The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	42265	54442	4961426	integrase	Enterobacteria_phage(77.78%)	12	43354:43376	54603:54625
VDY73102.1|42265_43303_-	putative RhuM-like cytoplasmic protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
43354:43376	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
VDY73103.1|43852_46186_-	putative prophage DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
VDY73104.1|46200_46521_-	P4 phage protein	NA	NA	NA	NA	NA
VDY73105.1|46656_47112_-	putative prophage protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
VDY73106.1|47104_47392_-	prophage derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
VDY73107.1|47971_48238_-	prophage regulatory protein	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
VDY73108.1|48790_49525_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
VDY73109.1|49521_50022_+	transcriptional activator Ogr/delta	NA	NA	NA	NA	NA
VDY73110.1|50095_50668_+	prophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
VDY73111.1|50978_51401_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY73112.1|51397_53269_-	putative helicase YejH	NA	A0A097BY72	Enterococcus_phage	21.7	5.3e-13
VDY73113.1|53278_54442_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	88.9	2.9e-203
54603:54625	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	845224	885056	4961426	integrase,transposase	Shigella_phage(50.0%)	34	851047:851060	889591:889604
VDY73860.1|845224_845677_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	72.1	5.9e-51
VDY73861.1|847331_848780_+	overcoming lysogenization defect protein (old-like)	NA	NA	NA	NA	NA
VDY73862.1|848973_849618_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY73863.1|849753_850767_+	putative phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	37.0	1.2e-54
851047:851060	attL	CAGTAACGATATCC	NA	NA	NA	NA
VDY73864.1|852284_852848_+	ParB-like nuclease	NA	A0A0F7L444	uncultured_marine_virus	47.6	1.5e-40
VDY73865.1|853298_853943_+	putative SpnT protein	NA	NA	NA	NA	NA
VDY73866.1|854439_854631_-	putative ATP-dependent helicase	NA	NA	NA	NA	NA
VDY73867.1|854922_856170_-	transport activator	NA	NA	NA	NA	NA
VDY73868.1|856159_858169_-	regulatory protein	NA	NA	NA	NA	NA
VDY73869.1|858165_859248_-	regulatory protein	NA	NA	NA	NA	NA
VDY73870.1|859781_861146_+	transporter protein	NA	NA	NA	NA	NA
VDY73871.1|861188_861554_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY73872.1|861755_862469_-|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	59.9	5.4e-75
VDY73873.1|862426_862705_-|transposase	IS2 transposase	transposase	Q76S41	Shigella_phage	76.1	2.4e-31
VDY73874.1|862649_862823_-|transposase	putative transposase	transposase	NA	NA	NA	NA
VDY73875.1|863098_863464_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VDY73876.1|863421_864327_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	97.0	4.2e-173
VDY73877.1|864478_865045_+	Protein of uncharacterised function (DUF3296)	NA	NA	NA	NA	NA
VDY73878.1|865302_865878_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY73879.1|867838_868060_-	PapI protein	NA	NA	NA	NA	NA
VDY73880.1|868545_868818_+	major pilu subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
VDY73881.1|869024_869573_+	major pilin protein PapA	NA	NA	NA	NA	NA
VDY73882.1|869722_870223_+	protein PapH	NA	NA	NA	NA	NA
VDY73883.1|870272_872792_+	PapC protein	NA	NA	NA	NA	NA
VDY73884.1|872877_873597_+	chaperone protein PapD	NA	NA	NA	NA	NA
VDY73885.1|873633_874215_+	protein PapJ	NA	NA	NA	NA	NA
VDY73886.1|874224_874761_+	PapK protein	NA	NA	NA	NA	NA
VDY73887.1|874787_875309_+	PapE protein	NA	NA	NA	NA	NA
VDY73888.1|875383_875884_+	minor pilin subunit PapF	NA	NA	NA	NA	NA
VDY73889.1|875927_876938_+	protein PapG	NA	NA	NA	NA	NA
VDY73890.1|877297_878044_+	tia invasion determinant	NA	NA	NA	NA	NA
VDY73891.1|878218_879718_+	putative membrane-associated, metal-dependent hydrolase	NA	NA	NA	NA	NA
VDY73892.1|879826_883342_-	superfamily I DNA helicase	NA	NA	NA	NA	NA
VDY73893.1|883793_885056_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
889591:889604	attR	CAGTAACGATATCC	NA	NA	NA	NA
>prophage 3
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	1148887	1156027	4961426	tRNA	Escherichia_phage(83.33%)	6	NA	NA
VDY74126.1|1148887_1149526_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
VDY74127.1|1149522_1150785_-|tRNA	paral putative tRNA synthase	tRNA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
VDY74128.1|1150781_1151690_-	oxidoreductase YgbJ	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
VDY74129.1|1151885_1152653_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
VDY74130.1|1152703_1153360_-	serine/threonine-specific protein phosphatase 2	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
VDY74131.1|1153465_1156027_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
>prophage 4
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	1233348	1307218	4961426	terminase,protease,tail,integrase,lysis,transposase,tRNA,capsid,head,portal,plate,holin	Shigella_phage(46.3%)	90	1232068:1232127	1273239:1274518
1232068:1232127	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
VDY74209.1|1233348_1234173_-|integrase	phage integrase	integrase	I6PDJ1	Cronobacter_phage	62.3	4.5e-89
VDY74210.1|1234133_1234340_-	phage excisionase	NA	I6PBM8	Cronobacter_phage	68.8	2.0e-22
VDY74211.1|1234381_1235248_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74212.1|1235356_1235881_-	CPS-53 (KpLE1) prophage protein	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
VDY74213.1|1236008_1236833_-	CPS-53 (KpLE1) prophage protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
VDY74214.1|1236898_1237261_-	CPS-53 (KpLE1) prophage protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
VDY74215.1|1237729_1238242_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74216.1|1238444_1239119_-	phage repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
VDY74217.1|1239209_1239410_+	DNA-binding transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
VDY74218.1|1239453_1240005_+	nucleic acid-binding protein; e14 prophage	NA	S5FXP0	Shigella_phage	97.8	1.1e-99
VDY74219.1|1240001_1240340_+	Uncharacterised protein	NA	U5P0J9	Shigella_phage	95.5	3.9e-55
VDY74220.1|1240349_1241291_+	phage O protein family	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
VDY74221.1|1241293_1241782_+	CPS-53 (KpLE1) prophage protein	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
VDY74222.1|1241781_1242435_+	putative phage AdoMet-dependent methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
VDY74223.1|1242431_1242758_+	putative LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
VDY74224.1|1242754_1243144_+	putative Crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
VDY74225.1|1243163_1243961_+	putative KilA-N phage protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
VDY74226.1|1243968_1244958_+	putative prophage protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
VDY74227.1|1244971_1245724_+	lambdoid prophage Qin antitermination protein Q-like protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
VDY74228.1|1245909_1246245_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74229.1|1246297_1246702_+|holin	holin protein	holin	A0A286N2Q5	Klebsiella_phage	85.0	2.1e-39
VDY74230.1|1246688_1247165_+	phage endolysin	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
VDY74231.1|1247161_1247599_+|lysis	phage lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
VDY74232.1|1247696_1247921_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74233.1|1248027_1248468_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74234.1|1248570_1248921_+	putative phage endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
VDY74235.1|1249046_1249541_+|terminase	phage terminase small subunit	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
VDY74236.1|1249537_1251271_+|terminase	phage terminase, large subunit	terminase	U5P0Q5	Shigella_phage	98.6	0.0e+00
VDY74237.1|1251282_1251465_+	prophage protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
VDY74238.1|1251464_1252706_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
VDY74239.1|1252683_1253334_+|head,protease	pro-head protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
VDY74240.1|1253348_1254554_+|capsid	major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
VDY74241.1|1254603_1254804_+	phage protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
VDY74242.1|1254806_1255130_+	phage protein	NA	U5P072	Shigella_phage	99.1	1.1e-56
VDY74243.1|1255126_1255537_+	prophage protein	NA	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
VDY74244.1|1255511_1256018_+	prophage protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
VDY74245.1|1256014_1256575_+	phage protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
VDY74246.1|1256583_1256754_+	phage protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
VDY74247.1|1256737_1258234_+|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
VDY74248.1|1258233_1258590_+	phage protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
VDY74249.1|1258589_1258859_+	phage protein	NA	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
VDY74250.1|1259000_1260836_+|tail	bacteriophage V tail protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
VDY74251.1|1260896_1261820_+	Tail/DNA circulation protein	NA	M1FPN5	Enterobacteria_phage	99.3	3.8e-169
VDY74252.1|1261889_1262225_+	Tail/DNA circulation protein	NA	U5P4I0	Shigella_phage	98.2	3.2e-54
VDY74253.1|1262221_1263301_+|tail	putative phage tail protein	tail	Q8SBG7	Shigella_phage	99.4	1.5e-206
VDY74254.1|1263300_1263849_+|plate	putative phage baseplate protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
VDY74255.1|1263848_1264274_+|tail	bacteriophage V tail protein	tail	U5P0R9	Shigella_phage	98.6	7.4e-80
VDY74256.1|1264260_1265319_+|plate	putative phage baseplate protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
VDY74257.1|1265309_1265894_+|tail	putative phage tail protein	tail	O22003	Shigella_phage	98.5	1.0e-111
VDY74258.1|1265897_1266641_+|tail	phage tail protein	tail	O22004	Shigella_phage	92.6	3.7e-50
VDY74259.1|1266640_1267243_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
VDY74260.1|1267214_1267658_-|tail	Caudovirales tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
VDY74261.1|1267660_1268152_-|tail	tail fiber protein	tail	F1BUP1	Erwinia_phage	35.3	4.8e-06
VDY74262.1|1268181_1268310_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	95.1	1.9e-15
VDY74263.1|1268405_1270295_-	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VDY74264.1|1271346_1272120_+	Uncharacterised protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
VDY74265.1|1272330_1272624_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74266.1|1272711_1273233_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74267.1|1274519_1274813_-	Uncharacterised protein	NA	NA	NA	NA	NA
1273239:1274518	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTTCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTGAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCCGCCATCGCGTTGTCATACGAGTCGCCTGTACTTCCTGTTGATGCCAGTAATCCGGCTTCCTTAAGCCGCTGTGTGTAGGCCAGCGATACATACTGAGAACCTTTATCACTGTGATGGACCGTGCCGGACGGTCGACGGGCCCATAACGCCTGCTCCAGTGCATCCAGCACGAATGTCGTTTCCATGGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATGAACGCCACATAGACGAAGCCCCGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACAGTGCATCTGGCCACTCTGATACCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTATACCTTGTGATTTTCATCGTATACGCGCTGTATCTCTTTCTTCAGCCAGTCATCGCGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAGTGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATAGCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGGTGGTGAGCCCTCCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGAGCAATGGAACAAATTGTCGCCCATTGTGAGTCATATTCGCTCTGACTTTCCAGAACCATACGGACTGCCCGTTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGAAG	NA	NA	NA	NA
VDY74268.1|1274809_1275007_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74269.1|1275969_1276452_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
VDY74270.1|1276610_1277060_+	putative oligoketide cyclase/lipid transport protein	NA	NA	NA	NA	NA
VDY74271.1|1277049_1277340_+	RnfH family protein	NA	NA	NA	NA	NA
VDY74272.1|1277401_1277743_-	putative outer membrane assembly lipoprotein	NA	NA	NA	NA	NA
VDY74273.1|1277891_1279553_-	DNA repair protein	NA	NA	NA	NA	NA
VDY74274.1|1279638_1280517_-	inorganic polyphosphate/ATP-NAD kinase	NA	NA	NA	NA	NA
VDY74275.1|1280639_1281233_+	heat shock protein	NA	NA	NA	NA	NA
VDY74276.1|1281287_1282529_-	inner membrane protein, UPF0053 family	NA	NA	NA	NA	NA
VDY74277.1|1282594_1283461_-	putative magnesium transport protein	NA	NA	NA	NA	NA
VDY74278.1|1283552_1284914_+	signal recognition particle protein	NA	NA	NA	NA	NA
VDY74279.1|1285050_1285299_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
VDY74280.1|1285317_1285866_+	16S rRNA-processing protein RimM	NA	NA	NA	NA	NA
VDY74281.1|1285896_1286664_+|tRNA	tRNA (guanine-1-)-methyltransferase	tRNA	NA	NA	NA	NA
VDY74282.1|1286705_1287053_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
VDY74283.1|1287129_1287612_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
VDY74284.1|1287627_1288854_-	diguanylate cyclase	NA	NA	NA	NA	NA
VDY74285.1|1288843_1289362_-	156G surface protein	NA	NA	NA	NA	NA
VDY74286.1|1289510_1289873_-	putative lipoprotein	NA	NA	NA	NA	NA
VDY74287.1|1290085_1291156_+	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
VDY74288.1|1291166_1292288_+	bifunctional chorismate mutase T and prephenate dehydrogenase	NA	NA	NA	NA	NA
VDY74289.1|1292330_1293491_-	P-protein [includes: chorismate mutase; prephenate dehydratase]	NA	NA	NA	NA	NA
VDY74290.1|1293740_1294082_-	translation inhibitor protein RaiA	NA	NA	NA	NA	NA
VDY74291.1|1294351_1295089_-	outer membrane protein assembly complex subunit YfiO	NA	NA	NA	NA	NA
VDY74292.1|1295223_1296204_+	23S rRNA pseudouridine synthase	NA	NA	NA	NA	NA
VDY74293.1|1296200_1296932_+	putative inner membrane protein	NA	NA	NA	NA	NA
VDY74294.1|1297061_1299635_+	protein disaggregation chaperone	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
VDY74295.1|1305222_1305465_+|transposase	IS putative transposase	transposase	NA	NA	NA	NA
VDY74296.1|1305569_1305743_+	Putative Transposase	NA	NA	NA	NA	NA
VDY74297.1|1305967_1306570_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	56.8	1.7e-61
VDY74298.1|1306813_1307218_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	1537658	1569989	4961426	terminase,lysis,coat,portal,holin	Enterobacteria_phage(77.55%)	53	NA	NA
VDY74493.1|1537658_1537859_-	response regulator inhibitor for tor operon	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
VDY74494.1|1537916_1538084_-	Uncharacterised protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
VDY74495.1|1538156_1538441_-	phage related protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
VDY74496.1|1538433_1538718_-	Uncharacterised protein	NA	A5VWB4	Enterobacteria_phage	98.9	1.5e-47
VDY74497.1|1538717_1539290_-	putative bacteriophage protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
VDY74498.1|1539291_1539591_-	phage-like protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
VDY74499.1|1539587_1540106_-	CPS-53 (KpLE1) prophage protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
VDY74500.1|1540200_1540497_-	Anti-RecBCD protein 2	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
VDY74501.1|1540520_1540904_-	bacteriophage HK97 gp40	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
VDY74502.1|1540903_1541509_-	DNA single-strand annealing protein; essential recombination function protein Erf	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
VDY74503.1|1541610_1541769_-	Uncharacterised protein	NA	A5VWA6	Enterobacteria_phage	100.0	2.4e-23
VDY74504.1|1541765_1541936_-	putative phage regulatory protein CIII	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
VDY74505.1|1542130_1542601_-	prophage protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
VDY74506.1|1542788_1542908_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74507.1|1543429_1543789_-	putative HTH-type transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	3.7e-64
VDY74508.1|1544160_1544346_+	Regulatory protein cro (Antirepressor)	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
VDY74509.1|1544454_1544748_+	Regulatory protein CII	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
VDY74510.1|1544770_1545043_+	Uncharacterised protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
VDY74511.1|1545105_1545993_+	phage replication protein	NA	A5VW95	Enterobacteria_phage	100.0	1.3e-145
VDY74512.1|1545989_1547366_+	phage replicative DNA Helicase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
VDY74513.1|1547438_1547645_+	phage protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
VDY74514.1|1547760_1548075_+	Uncharacterised protein	NA	A0A2I6PIG0	Escherichia_phage	66.7	5.0e-25
VDY74515.1|1548077_1548263_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74516.1|1548274_1548685_+	ninB protein	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
VDY74517.1|1548681_1548858_+	NinE protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
VDY74518.1|1548860_1549280_+	protein ninX	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
VDY74519.1|1549272_1549449_+	NinF family protein	NA	G9L691	Escherichia_phage	100.0	5.7e-26
VDY74520.1|1549441_1550164_+	DNA-binding protein from phage origin	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
VDY74521.1|1550163_1550454_+	82 prophage-derived uncharacterized protein ybcO	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
VDY74522.1|1550450_1550813_+	prophage holliday junction resolvase	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
VDY74523.1|1550809_1550998_+	prophage protein	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
VDY74524.1|1550994_1551513_+	antitermination protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
VDY74525.1|1552109_1552433_+|holin	holin	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
VDY74526.1|1552416_1552893_+	phage endolysin	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
VDY74527.1|1552889_1553327_+|lysis	bacteriophage lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
VDY74528.1|1553672_1554215_+	phage regulatory protein, Rha family	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
VDY74529.1|1554442_1554685_+	Protein of uncharacterised function (DUF2560)	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
VDY74530.1|1554687_1555128_+|terminase	terminase small subunit	terminase	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
VDY74531.1|1555124_1556540_+|terminase	phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
VDY74532.1|1556541_1558740_+|portal	phage portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
VDY74533.1|1558830_1559724_+	phage scaffold protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
VDY74534.1|1559742_1560996_+|coat	putative coat protein	coat	A5VW72	Enterobacteria_phage	99.8	7.5e-237
VDY74535.1|1561037_1561226_+	Uncharacterised protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
VDY74536.1|1561206_1561668_+	DNA stabilization protein	NA	A5VW70	Enterobacteria_phage	100.0	7.1e-84
VDY74537.1|1561677_1563096_+	Packaged DNA stabilization protein from phage	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
VDY74538.1|1563095_1563797_+	Packaged DNA stabilization protein from phage	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
VDY74539.1|1563796_1564252_+	Head assembly protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
VDY74540.1|1564254_1564947_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
VDY74541.1|1564957_1566409_+	phage injection protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
VDY74542.1|1566408_1568421_+	DNA transfer protein from bacteriophage	NA	A0A2I7QW93	Vibrio_phage	36.7	2.9e-97
VDY74543.1|1568438_1568789_-	putative prophage protein	NA	NA	NA	NA	NA
VDY74544.1|1568964_1569531_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74545.1|1569539_1569989_+	toxin YafO	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
>prophage 6
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	1819238	1828683	4961426		Enterobacteria_phage(85.71%)	10	NA	NA
VDY74765.1|1819238_1820165_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
VDY74766.1|1820169_1820901_+	ABC transporter permease	NA	NA	NA	NA	NA
VDY74767.1|1820881_1820989_-	putative inner membrane protein	NA	NA	NA	NA	NA
VDY74768.1|1821048_1821780_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
VDY74769.1|1822001_1823687_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
VDY74770.1|1823683_1824403_+	two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
VDY74771.1|1824449_1824920_+	conserved protein, DUF1456 family	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
VDY74772.1|1824960_1825422_-	lipoprotein yehR	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
VDY74773.1|1825546_1827550_-	zinc finger SWIM domain-containing protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
VDY74774.1|1827546_1828683_-	von Willebrand factor type A domain protein YehP	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
>prophage 7
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	1840774	1902241	4961426	terminase,protease,tail,integrase,lysis,tRNA,capsid,plate,holin	Escherichia_phage(47.73%)	70	1868116:1868143	1900708:1900735
VDY74781.1|1840774_1842808_-|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
VDY74782.1|1842939_1844049_+	ATPase	NA	NA	NA	NA	NA
VDY74783.1|1844311_1844593_+	fimbrial-like adhesin protein	NA	NA	NA	NA	NA
VDY74784.1|1844885_1845428_+	fimbrial protein	NA	NA	NA	NA	NA
VDY74785.1|1845508_1846183_+	putative periplasmic pilin chaperone	NA	NA	NA	NA	NA
VDY74786.1|1846198_1848679_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
VDY74787.1|1848694_1849729_+	putative fimbrial adhesin	NA	NA	NA	NA	NA
VDY74788.1|1849810_1850149_-	periplasmic modulator of Ni and Co efflux	NA	NA	NA	NA	NA
VDY74789.1|1850367_1851192_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
VDY74790.1|1851312_1851585_+	transcriptional repressor RcnR	NA	NA	NA	NA	NA
VDY74791.1|1851525_1851645_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74792.1|1851807_1852596_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
VDY74793.1|1852592_1853393_+	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VDY74794.1|1853457_1854276_+	1,4-beta-N-acetylmuramidase	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
VDY74795.1|1854327_1855074_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDY74796.1|1855047_1856013_-	putative carbohydrate/pyrimidine kinase	NA	NA	NA	NA	NA
VDY74797.1|1856009_1857014_-	putative ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	29.0	2.2e-13
VDY74798.1|1857010_1858288_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VDY74799.1|1858544_1859597_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
VDY74800.1|1859825_1860680_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
VDY74801.1|1860708_1861971_+	putative tagatose 6-phosphate kinase	NA	NA	NA	NA	NA
VDY74802.1|1861980_1862433_+	galactitol-specific PTS system EIIA component	NA	NA	NA	NA	NA
VDY74803.1|1862463_1862748_+	galactitol-specific PTS system EIIB component	NA	NA	NA	NA	NA
VDY74804.1|1862751_1864107_+	galactitol-specific PTS system EIIC component	NA	NA	NA	NA	NA
VDY74805.1|1864154_1865195_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
VDY74806.1|1865294_1866074_+	galactitol utilization operon repressor	NA	NA	NA	NA	NA
VDY74807.1|1866155_1867055_-	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
VDY74808.1|1867470_1867788_+	protein	NA	NA	NA	NA	NA
1868116:1868143	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
VDY74809.1|1868222_1869236_-|integrase	phage integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
VDY74810.1|1869351_1869651_-	bacteriophage P2 C-like protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
VDY74811.1|1869772_1870048_+	bacteriophage P2 Cox-like protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
VDY74812.1|1870058_1870229_+	Uncharacterised protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
VDY74813.1|1870225_1870726_+	Phage protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
VDY74814.1|1870789_1871014_+	Protein of uncharacterised function (DUF2732)	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
VDY74815.1|1871013_1871313_+	Uncharacterised protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
VDY74816.1|1871315_1871540_+	C4-type zinc finger protein, DksA/TraR family	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
VDY74817.1|1871536_1871812_+	relication initiation protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
VDY74818.1|1871801_1874087_+	Replication gene A protein (GpA)	NA	A0A0F7LBQ2	Escherichia_phage	96.2	0.0e+00
VDY74819.1|1874398_1875475_+	Putative protein phosphatase 2C-type	NA	NA	NA	NA	NA
VDY74820.1|1875467_1876532_+	protein kinase from phage origin	NA	G9BWE0	Planktothrix_phage	46.3	4.1e-58
VDY74821.1|1876528_1877596_+	serine/threonine kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	31.5	1.7e-16
VDY74822.1|1877912_1878947_-|capsid	phage capsid protein	capsid	A0A0F7LDI7	Escherichia_phage	96.5	1.2e-195
VDY74823.1|1878946_1880719_-	Terminase, ATPase subunit (GpP)	NA	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
VDY74824.1|1880892_1881747_+|capsid	phage capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.6	3.5e-137
VDY74825.1|1881804_1882878_+|capsid	major capsid protein	capsid	Q94MK7	Enterobacteria_phage	99.4	1.1e-201
VDY74826.1|1882881_1883625_+|terminase	small terminase subunit	terminase	Q858W5	Yersinia_virus	96.0	1.1e-121
VDY74827.1|1883724_1884234_+|capsid	capsid completion protein	capsid	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
VDY74828.1|1884233_1884437_+|tail	phage tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
VDY74829.1|1884440_1884722_+|holin,lysis	phage lysis holin	holin,lysis	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
VDY74830.1|1884721_1885219_+	phage lysin	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
VDY74831.1|1885233_1885659_+	LysA protein	NA	U5N096	Enterobacteria_phage	97.2	4.2e-59
VDY74832.1|1885646_1886072_+	LysB protein	NA	A0A0F7L9Y0	Escherichia_phage	97.2	4.7e-66
VDY74833.1|1886058_1886217_+|lysis	phage lysis protein	lysis	A0A0F7LCN5	Escherichia_phage	98.1	2.6e-22
VDY74834.1|1886179_1886647_+|tail	tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	2.3e-82
VDY74835.1|1886639_1887092_+|tail	tail protein	tail	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
VDY74836.1|1887305_1888049_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74837.1|1888132_1888774_+|plate	Baseplate assembly protein V (GpV)	plate	A0A0F7LBP2	Escherichia_phage	90.2	5.4e-98
VDY74838.1|1888770_1889118_+|plate	phage baseplate protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
VDY74839.1|1889122_1890031_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
VDY74840.1|1890023_1890554_+|tail	tail protein I (GpI)	tail	Q858V5	Yersinia_virus	98.3	5.1e-102
VDY74841.1|1890564_1893345_+|tail	phage tail fiber protein H (GpH)	tail	Q858V4	Yersinia_virus	64.9	0.0e+00
VDY74842.1|1893348_1893876_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	92.6	1.2e-87
VDY74843.1|1894004_1895195_+|tail	major tail sheath protein FI	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
VDY74844.1|1895207_1895726_+|tail	phage major tail tube protein FII	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
VDY74845.1|1895782_1896058_+|tail	tail protein E (GpE)	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
VDY74846.1|1896202_1898650_+|tail	phage related tail protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
VDY74847.1|1898664_1899144_+	gpU phage protein	NA	M1TAU1	Escherichia_phage	99.4	1.1e-84
VDY74848.1|1899143_1900307_+	phage protein D	NA	U5N3V4	Enterobacteria_phage	99.2	3.1e-205
VDY74849.1|1900388_1900607_+	transcriptional activator Ogr/delta	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
VDY74850.1|1900879_1902241_-|protease	putative protease	protease	Q6DW11	Phage_TP	99.5	5.5e-217
1900708:1900735	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
>prophage 8
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	1956623	1964358	4961426		Enterobacteria_phage(33.33%)	8	NA	NA
VDY74892.1|1956623_1958018_+	colanic acid biosynthesis protein	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
VDY74893.1|1958192_1959086_+	UTP--glucose-1-phosphate uridylyltransferase subunit GalF	NA	A0A127AW70	Bacillus_phage	42.4	1.3e-46
VDY74894.1|1959458_1960544_+	dTDP-D-glucose 4,6-dehydratase rmlB	NA	I7HTA3	Enterobacteria_phage	53.6	2.6e-100
VDY74895.1|1960543_1961443_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	8.2e-28
VDY74896.1|1961501_1962377_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.1	8.6e-107
VDY74897.1|1962391_1962805_+	dTDP-6-deoxy-3,4-keto-hexulose isomerase	NA	NA	NA	NA	NA
VDY74898.1|1962791_1963259_+	putative acetyltransferase in HXT11-HXT8 intergenic region	NA	NA	NA	NA	NA
VDY74899.1|1963251_1964358_+	aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.6	5.9e-44
>prophage 9
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	1971294	2031152	4961426	transposase	Shigella_phage(20.0%)	56	NA	NA
VDY74907.1|1971294_1971597_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY74908.1|1972589_1972892_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY74909.1|1973191_1974589_+	phosphoglycerol transferase I	NA	NA	NA	NA	NA
VDY74910.1|1974724_1976131_+	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
VDY74911.1|1976377_1977544_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.9	6.5e-110
VDY74912.1|1977688_1978669_+	O-antigen chain length determinant Wzz	NA	NA	NA	NA	NA
VDY74913.1|1978851_1979463_-	histidine biosynthesis bifunctional protein [includes phosphoribosyl-AMP cyclohydrolase;phosphoribosyl-ATP pyrophosphatase]	NA	NA	NA	NA	NA
VDY74914.1|1979456_1980233_-	imidazole glycerol phosphate synthase subunit	NA	NA	NA	NA	NA
VDY74915.1|1980214_1980952_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
VDY74916.1|1980951_1981542_-	imidazole glycerol phosphate synthase subunit	NA	NA	NA	NA	NA
VDY74917.1|1981541_1982609_-	imidazole glycerol-phosphate dehydratase/histidinol phosphatase	NA	NA	NA	NA	NA
VDY74918.1|1982608_1983679_-	histidinol-phosphate aminotransferase	NA	NA	NA	NA	NA
VDY74919.1|1983675_1984980_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
VDY74920.1|1984985_1985885_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
VDY74921.1|1986363_1986615_+	antitoxin YefM	NA	NA	NA	NA	NA
VDY74922.1|1986611_1986866_+	toxin	NA	NA	NA	NA	NA
VDY74923.1|1986948_1987773_+	protein YeeZ	NA	NA	NA	NA	NA
VDY74924.1|1987797_1988748_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDY74925.1|1989014_1990373_+	putative amino acid permease	NA	NA	NA	NA	NA
VDY74926.1|1990605_1991610_+	inner membrane protein	NA	NA	NA	NA	NA
VDY74927.1|1991623_1991851_+	SirA family protein	NA	NA	NA	NA	NA
VDY74928.1|1991893_1993321_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
VDY74929.1|1993529_1994696_+	penicillin-binding protein 6B	NA	B6DZZ7	Stx2-converting_phage	99.5	2.2e-227
VDY74930.1|1994814_1995288_+	DNA gyrase inhibitory protein	NA	NA	NA	NA	NA
VDY74931.1|1995485_1996544_+	inner membrane protein	NA	NA	NA	NA	NA
VDY74932.1|1996715_1997045_+	putative alpha helix protein	NA	NA	NA	NA	NA
VDY74933.1|1997942_1998137_-	CP4-44 prophage	NA	NA	NA	NA	NA
VDY74934.1|1998133_1998508_-	toxin of the YeeV-YeeU toxin-antitoxin system; CP4-44 prophage	NA	NA	NA	NA	NA
VDY74935.1|1998596_1998965_-	antitoxin of the YeeV-YeeU toxin-antitoxin system; CP4-44 prophage	NA	NA	NA	NA	NA
VDY74936.1|1999038_1999260_-	CP4-44 prophage	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
VDY74937.1|1999322_1999799_-	putative DNA repair protein	NA	NA	NA	NA	NA
VDY74938.1|1999814_2000294_-	anti-restriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
VDY74939.1|2000375_2001194_-	CP4-57 prophage protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.6e-44
VDY74940.1|2001293_2001527_-	putative plasmid-like protein	NA	NA	NA	NA	NA
VDY74941.1|2001605_2002061_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74942.1|2002136_2004653_-	membrane protein, yeeR	NA	NA	NA	NA	NA
VDY74943.1|2004771_2007891_-	CP4-44 prophage; antigen 43 (Ag43)phase-variable biofilm formation autotransporter	NA	NA	NA	NA	NA
VDY74944.1|2008218_2009091_-	putative GTP-binding protein	NA	NA	NA	NA	NA
VDY74945.1|2010321_2011806_+	CP4-57 prophage protein	NA	NA	NA	NA	NA
VDY74946.1|2012127_2012730_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74947.1|2012816_2013023_-	putative phage-related regulatory protein	NA	NA	NA	NA	NA
VDY74948.1|2014352_2014547_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74949.1|2014745_2015315_+	malate transporter	NA	NA	NA	NA	NA
VDY74950.1|2015574_2015976_+	ybl85	NA	NA	NA	NA	NA
VDY74951.1|2015963_2016371_+	DNA-directed RNA polymerase, beta subunit/140 kD subunit	NA	NA	NA	NA	NA
VDY74952.1|2017176_2018034_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY74953.1|2018685_2019720_-	phosphotriesterase	NA	NA	NA	NA	NA
VDY74954.1|2019722_2020688_-	Putative inner membrane protein	NA	NA	NA	NA	NA
VDY74955.1|2020744_2021503_-	cytoplasmic protein	NA	NA	NA	NA	NA
VDY74956.1|2021516_2022464_-	carbohydrate kinase	NA	NA	NA	NA	NA
VDY74957.1|2022488_2022731_-	Putative carbohydrate kinase	NA	NA	NA	NA	NA
VDY74958.1|2023106_2024240_+|transposase	transposase, IS110 family protein	transposase	NA	NA	NA	NA
VDY74959.1|2027276_2027642_+|transposase	transposase	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
VDY74960.1|2027599_2028505_+	IS2 element protein	NA	Q9ZXG3	Shigella_phage	99.3	2.2e-177
VDY74961.1|2028429_2028822_-	CP4-44 prophage; predicted disrupted hemin or colicin receptor	NA	NA	NA	NA	NA
VDY74962.1|2030171_2031152_+|transposase	IS5 transposase and trans-activator	transposase	Q38213	Escherichia_phage	99.7	1.6e-186
>prophage 10
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	2076493	2154118	4961426	terminase,protease,tail,integrase,lysis,transposase,capsid,head,portal	Escherichia_phage(35.85%)	91	2058295:2058311	2087851:2087867
2058295:2058311	attL	ATCAGTCGTGAAGAGGC	NA	NA	NA	NA
VDY74987.1|2076493_2077756_-|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
VDY74988.1|2078093_2078891_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
VDY74989.1|2079126_2080152_-|integrase	site-specific recombinase, phage integrase family	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
VDY74990.1|2080151_2080355_-	putative prophage protein	NA	NA	NA	NA	NA
VDY74991.1|2080413_2082855_-	Exodeoxyribonuclease VIII from bacteriophage origin	NA	V5UQJ3	Shigella_phage	47.3	5.4e-114
VDY74992.1|2082948_2083140_-	putative prophage protein	NA	NA	NA	NA	NA
VDY74993.1|2083136_2083325_-	division inhibition protein	NA	NA	NA	NA	NA
VDY74994.1|2083892_2084111_-	putative prophage protein	NA	NA	NA	NA	NA
VDY74995.1|2084203_2084404_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY74996.1|2084808_2085228_-	putative phage repressor protein CI	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
VDY74997.1|2085328_2085610_+	putative antirepressor protein Cro	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
VDY74998.1|2085593_2086019_+	putative prophage protein	NA	NA	NA	NA	NA
VDY74999.1|2086041_2087004_+	putative prophage replication protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
VDY75000.1|2087010_2087757_+	putative replication protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
VDY75001.1|2087778_2088540_+	putative phage regulatory protein	NA	A0A0U2SAW4	Escherichia_phage	62.9	2.9e-74
2087851:2087867	attR	ATCAGTCGTGAAGAGGC	NA	NA	NA	NA
VDY75002.1|2088536_2088854_+	Uncharacterised protein	NA	A0A222YXX1	Escherichia_phage	75.5	2.9e-36
VDY75003.1|2088856_2089147_+	phage protein	NA	A0A0U2SAZ1	Escherichia_phage	92.5	1.4e-45
VDY75004.1|2089143_2089605_+	phage protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	3.8e-37
VDY75005.1|2089582_2089939_+	putative bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
VDY75006.1|2090032_2090215_+	putative prophage protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
VDY75007.1|2090207_2090384_+	putative prophage protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	4.3e-26
VDY75008.1|2090380_2090896_+	prophage protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
VDY75009.1|2091035_2091293_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY75010.1|2092071_2093202_+	phage protein	NA	U5P0K4	Shigella_phage	48.3	9.5e-90
VDY75011.1|2093202_2093568_+	Holliday junction resolvase	NA	V5URS4	Shigella_phage	67.5	4.2e-39
VDY75012.1|2093564_2094254_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	51.1	4.8e-60
VDY75013.1|2095155_2095371_+	Lysis protein S	NA	M1FN85	Enterobacteria_phage	100.0	2.4e-34
VDY75014.1|2095375_2095726_+	putative prophage protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
VDY75015.1|2095789_2096323_+	membrane-associated lysozyme; Qin prophage	NA	Q08J98	Stx2-converting_phage	91.5	3.8e-97
VDY75016.1|2096319_2096784_+|lysis	phage endopeptidase/lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	86.8	6.3e-64
VDY75017.1|2096826_2097177_+	putative prophage endonuclease	NA	A0A1B5FP94	Escherichia_phage	90.4	1.9e-57
VDY75018.1|2097312_2097828_-	Uncharacterised protein	NA	A0A077K9U2	Edwardsiella_phage	48.8	6.3e-33
VDY75019.1|2098059_2098542_+|terminase	putative prophage terminase, small subunit	terminase	A0A1B5FPA0	Escherichia_phage	96.9	9.6e-84
VDY75020.1|2098541_2100299_+|terminase	phage terminase	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
VDY75021.1|2100446_2101673_+|portal	prophage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
VDY75022.1|2101665_2102265_+|head,protease	putative phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
VDY75023.1|2102279_2103497_+|capsid	prophage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
VDY75024.1|2103573_2103891_+	phage protein	NA	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
VDY75025.1|2103899_2104238_+|head,tail	putative prophage head-tail adaptor	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
VDY75026.1|2104237_2104684_+	prophage protein	NA	S4TR46	Salmonella_phage	81.1	2.3e-63
VDY75027.1|2104680_2105025_+	putative prophage protein	NA	A0A1B5FP84	Escherichia_phage	98.2	6.1e-56
VDY75028.1|2105033_2105789_+|tail	phage major tail subunit	tail	A0A1B5FP82	Escherichia_phage	94.4	2.3e-116
VDY75029.1|2105803_2106175_+|tail	tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
VDY75030.1|2106198_2106477_+	prophage protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
VDY75031.1|2106523_2109763_+|tail	phage-related minor tail protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
VDY75032.1|2109755_2110097_+|tail	prophage minor tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	7.1e-41
VDY75033.1|2110096_2110795_+|tail	phage minor tail protein	tail	A0A1B5FP81	Escherichia_phage	97.8	8.1e-132
VDY75034.1|2111440_2112088_+	Tail assembly protein I from prophage	NA	A5LH42	Enterobacteria_phage	96.7	2.3e-112
VDY75035.1|2112148_2115844_+	Host specificity protein J	NA	A5LH43	Enterobacteria_phage	73.5	0.0e+00
VDY75036.1|2115911_2116511_+	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
VDY75037.1|2116662_2118726_+|tail	prophage side tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	63.2	4.3e-149
VDY75038.1|2118722_2119001_+	putative prophage protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	4.6e-22
VDY75039.1|2119010_2119298_+	putative prophage protein	NA	NA	NA	NA	NA
VDY75040.1|2121692_2122343_-	metal ABC transporter substrate binding protein	NA	NA	NA	NA	NA
VDY75041.1|2122599_2123235_-	sulfite oxidase subunit YedZ	NA	NA	NA	NA	NA
VDY75042.1|2123235_2124240_-	putative oxidoreductase	NA	NA	NA	NA	NA
VDY75043.1|2124348_2124762_-	transthyretin-like protein	NA	NA	NA	NA	NA
VDY75044.1|2124783_2125566_+	transcriptional regulatory protein YedW	NA	W8CYM9	Bacillus_phage	35.6	1.3e-32
VDY75045.1|2125565_2126924_+	two-component sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	3.0e-05
VDY75046.1|2127031_2127883_-	chaperone protein	NA	NA	NA	NA	NA
VDY75047.1|2128474_2129533_-	outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	49.3	6.6e-93
VDY75048.1|2130501_2131197_+	putative phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
VDY75049.1|2131263_2132682_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
VDY75050.1|2132662_2133133_+	patch repair protein	NA	E5E3X5	Burkholderia_phage	47.6	2.6e-33
VDY75051.1|2133121_2134042_-	putative DMT superfamily transporter inner membrane protein	NA	NA	NA	NA	NA
VDY75052.1|2134214_2135132_+	putative methyl-independent mismatch repair protein	NA	NA	NA	NA	NA
VDY75053.1|2135210_2135393_+	putative small protein	NA	NA	NA	NA	NA
VDY75054.1|2135563_2137258_+	cellulose synthesis regulatory protein (signal transduction protein)	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
VDY75055.1|2137254_2138070_-	mannosyl-3-phosphoglycerate phosphatase	NA	NA	NA	NA	NA
VDY75056.1|2138367_2138595_-	Protein of uncharacterised function (DUF2525)	NA	NA	NA	NA	NA
VDY75057.1|2138757_2138946_+	DsrB protein	NA	NA	NA	NA	NA
VDY75058.1|2138989_2139613_-	colanic acid capsullar biosynthesis activation protein A	NA	NA	NA	NA	NA
VDY75059.1|2139902_2140688_-	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
VDY75060.1|2140696_2140966_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
VDY75061.1|2140975_2141713_-	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
VDY75062.1|2141712_2142078_-	flagellar biosynthesis protein FliO	NA	NA	NA	NA	NA
VDY75063.1|2142080_2142494_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
VDY75064.1|2142490_2143495_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
VDY75065.1|2143499_2143964_-	flagellar protein FliL	NA	NA	NA	NA	NA
VDY75066.1|2144068_2145196_-	flagellar hook-length control protein	NA	NA	NA	NA	NA
VDY75067.1|2145192_2145636_-	flagellar protein FliJ	NA	NA	NA	NA	NA
VDY75068.1|2145654_2147028_-	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
VDY75069.1|2147027_2147714_-	flagellar assembly protein H	NA	NA	NA	NA	NA
VDY75070.1|2147706_2148702_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
VDY75071.1|2148694_2150353_-	flagellar M-ring protein	NA	NA	NA	NA	NA
VDY75072.1|2150567_2150882_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
VDY75073.1|2151225_2151558_+	Multidrug transporter emrE	NA	NA	NA	NA	NA
VDY75074.1|2151726_2152278_+	kinase inhibitor	NA	NA	NA	NA	NA
VDY75075.1|2152287_2153085_+	DNA-binding transcriptional regulator; DLP12 prophage	NA	NA	NA	NA	NA
VDY75076.1|2153241_2153790_-|transposase	transposase ORF A, IS609 family	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	1.8e-33
VDY75077.1|2153848_2154118_+|transposase	IS605 family transposase OrfB	transposase	A0A1W6JP07	Morganella_phage	96.1	6.4e-37
>prophage 11
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	2727313	2789941	4961426	protease,terminase,tail,integrase,lysis,capsid,head	Escherichia_phage(34.09%)	68	2732037:2732052	2797307:2797322
VDY75612.1|2727313_2728363_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
VDY75613.1|2728582_2729341_+	putative short chain dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
VDY75614.1|2729337_2729928_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
VDY75615.1|2729967_2730843_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
VDY75616.1|2731055_2732954_-	putative inner membrane protein	NA	NA	NA	NA	NA
2732037:2732052	attL	AAAACCTTTATCGTCG	NA	NA	NA	NA
VDY75617.1|2732978_2733599_-	putative RNA binding protein	NA	NA	NA	NA	NA
VDY75618.1|2733595_2734477_-	putative phosphoesterase	NA	NA	NA	NA	NA
VDY75619.1|2734751_2736314_+	anthranilate synthase component I	NA	NA	NA	NA	NA
VDY75620.1|2736313_2737909_+	anthranilate synthase component II [includes: glutamine amidotransferase; anthranilate phosphoribosyltransferase]	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
VDY75621.1|2737912_2739271_+	tryptophan biosynthesis protein [includes: indole-3-glycero phosphate synthase; N-(5'-phospho ribosyl)anthranilate isomerase]	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
VDY75622.1|2739282_2740476_+	tryptophan synthase	NA	NA	NA	NA	NA
VDY75623.1|2740475_2741282_+	tryptophan synthase alpha chain	NA	NA	NA	NA	NA
VDY75624.1|2741662_2741842_+	protein	NA	NA	NA	NA	NA
VDY75625.1|2741927_2742428_+	YciF protein	NA	NA	NA	NA	NA
VDY75626.1|2742473_2742980_+	protein YciE	NA	NA	NA	NA	NA
VDY75627.1|2743467_2743638_-|tail	tail component	tail	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
VDY75628.1|2744090_2744747_+	methylase	NA	NA	NA	NA	NA
VDY75629.1|2745385_2746996_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	69.5	4.7e-42
VDY75630.1|2747126_2747864_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY75631.1|2748512_2749112_-	membrane protein, Lom/All family	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
VDY75632.1|2749179_2752659_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
VDY75633.1|2752725_2752980_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY75634.1|2753137_2753680_-|tail	tail component of prophage CP-933K	tail	A0A291AWV5	Escherichia_phage	83.5	3.7e-76
VDY75635.1|2753676_2754276_-|tail	putative tail fiber component K of prophage	tail	K7PLW1	Enterobacteria_phage	94.0	1.8e-116
VDY75636.1|2754424_2755123_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
VDY75637.1|2755122_2755452_-|tail	minor tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
VDY75638.1|2755448_2758022_-|tail	Minor tail protein precursor H	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
VDY75639.1|2758002_2758416_-|tail	phage minor tail protein	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
VDY75640.1|2758442_2758874_-|tail	tail component of prophage CP-933O	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
VDY75641.1|2758887_2759640_-|tail	phage major tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
VDY75642.1|2759647_2760043_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	3.3e-58
VDY75643.1|2760039_2760573_-|tail	phage minor tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
VDY75644.1|2760588_2760942_-|capsid	Tail attachment protein (Minor capsid protein FII)	capsid	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
VDY75645.1|2760934_2761318_-	phage protein	NA	NA	NA	NA	NA
VDY75646.1|2761369_2762398_-|head	phage major head protein	head	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
VDY75647.1|2762455_2762803_-|head	phage head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
VDY75648.1|2762839_2764345_-|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
VDY75649.1|2764334_2765927_-|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
VDY75650.1|2765923_2766130_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	56.9	7.9e-11
VDY75651.1|2766113_2768042_-|terminase	DNA packaging protein of prophage; terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	2.2e-259
VDY75652.1|2768013_2768802_-	prophage Qin DNA packaging protein NU1-like protein	NA	A0A0U2S671	Escherichia_phage	84.2	8.7e-58
VDY75653.1|2769240_2769651_+	phage protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
VDY75654.1|2769958_2770423_-	murein endopeptidase; DLP12 prophage	NA	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
VDY75655.1|2770721_2771255_-	membrane-associated lysozyme; Qin prophage	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
VDY75656.1|2771360_2771633_+	ybl58	NA	NA	NA	NA	NA
VDY75657.1|2771598_2771943_-	putative prophage protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
VDY75658.1|2771947_2772163_-|lysis	putative prophage lysis protein	lysis	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
VDY75659.1|2772431_2772659_-	phage protein YjhS encoded within prophage CP-933O	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
VDY75660.1|2773933_2774983_-	DNA methylase	NA	S5MDR0	Escherichia_phage	94.8	1.4e-196
VDY75661.1|2775133_2775331_-	lipoprotein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
VDY75662.1|2775555_2776377_-	phage antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
VDY75663.1|2776373_2776748_-	Holliday juction resolvase	NA	V5URS4	Shigella_phage	62.7	1.1e-34
VDY75664.1|2776760_2777807_-	putative prophage protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
VDY75665.1|2779027_2780029_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY75666.1|2780044_2781067_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY75667.1|2781198_2781621_-	phage protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
VDY75668.1|2781661_2782732_-	replication protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
VDY75669.1|2782803_2783229_-	phage regulatory protein	NA	NA	NA	NA	NA
VDY75670.1|2783212_2783455_-	antirepressor protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
VDY75671.1|2783846_2784185_+	DNA polymerase V subunit UmuD	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
VDY75672.1|2784396_2784633_+	putative prophage protein	NA	M4QQ57	Salicola_phage	51.1	1.4e-06
VDY75673.1|2784634_2784763_+	putative prophage protein	NA	NA	NA	NA	NA
VDY75674.1|2784792_2785014_+	putative prophage protein	NA	NA	NA	NA	NA
VDY75675.1|2785014_2785179_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY75676.1|2785579_2785768_+	cell division inhibition protein	NA	NA	NA	NA	NA
VDY75677.1|2785764_2785956_+	putative prophage protein	NA	NA	NA	NA	NA
VDY75678.1|2786048_2788520_+	putative exonuclease from phage origin	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
VDY75679.1|2788810_2789941_+|integrase	integrase for prophage CP-933O	integrase	O21940	Phage_21	51.4	3.4e-103
2797307:2797322	attR	CGACGATAAAGGTTTT	NA	NA	NA	NA
>prophage 12
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	2896776	2938887	4961426	terminase,tail,integrase,lysis,tRNA,capsid,head	Enterobacteria_phage(59.46%)	45	2888966:2888981	2946237:2946252
2888966:2888981	attL	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
VDY75787.1|2896776_2897055_-	putative prophage protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
VDY75788.1|2897051_2899112_-|tail	side tail fiber protein homolog from lambdoid prophage	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
VDY75789.1|2899170_2902653_-	Host specificity protein J of prophage	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
VDY75790.1|2902713_2903286_-|tail	phage tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	3.0e-84
VDY75791.1|2903282_2903882_-|tail	tail component	tail	C6ZCZ3	Enterobacteria_phage	98.5	1.6e-120
VDY75792.1|2904031_2904730_-|tail	phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
VDY75793.1|2904729_2905059_-|tail	minor tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
VDY75794.1|2905055_2907617_-|tail	tail component of prophage	tail	A0A0K2FI43	Enterobacteria_phage	97.1	0.0e+00
VDY75795.1|2907609_2908044_-|tail	minor tail protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
VDY75796.1|2908025_2908448_-|tail	phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
VDY75797.1|2908463_2909204_-|tail	Major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
VDY75798.1|2909211_2909607_-|tail	phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
VDY75799.1|2909603_2910182_-|tail	Minor tail protein Z (GpZ)	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
VDY75800.1|2910193_2910547_-|head,tail	head-tail joining protein of prophage	head,tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
VDY75801.1|2910539_2910914_-	DNA packaging protein from phage origin	NA	NA	NA	NA	NA
VDY75802.1|2911041_2911995_-|capsid	major capsid	capsid	C6ZCY2	Enterobacteria_phage	55.6	7.5e-64
VDY75803.1|2912052_2912277_-|head	phage head decoration protein	head	NA	NA	NA	NA
VDY75804.1|2912437_2913943_-|head,tail	phage head-tail preconnector protein [contains: scaffold protein]	head,tail	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
VDY75805.1|2913932_2915525_-|capsid	capsid protein of prophage	capsid	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
VDY75806.1|2915521_2915728_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
VDY75807.1|2915711_2917640_-|terminase	DNA packaging protein of prophage; terminase large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
VDY75808.1|2917611_2918160_-	Terminase small subunit (gp1)	NA	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
VDY75809.1|2918635_2918989_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY75810.1|2919111_2919438_-	truncated TonB-like membrane protein encoded within prophage	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
VDY75811.1|2921108_2921663_+	putative superinfection exclusion protein B of prophage	NA	K7P6T7	Enterobacteria_phage	92.4	4.1e-86
VDY75812.1|2921679_2921952_-	putative transcription antitermination protein N of prophage	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
VDY75813.1|2922388_2923138_-	Domain of uncharacterised function DUF1828	NA	NA	NA	NA	NA
VDY75814.1|2923137_2923695_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY75815.1|2923734_2924388_-	Repressor protein CI from phage origin	NA	A0A0N7BTS4	Escherichia_phage	100.0	6.2e-126
VDY75816.1|2924505_2924721_+	repressor protein	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
VDY75817.1|2924862_2925159_+	regulatory protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
VDY75818.1|2925191_2925746_+	replication protein from bacteriophage origin	NA	K7P7F0	Enterobacteria_phage	99.5	1.4e-99
VDY75819.1|2927359_2927722_+	endodeoxyribonuclease RUS	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
VDY75820.1|2927721_2927859_+	DLP12 prophage; small protein	NA	K7PHH3	Enterobacteria_phage	68.3	6.0e-07
VDY75821.1|2927944_2928328_+	lambdoid prophage DLP12 antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
VDY75822.1|2928516_2929599_-	outer membrane porin protein NmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
VDY75823.1|2930187_2930403_+|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
VDY75824.1|2930402_2930900_+	phage lysozome	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
VDY75825.1|2930896_2931358_+	Rz endopeptidase from lambdoid prophage DLP12	NA	A0A0K2FJD0	Enterobacteria_phage	97.4	4.6e-75
VDY75826.1|2931389_2931683_-	lambdoid prophage DLP12 Bor-like protein	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
VDY75827.1|2934380_2935067_+|integrase	prophage lambda integrase	integrase	Q77Z02	Phage_21	100.0	1.7e-129
VDY75828.1|2935180_2936431_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
VDY75829.1|2936602_2937256_+	ribosomal large subunit pseudouridine synthase E (rRNA pseudouridylate synthase E)	NA	NA	NA	NA	NA
VDY75830.1|2937265_2937727_+	putative NUDIX-family hydrolase	NA	NA	NA	NA	NA
VDY75831.1|2937780_2938887_+|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
2946237:2946252	attR	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
>prophage 13
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	3186226	3196526	4961426	protease	Vibrio_phage(33.33%)	6	NA	NA
VDY76058.1|3186226_3189460_-	putative CRISPR-associated helicase	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
VDY76059.1|3189456_3190440_-	CRISPR-associated protein Cas1, YPEST subtype	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
VDY76060.1|3191332_3193609_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
VDY76061.1|3193639_3193960_-|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
VDY76062.1|3194282_3194507_+	stationary phase/starvation inducible regulatory protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
VDY76063.1|3194579_3196526_-	macrolide export ATP-binding/permease protein	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 14
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	4097860	4145877	4961426	protease,terminase,tail,integrase,lysis,head,portal	Enterobacteria_phage(53.06%)	55	4117976:4117990	4146662:4146676
VDY76871.1|4097860_4098022_-	protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
VDY76872.1|4098148_4098754_-	periplasmic protein	NA	NA	NA	NA	NA
VDY76873.1|4099146_4100733_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
VDY76874.1|4100952_4101201_+	DNA damage-inducible protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
VDY76875.1|4101809_4102043_+	Qin prophage DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
VDY76876.1|4102359_4102950_+	putative DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
VDY76877.1|4103481_4104186_-	putative prophage protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
VDY76878.1|4104195_4104477_-	putative prophage protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	3.1e-18
VDY76879.1|4104476_4106855_-|tail	putative prophage side tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	75.9	7.4e-185
VDY76880.1|4106919_4107519_-	outer membrane precursor Lom	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
VDY76881.1|4107586_4110982_-	Host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.7	0.0e+00
VDY76882.1|4111042_4111591_-	Tail assembly protein I from prophage	NA	K7PH50	Enterobacteria_phage	96.2	1.4e-91
VDY76883.1|4111587_4112187_-|tail	tail component	tail	A0A291AWX4	Escherichia_phage	97.0	1.3e-117
VDY76884.1|4112335_4113034_-|tail	phage minor tail protein	tail	A5LH40	Enterobacteria_phage	98.3	5.6e-133
VDY76885.1|4113043_4113373_-|tail	Minor tail protein M	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
VDY76886.1|4113372_4116438_-|tail	putative tail length tape measure protein from putative prophage	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
VDY76887.1|4116409_4116727_-|tail	minor tail protein T of prophage	tail	A5LH37	Enterobacteria_phage	100.0	1.5e-53
VDY76888.1|4116747_4117134_-|tail	minor tail component of prophage	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
VDY76889.1|4117194_4117938_-|tail	Major tail protein V	tail	A0A291AWU6	Escherichia_phage	96.8	1.2e-128
VDY76890.1|4117948_4118350_-|tail	Minor tail protein U	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
4117976:4117990	attL	GATTTCCGCCATCGC	NA	NA	NA	NA
VDY76891.1|4118346_4118925_-|tail	Minor tail protein Z (GPZ) of prophage	tail	A5LH33	Enterobacteria_phage	99.0	3.6e-101
VDY76892.1|4118936_4119212_-	prophage protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
VDY76893.1|4119204_4119528_-	prophage protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
VDY76894.1|4119614_4121642_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
VDY76895.1|4121586_4123095_-|head,tail,portal	portal protein (head-tail preconnector protein) from prophage	head,tail,portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
VDY76896.1|4123094_4123307_-	prophage protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
VDY76897.1|4123303_4125406_-|terminase	DNA packaging protein of prophage (terminase large subunit)	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
VDY76898.1|4125405_4125897_-|terminase	bacteriophage DNA packaging protein; terminase, small subunit	terminase	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
VDY76899.1|4126449_4126656_-	DLP12 prophage; predicted protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
VDY76900.1|4126951_4127125_-	GnsA/GnsB family transcriptional regulator	NA	NA	NA	NA	NA
VDY76901.1|4128375_4128873_-	Qin prophage protein	NA	NA	NA	NA	NA
VDY76902.1|4128869_4129403_-	prophage lysozyme (endolysin)	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
VDY76903.1|4129516_4129777_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY76904.1|4129724_4130102_-	phage protein	NA	Q08JA0	Stx2-converting_phage	50.4	1.3e-19
VDY76905.1|4130139_4130277_-	bacteriophage protein	NA	K7PGU6	Enterobacteria_phage	86.0	3.0e-14
VDY76906.1|4130281_4130488_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	89.7	2.4e-28
VDY76907.1|4131765_4131978_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
VDY76908.1|4132393_4133146_-	lambdoid prophage Qin antitermination protein Q-like protein	NA	K7PGU5	Enterobacteria_phage	96.0	3.3e-131
VDY76909.1|4133159_4134149_-	putative prophage protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
VDY76910.1|4134156_4134954_-	putative KilA-N phage protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	9.8e-150
VDY76911.1|4134973_4135363_-	putative Crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	2.1e-68
VDY76912.1|4135359_4135686_-	putative LexA repressor	NA	U5P451	Shigella_phage	96.3	1.1e-51
VDY76913.1|4135685_4136174_-	CPS-53 (KpLE1) prophage protein	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.4e-85
VDY76914.1|4136176_4136995_-	replication protein from phage	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
VDY76915.1|4136991_4137228_-	Uncharacterised protein	NA	A0A291AX25	Escherichia_phage	97.4	1.3e-38
VDY76916.1|4138053_4138605_-	phage regulatory protein	NA	A0A291AWW8	Escherichia_phage	99.5	2.2e-100
VDY76917.1|4138648_4138849_-	DNA-binding transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
VDY76918.1|4138939_4139614_+	phage repressor	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
VDY76919.1|4140282_4140645_+	CPS-53 (KpLE1) prophage protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
VDY76920.1|4140710_4141535_+	CPS-53 (KpLE1) prophage protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
VDY76921.1|4141662_4142199_+	CPS-53 (KpLE1) prophage protein	NA	K7PKJ9	Enterobacteria_phage	98.9	1.4e-99
VDY76922.1|4142189_4142552_+	CPS-53 (KpLE1) prophage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
VDY76923.1|4142551_4143172_+	phage protein	NA	A5LH60	Enterobacteria_phage	90.3	5.9e-110
VDY76924.1|4143648_4144368_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY76925.1|4144653_4145877_-|integrase	site-specific recombinase, phage integrase family protein	integrase	A5LH57	Enterobacteria_phage	98.0	3.4e-234
4146662:4146676	attR	GATTTCCGCCATCGC	NA	NA	NA	NA
>prophage 15
LR134031	Escherichia coli strain NCTC11151 genome assembly, chromosome: 1	4961426	4245737	4265998	4961426	transposase	Shigella_phage(55.56%)	22	NA	NA
VDY77018.1|4245737_4245947_-|transposase	IS1 transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
VDY77019.1|4246726_4247248_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
VDY77020.1|4247244_4248198_+	iron(III) dicitrate sensor protein	NA	NA	NA	NA	NA
VDY77021.1|4248284_4250609_+	iron(III) dicitrate TonB-dependent receptor	NA	NA	NA	NA	NA
VDY77022.1|4250653_4251556_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
VDY77023.1|4251552_4252551_+	iron(III) dicitrate transport system, permease protein	NA	NA	NA	NA	NA
VDY77024.1|4252547_4253504_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
VDY77025.1|4253504_4254272_+	iron(III) dicitrate transport system, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
VDY77026.1|4254828_4255086_-	KpLE2 phage-like element	NA	NA	NA	NA	NA
VDY77027.1|4255168_4255411_-|transposase	putative transposase	transposase	Q716C2	Shigella_phage	92.4	4.7e-39
VDY77028.1|4255407_4255821_-|transposase	transposase	transposase	Q716C2	Shigella_phage	97.4	1.0e-62
VDY77029.1|4256019_4256322_+	IS600 ORF1-like protein	NA	NA	NA	NA	NA
VDY77030.1|4256357_4257176_+|transposase	IS600 orfAB' transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
VDY77031.1|4257329_4259327_+	secondary glycine betaine transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
VDY77032.1|4259358_4259616_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY77033.1|4259625_4260390_-|transposase	putative transposase subunit	transposase	Q716C2	Shigella_phage	99.0	4.0e-116
VDY77034.1|4260631_4260904_-	IS911 protein	NA	Q716C1	Shigella_phage	97.7	1.0e-37
VDY77035.1|4261124_4261475_+	yjhD	NA	NA	NA	NA	NA
VDY77036.1|4261527_4261653_-	small predicted membrane protein	NA	NA	NA	NA	NA
VDY77037.1|4261695_4262814_-	KpLE2 phage-like element; predicted oxidoreductase	NA	NA	NA	NA	NA
VDY77038.1|4262825_4264043_-	KpLE2 phage-like element transporter	NA	NA	NA	NA	NA
VDY77039.1|4264669_4265998_+|transposase	transposase insG	transposase	NA	NA	NA	NA
