|4705932_4706334_+	ybl85	NA	NA	NA	NA	NA
VDY90439.1|4706321_4706756_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VDY90441.1|4706755_4706992_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90443.1|4707110_4707491_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
VDY90445.1|4707487_4707835_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
VDY90447.1|4707884_4709270_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	2.6e-259
VDY90449.1|4709508_4710867_-	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
VDY90451.1|4711598_4711856_-	Biofilm development protein YmgB/AriR	NA	NA	NA	NA	NA
VDY90453.1|4712616_4712826_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
>prophage 18
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	4719426	4775876	5468700	integrase,transposase,tRNA	Shigella_phage(30.43%)	54	4757291:4757315	4765392:4765416
VDY90467.1|4719426_4720383_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VDY90469.1|4720383_4721151_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VDY90471.1|4721707_4721965_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VDY90473.1|4722047_4722290_-|transposase	transposase (partial)	transposase	Q716C2	Shigella_phage	96.2	2.5e-40
VDY90475.1|4722286_4722700_-|transposase	transposase	transposase	Q716C2	Shigella_phage	96.5	5.2e-62
VDY90477.1|4723016_4724168_+|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VDY90479.1|4724252_4725071_+|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.6e-65
VDY90481.1|4725224_4727222_+	secondary glycine betaine transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
VDY90483.1|4727166_4727325_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90485.1|4727284_4728562_+	Predicted membrane protein (DUF2254)	NA	NA	NA	NA	NA
VDY90487.1|4728809_4729466_+	HTH regulator, TetR family	NA	NA	NA	NA	NA
VDY90489.1|4729523_4729628_-	putative alcohol dehydrogenase (partial)	NA	NA	NA	NA	NA
VDY90491.1|4729865_4730147_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90493.1|4730973_4731756_-	transcriptional regulator	NA	NA	NA	NA	NA
VDY90495.1|4732061_4732982_+	Deoxyribokinase	NA	NA	NA	NA	NA
VDY90497.1|4733009_4734326_+	major facilitator superfamily protein	NA	NA	NA	NA	NA
VDY90499.1|4734337_4735351_+	Deoxyribose specific mutarotase	NA	NA	NA	NA	NA
VDY90501.1|4735540_4735906_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VDY90503.1|4735863_4736769_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	99.0	6.3e-177
VDY90505.1|4737154_4737394_+|transposase	Putative transposase	transposase	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
VDY90507.1|4737604_4738861_-	PTS system EIIC component	NA	NA	NA	NA	NA
VDY90509.1|4738873_4739161_-	PTS system transporter subunit IIB	NA	NA	NA	NA	NA
VDY90511.1|4739176_4739620_-	PTS system EIIA component	NA	NA	NA	NA	NA
VDY90513.1|4739890_4740130_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	55.6	4.7e-07
VDY90515.1|4740153_4740921_+	transcriptional regulator	NA	NA	NA	NA	NA
VDY90517.1|4741005_4742214_+|transposase	IS1414, transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
VDY90519.1|4742770_4743691_-	maturase-related protein	NA	NA	NA	NA	NA
VDY90521.1|4744937_4745264_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY90523.1|4745473_4745818_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90525.1|4746172_4747522_-	putative sugar phosphate permease	NA	NA	NA	NA	NA
VDY90527.1|4747542_4748460_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
VDY90529.1|4748471_4749668_-	CoA-transferase	NA	NA	NA	NA	NA
VDY90531.1|4749904_4751818_+	acetoacetate metabolism regulator (two-component system response regulator)	NA	NA	NA	NA	NA
VDY90533.1|4752099_4752936_+	putative restriction endonuclease	NA	NA	NA	NA	NA
VDY90535.1|4752969_4753623_-|transposase	putative transposase subunit	transposase	Q716C2	Shigella_phage	99.5	2.4e-130
VDY90537.1|4753884_4755036_-|transposase	IS30 transposase encoded within prophage CP-933T	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
VDY90539.1|4755179_4755473_-	IS1 protein InsB	NA	U5P0U6	Shigella_phage	92.8	8.3e-46
VDY90541.1|4755927_4757127_-|integrase	site-specific recombinase, phage integrase family	integrase	B7SYF8	Stenotrophomonas_phage	40.4	4.7e-71
4757291:4757315	attL	TGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
VDY90543.1|4757805_4758270_-	transcriptional regulator	NA	NA	NA	NA	NA
VDY90545.1|4758510_4759008_+	putative transmembrane protein	NA	NA	NA	NA	NA
VDY90547.1|4759058_4759586_-	putative IS element protein	NA	NA	NA	NA	NA
VDY90549.1|4759909_4760203_+	IS1 protein InsB	NA	U5P0U6	Shigella_phage	92.8	8.3e-46
VDY90551.1|4760213_4760684_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90553.1|4760697_4761258_-	resolvase	NA	A0A219Y912	Aeromonas_phage	40.6	4.2e-22
VDY90555.1|4761448_4761916_+	Uncharacterized protein conserved in bacteria	NA	A0A0F6WE62	Mycobacterium_phage	43.0	9.5e-28
VDY90557.1|4763006_4763258_+	nipsnap family protein	NA	NA	NA	NA	NA
VDY90559.1|4763390_4765301_-|integrase	phage integrase site specific recombinase	integrase	NA	NA	NA	NA
VDY90561.1|4765671_4766691_+	oxidoreductase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	4.9e-45
4765392:4765416	attR	TGGTGCCGAAGGCCGGACTCGAACC	NA	NA	NA	NA
VDY90563.1|4766818_4768501_+	ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.6	6.8e-84
VDY90565.1|4768483_4769566_-	putative permease	NA	NA	NA	NA	NA
VDY90567.1|4769565_4770645_-	putative permease	NA	NA	NA	NA	NA
VDY90569.1|4770932_4772444_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
VDY90571.1|4772538_4773021_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VDY90573.1|4773020_4775876_+|tRNA	valyl-tRNA synthetase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	3.0e-140
>prophage 19
LR134079	Escherichia coli strain NCTC9112 genome assembly, chromosome: 1	5468700	4828722	4862581	5468700	integrase,transposase	Stx2-converting_phage(28.57%)	34	4833643:4833657	4840423:4840437
VDY90669.1|4828722_4829871_-|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	97.1	3.7e-206
VDY90671.1|4830001_4830553_+|transposase	putative IS609 transposase TnpA	transposase	A0A1S5RHE3	Helicobacter_phage	59.5	5.0e-36
VDY90673.1|4830993_4831788_+	Protein of uncharacterised function (DUF2686)	NA	NA	NA	NA	NA
VDY90675.1|4831858_4832308_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
VDY90677.1|4832349_4832577_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
VDY90680.1|4832581_4832896_-	primosomal replication protein N	NA	NA	NA	NA	NA
VDY90682.1|4832902_4833298_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
VDY90684.1|4833624_4833900_+	protein	NA	NA	NA	NA	NA
4833643:4833657	attL	GCCCTTCTGGCTGTG	NA	NA	NA	NA
VDY90686.1|4834028_4834715_-	L-ribulose-5-phosphate 4-epimerase ulaF	NA	NA	NA	NA	NA
VDY90688.1|4834714_4835458_-	L-xylulose 5-phosphate 3-epimerase	NA	NA	NA	NA	NA
VDY90690.1|4835704_4836886_+|integrase	putative prophage integrase	integrase	Q7M297	Enterobacteria_phage	47.9	2.2e-97
VDY90692.1|4837168_4837798_+	putative response regulator	NA	NA	NA	NA	NA
VDY90694.1|4837797_4839339_+	putative sensor histidine protein kinase (uhpB-like)	NA	NA	NA	NA	NA
VDY90696.1|4839423_4840728_+	putative regulatory protein	NA	NA	NA	NA	NA
4840423:4840437	attR	GCCCTTCTGGCTGTG	NA	NA	NA	NA
VDY90698.1|4840724_4841756_+	putative periplasmic ferric iron-binding protein	NA	NA	NA	NA	NA
VDY90700.1|4841824_4843903_+	permease component of transport system for ferric iron	NA	NA	NA	NA	NA
VDY90702.1|4843914_4844961_+	Fe(3+) ions import ATP-binding protein fbpC	NA	G3M9Y6	Bacillus_virus	38.2	1.4e-34
VDY90704.1|4845657_4845963_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90706.1|4846282_4846477_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90708.1|4846837_4846966_+	IS150 conserved protein InsB	NA	NA	NA	NA	NA
VDY90710.1|4848254_4848473_-	Putative ShiA	NA	NA	NA	NA	NA
VDY90712.1|4849925_4852016_+	bifunctional enterobactin receptor/adhesin protein	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
VDY90714.1|4852877_4853120_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90716.1|4853419_4853788_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90718.1|4853791_4854007_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY90720.1|4855103_4855403_-|transposase	transposase	transposase	NA	NA	NA	NA
VDY90722.1|4856070_4856262_-	Periplasmic oligopeptide-binding protein (fragment)	NA	NA	NA	NA	NA
VDY90724.1|4856598_4858155_+	L-lactate permease	NA	NA	NA	NA	NA
VDY90726.1|4858204_4858924_+	hydroxyacid oxidoreductase (Fe-S centre)	NA	NA	NA	NA	NA
VDY90728.1|4858934_4860350_+	putative oxidoreductase subunit with NAD(P)-binding domain and ferridoxin-like domain	NA	NA	NA	NA	NA
VDY90730.1|4860354_4861053_+	transporter	NA	NA	NA	NA	NA
VDY90732.1|4861466_4861670_-	type I restriction-modification system (hsdR-like)	NA	NA	NA	NA	NA
VDY90734.1|4861856_4862237_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
VDY90736.1|4862233_4862581_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	97.4	2.0e-59
