The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR133933	Legionella pneumophila strain NCTC12180 genome assembly, chromosome: 1	3369585	513183	551609	3369585	protease,tRNA,holin,transposase	Prochlorococcus_phage(14.29%)	41	NA	NA
VDY53786.1|513183_514815_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
VDY53788.1|514816_515665_-	lipase A	NA	NA	NA	NA	NA
VDY53790.1|516132_516888_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
VDY53792.1|517065_518076_-	fructose-bisphosphate aldolase, class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	48.6	5.5e-73
VDY53794.1|518225_518918_-	phenol hydroxylase	NA	NA	NA	NA	NA
VDY53796.1|519043_519586_+	protein IcmC (DotV)-like protein	NA	NA	NA	NA	NA
VDY53798.1|519655_519793_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY53800.1|519729_520014_-	PhnO-related protein	NA	NA	NA	NA	NA
VDY53802.1|520243_520981_+	CDP-diacylglycerol-serine-O- phosphatidyltransferase	NA	A0A1V0SBU3	Catovirus	29.4	2.1e-05
VDY53804.1|521221_521491_-	sugar transport PTS system phosphocarrier HPr protein	NA	NA	NA	NA	NA
VDY53806.1|521681_521981_-	putative sigma-54 modulation protein	NA	NA	NA	NA	NA
VDY53808.1|522007_523402_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
VDY53810.1|523611_523776_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
VDY53812.1|523790_524027_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
VDY53814.1|524295_524973_+|tRNA	tRNA (m7G46) methyltransferase, SAM-dependent	tRNA	NA	NA	NA	NA
VDY53816.1|524984_526109_+	endo-1,4 beta-glucanase	NA	NA	NA	NA	NA
VDY53818.1|526186_527674_+	ankyrin repeat-containing protein	NA	NA	NA	NA	NA
VDY53820.1|527881_529024_+|protease	membrane protease subunit HflK	protease	NA	NA	NA	NA
VDY53822.1|529026_529941_+	HflC protein	NA	R4VJU7	Alteromonas_phage	29.6	3.0e-09
VDY53824.1|530075_531371_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.5	1.2e-72
VDY53826.1|531591_532167_+	putative Cupin region protein	NA	NA	NA	NA	NA
VDY53828.1|532343_532778_+|transposase	transposase, ISSod6	transposase	NA	NA	NA	NA
VDY53830.1|532838_533129_+	Excinuclease ABC, C subunit-like protein	NA	NA	NA	NA	NA
VDY53832.1|533403_533862_-	argR arginine repressor	NA	NA	NA	NA	NA
VDY53834.1|533991_534726_+	amino acid (glutamine) ABC transporter, periplasmic amino acid binding protein	NA	NA	NA	NA	NA
VDY53836.1|534722_535370_+	amino acid (glutamine) ABC transporter permease	NA	NA	NA	NA	NA
VDY53838.1|535353_536022_+	polar amino acid transport system ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	7.5e-26
VDY53840.1|536018_537236_+	argininosuccinate synthase	NA	NA	NA	NA	NA
VDY53842.1|537228_538464_+	argininosuccinate lyase	NA	NA	NA	NA	NA
VDY53844.1|538466_539582_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
VDY53846.1|539670_541146_-	adenosine deaminase	NA	NA	NA	NA	NA
VDY53848.1|541320_542439_+	leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein	NA	NA	NA	NA	NA
VDY53850.1|542511_543849_-|protease	carboxy-terminal protease	protease	A0A0R6PIZ1	Moraxella_phage	27.4	7.7e-22
VDY53852.1|543929_545072_-	peptidase, M23/M37 family	NA	NA	NA	NA	NA
VDY53854.1|545058_546603_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
VDY53856.1|546705_547002_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY53858.1|547078_548350_-|holin	phosphatidylcholine hydrolyzing phospholipase	holin	NA	NA	NA	NA
VDY53860.1|548349_548520_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY53862.1|548699_549416_+	undecaprenyl pyrophosphate synthetase	NA	R9W0U9	Flavobacterium_phage	37.3	7.0e-22
VDY53864.1|549426_550224_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
VDY53866.1|550256_551609_+|protease	membrane associated zinc metalloprotease	protease	NA	NA	NA	NA
>prophage 2
LR133933	Legionella pneumophila strain NCTC12180 genome assembly, chromosome: 1	3369585	942064	948903	3369585		Acinetobacter_phage(42.86%)	9	NA	NA
VDY54552.1|942064_942841_-	indole-3-glycerol phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	48.6	1.1e-57
VDY54554.1|942845_943868_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.3	4.6e-75
VDY54556.1|943845_944424_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
VDY54558.1|944457_945183_-	ABC-type transport system protein involved in lipoprotein release, ATPase compnent	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
VDY54560.1|945179_945689_-	lipopolysaccharide export system protein LptA	NA	NA	NA	NA	NA
VDY54562.1|945669_946239_-	Uncharacterized protein YrbK clustered with lipopolysaccharide transporters	NA	NA	NA	NA	NA
VDY54564.1|946235_946763_-	hydrolase	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
VDY54566.1|946776_947739_-	polysialic acid capsule expression protein	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
VDY54568.1|948105_948903_+	putative ABC transport system ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.7e-21
>prophage 3
LR133933	Legionella pneumophila strain NCTC12180 genome assembly, chromosome: 1	3369585	1105928	1152669	3369585	transposase,integrase	Pseudomonas_phage(22.22%)	55	1139908:1139928	1154465:1154485
VDY54859.1|1105928_1106828_-|integrase	integrase	integrase	NA	NA	NA	NA
VDY54861.1|1106820_1107627_-|integrase	putative integrase	integrase	NA	NA	NA	NA
VDY54863.1|1108264_1108909_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54865.1|1108921_1109233_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54870.1|1109284_1109545_-	conjugative coupling factor TraD	NA	NA	NA	NA	NA
VDY54873.1|1109674_1109959_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54875.1|1110294_1111239_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54877.1|1111432_1113412_-	conjugative coupling factor TraD	NA	NA	NA	NA	NA
VDY54879.1|1113408_1113738_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54881.1|1113752_1113926_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54883.1|1114052_1115486_-	membrane protein	NA	NA	NA	NA	NA
VDY54885.1|1115488_1116856_-	membrane protein, Tfp pilus assembly, pilus retraction ATPase PilT	NA	NA	NA	NA	NA
VDY54887.1|1116865_1117840_-	integrating conjugative element protein, PFL_4710 family	NA	NA	NA	NA	NA
VDY54889.1|1117832_1120583_-	Type IV secretory protein VirB4 component	NA	NA	NA	NA	NA
VDY54891.1|1120592_1120940_-	putative lipoprotein	NA	NA	NA	NA	NA
VDY54893.1|1120896_1122156_-	exported membrane protein	NA	NA	NA	NA	NA
VDY54895.1|1122152_1122929_-	integrating conjugative element protein, PFL_4704 family	NA	NA	NA	NA	NA
VDY54897.1|1122915_1123572_-	integrating conjugative element protein, PFL_4703 family	NA	NA	NA	NA	NA
VDY54899.1|1123564_1123927_-	conjugative transfer region protein	NA	NA	NA	NA	NA
VDY54901.1|1123938_1124304_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54903.1|1124300_1124567_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54905.1|1124566_1124893_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54907.1|1124902_1125535_-	Fe2+/Zn2+ uptake regulation protein	NA	NA	NA	NA	NA
VDY54909.1|1125525_1125957_-	integrating conjugative element protein, PFL_4695 family	NA	NA	NA	NA	NA
VDY54911.1|1125956_1126778_-	bile acid beta-glucosidase	NA	NA	NA	NA	NA
VDY54914.1|1126770_1127355_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54916.1|1127351_1127765_-	integrating conjugative element protein PilL, PFGI-1 class	NA	NA	NA	NA	NA
VDY54918.1|1127757_1127976_-	carbon storage regulator	NA	NA	NA	NA	NA
VDY54920.1|1127969_1128329_-	vir region protein	NA	NA	NA	NA	NA
VDY54922.1|1128333_1129236_-	protein LvrA	NA	NA	NA	NA	NA
VDY54925.1|1129435_1129657_+	phage repressor	NA	NA	NA	NA	NA
VDY54927.1|1129732_1130695_+	modification methylase (Eco47II, Sau96I)	NA	Q6DMX0	Streptococcus_phage	47.0	1.8e-65
VDY54929.1|1130698_1131442_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54931.1|1131543_1131999_-	patch repair protein	NA	NA	NA	NA	NA
VDY54933.1|1132096_1133155_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54935.1|1133166_1134462_-	proline/betaine transporter ProP6	NA	NA	NA	NA	NA
VDY54937.1|1134466_1134985_-	polypeptide deformylase	NA	E3SLL2	Synechococcus_phage	36.1	5.1e-14
VDY54945.1|1134965_1135607_-	putative FlgJ-like protein	NA	NA	NA	NA	NA
VDY54949.1|1135569_1136061_-	transcription factor	NA	NA	NA	NA	NA
VDY54954.1|1136267_1136513_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54959.1|1136535_1136754_+	prophage regulatory protein-like protein	NA	NA	NA	NA	NA
VDY54964.1|1137022_1138267_-|integrase	integrase	integrase	I6R9B6	Salmonella_phage	30.2	6.4e-47
VDY54969.1|1138593_1138869_-|transposase	transposase (01), TnpA	transposase	NA	NA	NA	NA
VDY54973.1|1138921_1139842_-|transposase	transposase TnpA or TnpA2	transposase	A0A2D1GQC1	Lysinibacillus_phage	31.8	9.7e-08
1139908:1139928	attL	TTTGTTGGGGTAGAGCCTAAT	NA	NA	NA	NA
VDY54975.1|1139954_1141058_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54977.1|1141175_1142360_-	Protein of uncharacterised function (DUF723)	NA	A0A2I7QLI5	Vibrio_phage	41.3	1.1e-67
VDY54979.1|1142436_1142952_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54981.1|1143148_1144858_-	inner membrane protein	NA	A0A1B0VP75	Pseudomonas_phage	32.6	7.4e-62
VDY54983.1|1144922_1145294_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54985.1|1145566_1145719_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54988.1|1145757_1147113_-	deoxyguanosine triphosphate triphosphohydrolase	NA	NA	NA	NA	NA
VDY54990.1|1147348_1148845_-	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	54.8	3.2e-141
VDY54993.1|1149627_1150311_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY54995.1|1150396_1151428_-	Putative cytoplasmic protein	NA	Q9JMP5	Wolbachia_phage	34.1	5.9e-38
VDY55002.1|1151424_1152669_-|integrase	phage related integrase	integrase	K7P7E1	Enterobacteria_phage	22.9	1.0e-12
1154465:1154485	attR	TTTGTTGGGGTAGAGCCTAAT	NA	NA	NA	NA
>prophage 4
LR133933	Legionella pneumophila strain NCTC12180 genome assembly, chromosome: 1	3369585	1274133	1280070	3369585		Staphylococcus_phage(50.0%)	6	NA	NA
VDY55305.1|1274133_1275207_+	riboflavin biosynthesis protein	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
VDY55307.1|1275191_1275806_+	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
VDY55309.1|1275802_1277011_+	Riboflavin biosynthesis protein	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
VDY55311.1|1277018_1277486_+	riboflavin synthase subunit beta	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
VDY55313.1|1277611_1279249_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
VDY55315.1|1279245_1280070_+	2-dehydro-3-deoxyphosphooctonate aldolase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 5
LR133933	Legionella pneumophila strain NCTC12180 genome assembly, chromosome: 1	3369585	2183883	2194007	3369585	protease	Bacillus_phage(16.67%)	7	NA	NA
VDY56802.1|2183883_2185572_-|protease	AprE, Subtilisin-like serine protease	protease	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
VDY56803.1|2185703_2186711_-	transcriptional regulator OruR, AraC family	NA	NA	NA	NA	NA
VDY56804.1|2186834_2188160_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
VDY56805.1|2188178_2189327_-	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
VDY56806.1|2189535_2190648_-	carbamoyl phosphate synthase, small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
VDY56807.1|2190743_2191883_-	heat shock protein DnaJ, chaperone protein	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
VDY56808.1|2192072_2194007_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 6
LR133933	Legionella pneumophila strain NCTC12180 genome assembly, chromosome: 1	3369585	2285255	2335263	3369585	integrase,transposase	Wolbachia_phage(22.22%)	55	2286986:2287035	2332467:2332516
VDY56899.1|2285255_2285639_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY56900.1|2285692_2286646_-	phage AbiD protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
VDY56901.1|2286663_2286792_+	Uncharacterised protein	NA	NA	NA	NA	NA
2286986:2287035	attL	GGCTTCGAACCAAGGTGTCGGGGGTTCGAGTCCCTCCGAGCGCGCCATTT	NA	NA	NA	NA
VDY56902.1|2287075_2288236_-|integrase	integrase	integrase	A0A059VF45	Pseudomonas_phage	45.8	1.5e-85
VDY56903.1|2288570_2289575_-	protein of uncharacterised function DUF1016	NA	Q9JMP5	Wolbachia_phage	32.9	8.0e-48
VDY56904.1|2289595_2290078_-	putative Acyl-CoA N-acyltransferase	NA	NA	NA	NA	NA
VDY56905.1|2290094_2291369_-	proline betaine transport protein like protein	NA	NA	NA	NA	NA
VDY56906.1|2291346_2291859_-	N-acetyltransferase ats1	NA	NA	NA	NA	NA
VDY56907.1|2291900_2292584_+	lipolytic protein	NA	NA	NA	NA	NA
VDY56908.1|2292610_2293414_+	lipolytic enzyme / transcription regulator protein	NA	NA	NA	NA	NA
VDY56909.1|2293497_2293737_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56910.1|2293862_2294060_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56911.1|2294088_2294484_+	Uncharacterized conserved protein	NA	NA	NA	NA	NA
VDY56912.1|2294498_2296406_-	cadmium efflux ATPase	NA	E4ZFI9	Streptococcus_phage	45.5	1.1e-143
VDY56913.1|2296975_2297146_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56914.1|2297410_2299546_-	cadmium translocating P-type ATPase CadA	NA	E4ZFI9	Streptococcus_phage	42.0	1.0e-145
VDY56915.1|2299622_2302772_-	cobalt/zinc/cadmium efflux RND transporter, permease HelA	NA	NA	NA	NA	NA
VDY56916.1|2302781_2304038_-	cation efflux system HelB	NA	NA	NA	NA	NA
VDY56917.1|2304034_2305279_-	cobalt/zinc/cadmium efflux RND transporter, outer membrane protein	NA	NA	NA	NA	NA
VDY56918.1|2305542_2306205_-	phage repressor	NA	NA	NA	NA	NA
VDY56919.1|2306389_2307262_+	lvrA	NA	NA	NA	NA	NA
VDY56920.1|2307206_2307590_+	virB	NA	NA	NA	NA	NA
VDY56921.1|2307609_2307807_+	vir region protein	NA	NA	NA	NA	NA
VDY56922.1|2307803_2308238_+	integrating conjugative element protein PilL, PFGI-1 class	NA	NA	NA	NA	NA
VDY56923.1|2308234_2308843_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56924.1|2308835_2309672_+	bile acid beta-glucosidase	NA	NA	NA	NA	NA
VDY56925.1|2309673_2310132_+	integrating conjugative element protein, PFL_4695 family	NA	NA	NA	NA	NA
VDY56926.1|2310122_2310821_+	Fe2+/Zn2+ uptake regulation protein	NA	NA	NA	NA	NA
VDY56927.1|2310830_2311154_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56928.1|2311156_2311420_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56929.1|2311422_2311809_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56930.1|2311817_2312168_+	conjugative transfer region protein	NA	NA	NA	NA	NA
VDY56931.1|2312172_2312835_+	integrating conjugative element protein, PFL_4703 family	NA	NA	NA	NA	NA
VDY56932.1|2312821_2313604_+	integrating conjugative element protein, PFL_4704 family	NA	NA	NA	NA	NA
VDY56933.1|2313600_2314914_+	membrane protein	NA	NA	NA	NA	NA
VDY56934.1|2314870_2315260_+	putative lipoprotein	NA	NA	NA	NA	NA
VDY56935.1|2315270_2318045_+	Type IV secretory protein VirB4 components	NA	NA	NA	NA	NA
VDY56936.1|2318019_2319015_+	integrating conjugative element protein, PFL_4710 family	NA	NA	NA	NA	NA
VDY56937.1|2319024_2320407_+	Tfp pilus assembly, pilus retraction ATPase PilT	NA	NA	NA	NA	NA
VDY56938.1|2320408_2321977_+	membrane protein	NA	NA	NA	NA	NA
VDY56939.1|2321979_2322189_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56940.1|2322202_2322535_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56941.1|2322538_2324545_+	conjugative coupling factor TraD	NA	NA	NA	NA	NA
VDY56942.1|2324546_2325032_+	Domain of uncharacterised function (DUF1845)	NA	NA	NA	NA	NA
VDY56943.1|2325116_2325326_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56944.1|2325472_2326441_-	Protein of uncharacterised function (DUF3644)	NA	NA	NA	NA	NA
VDY56945.1|2327099_2327903_+|integrase	putative integrase	integrase	NA	NA	NA	NA
VDY56946.1|2327895_2328795_+|integrase	putative integrase	integrase	NA	NA	NA	NA
VDY56947.1|2329205_2329391_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56948.1|2329453_2329960_+	antirestriction protein	NA	U5P3Z5	Mycobacterium_phage	39.5	4.2e-21
VDY56949.1|2330061_2330679_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY56950.1|2330711_2331203_-	4-diphosphocytidyl-2-methyl-D-erythritol synthase	NA	NA	NA	NA	NA
VDY56951.1|2331213_2332032_-	dam methylase	NA	A0A1S6L1V5	Vibrio_phage	47.1	1.4e-63
VDY56952.1|2332636_2334055_+|transposase	transposase, IS4 family TnpA	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
2332467:2332516	attR	GGCTTCGAACCAAGGTGTCGGGGGTTCGAGTCCCTCCGAGCGCGCCATTT	NA	NA	NA	NA
VDY56953.1|2334087_2335263_-|transposase	transposase TnpA or TnpA2	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
