The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR133932	Klebsiella oxytoca strain NCTC11356 genome assembly, chromosome: 1	5856891	58360	93302	5856891	integrase,transposase	Enterobacteria_phage(33.33%)	36	71075:71105	97693:97723
VDY49573.1|58360_59302_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	50.0	1.7e-68
VDY49574.1|59301_59559_+|transposase	transposase	transposase	NA	NA	NA	NA
VDY49575.1|59562_60465_-	inner membrane transporter yicL	NA	NA	NA	NA	NA
VDY49576.1|60723_62157_-	PTS system protein	NA	NA	NA	NA	NA
VDY49577.1|62181_63084_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
VDY49578.1|63245_64412_-	membrane transport protein	NA	S4TR35	Salmonella_phage	27.0	6.5e-25
VDY49579.1|64462_65827_-	RND efflux system	NA	NA	NA	NA	NA
VDY49580.1|65830_68938_-	RND efflux system, inner membrane transporter CmeB	NA	NA	NA	NA	NA
VDY49581.1|68937_70062_-	RND efflux membrane fusion protein	NA	NA	NA	NA	NA
VDY49582.1|70514_70931_+	acetyltransferase	NA	NA	NA	NA	NA
71075:71105	attL	GTAGCCCGGCTAAGCGCAGCGCGAGCCGGGG	NA	NA	NA	NA
VDY49583.1|71109_71757_-	transcriptional regulator RutR	NA	NA	NA	NA	NA
VDY49584.1|71837_73334_+	drug resistance transporter EmrB/QacA subfamily protein	NA	NA	NA	NA	NA
VDY49585.1|73330_74245_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDY49586.1|74347_74974_+	flavodoxin reductases (ferredoxin-NADPH reductases) family 1	NA	NA	NA	NA	NA
VDY49587.1|74973_75444_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
VDY49588.1|75630_76653_+|transposase	transposase, IS110 family	transposase	NA	NA	NA	NA
VDY49589.1|76971_77892_+	cytoplasmic membrane lipoprotein-28	NA	NA	NA	NA	NA
VDY49590.1|77916_78777_+	drug/metabolite transporter permease	NA	NA	NA	NA	NA
VDY49591.1|78768_79323_-	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
VDY49592.1|79492_80272_+	putative beta-lactamase-like protein	NA	NA	NA	NA	NA
VDY49593.1|80286_81240_+	transcriptional regulator	NA	NA	NA	NA	NA
VDY49594.1|81236_82286_-	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.9	1.7e-69
VDY49595.1|82444_82747_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
VDY49596.1|82748_83756_-	Bifunctional protein	NA	NA	NA	NA	NA
VDY49597.1|83868_84336_-	Protein of uncharacterised function (DUF3237)	NA	NA	NA	NA	NA
VDY49598.1|84523_85129_+	putative Shikimate kinase	NA	NA	NA	NA	NA
VDY49599.1|85286_86324_-	DNA-binding protein	NA	Q9JMN3	Wolbachia_phage	43.7	4.1e-71
VDY49600.1|86448_86565_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY49601.1|86831_87032_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY49602.1|87068_87689_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY49603.1|88458_89100_-|integrase	integrase catalytic subunit	integrase	NA	NA	NA	NA
VDY49604.1|89799_91308_-	putative Retron-type reverse transcriptase	NA	NA	NA	NA	NA
VDY49605.1|91307_91952_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY49606.1|91951_92119_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY49607.1|92122_92500_-|integrase	phage integrase, Phage P4-associated	integrase	Q7M297	Enterobacteria_phage	81.5	6.2e-54
VDY49608.1|92645_93302_-|integrase	phage integrase, Phage P4-associated	integrase	Q7M297	Enterobacteria_phage	96.6	1.3e-110
97693:97723	attR	CCCCGGCTCGCGCTGCGCTTAGCCGGGCTAC	NA	NA	NA	NA
>prophage 2
LR133932	Klebsiella oxytoca strain NCTC11356 genome assembly, chromosome: 1	5856891	1617252	1648096	5856891	protease,transposase	Sodalis_phage(16.67%)	28	NA	NA
VDY50982.1|1617252_1617909_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	47.9	7.1e-37
VDY50983.1|1617934_1618177_-|transposase	transposase	transposase	NA	NA	NA	NA
VDY50984.1|1618242_1618416_-	inner membrane protein	NA	NA	NA	NA	NA
VDY50985.1|1618430_1618958_-	primosomal replication protein N''	NA	NA	NA	NA	NA
VDY50986.1|1619027_1619405_+	membrane protein	NA	NA	NA	NA	NA
VDY50987.1|1619555_1620107_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
VDY50988.1|1622161_1622494_+	DNA-binding protein, YbaB/EbfC family	NA	NA	NA	NA	NA
VDY50989.1|1622493_1623099_+	Recombination protein RecR	NA	NA	NA	NA	NA
VDY50990.1|1623210_1625085_+	chaperone protein HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.0	1.2e-110
VDY50991.1|1625393_1626038_+	adenylate kinase	NA	NA	NA	NA	NA
VDY50992.1|1626165_1627128_+	ferrochelatase	NA	NA	NA	NA	NA
VDY50993.1|1627191_1628496_+	inosine-guanosine kinase	NA	NA	NA	NA	NA
VDY50994.1|1628539_1630216_-	Potassium/proton antiporter RosB	NA	NA	NA	NA	NA
VDY50995.1|1630584_1631805_-	fosmidomycin resistance protein	NA	NA	NA	NA	NA
VDY50996.1|1631968_1633621_+	UDP-sugar hydrolase	NA	NA	NA	NA	NA
VDY50997.1|1633746_1634226_-	YbaK family protein	NA	NA	NA	NA	NA
VDY50998.1|1635488_1637990_-	Lead, cadmium, zinc and mercury transporting ATPase	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
VDY50999.1|1638096_1638507_+	HTH-type transcriptional regulator cueR	NA	NA	NA	NA	NA
VDY51000.1|1638503_1638968_-|protease	activity regulator of membrane protease YbbK	protease	NA	NA	NA	NA
VDY51001.1|1638964_1639882_-|protease	stomatin/prohibitin-family membrane protease subunit YbbK	protease	NA	NA	NA	NA
VDY51002.1|1640018_1640699_+	YbbL ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.4	4.2e-24
VDY51003.1|1640685_1641468_+	YbbM seven transmembrane helix protein	NA	NA	NA	NA	NA
VDY51004.1|1641565_1642420_-	thioredoxin domain-containing protein EC-YbbN	NA	NA	NA	NA	NA
VDY51005.1|1642481_1643252_-	short chain dehydrogenase	NA	NA	NA	NA	NA
VDY51006.1|1643280_1643835_-|protease	multifunctional acyl-CoA thioesterase I and protease I and lysophospholipase L1	protease	NA	NA	NA	NA
VDY51007.1|1643874_1644561_+	metabolite ABC transporter	NA	G9BWD6	Planktothrix_phage	36.5	7.6e-34
VDY51008.1|1644557_1646975_+	metabolite ABC transporter	NA	NA	NA	NA	NA
VDY51009.1|1647073_1648096_+|transposase	transposase, IS110 family	transposase	NA	NA	NA	NA
>prophage 3
LR133932	Klebsiella oxytoca strain NCTC11356 genome assembly, chromosome: 1	5856891	2153306	2266400	5856891	portal,protease,tail,capsid,terminase,head,transposase	Enterobacteria_phage(28.85%)	115	NA	NA
VDY51456.1|2153306_2154329_+|transposase	transposase, IS110 family	transposase	NA	NA	NA	NA
VDY51457.1|2154639_2157072_-	pyruvate formate-lyase	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
VDY51458.1|2157076_2157976_-	pyruvate formate-lyase activating enzyme	NA	NA	NA	NA	NA
VDY51459.1|2158129_2158885_-	Molybdopterin biosynthesis protein MoeB	NA	NA	NA	NA	NA
VDY51460.1|2158884_2160120_-	Molybdopterin biosynthesis protein MoeA	NA	NA	NA	NA	NA
VDY51461.1|2160568_2161510_+	Isoaspartyl aminopeptidase	NA	NA	NA	NA	NA
VDY51462.1|2161522_2163376_+	glutathione transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.9e-13
VDY51463.1|2163413_2164952_+	dipeptide-binding ABC transporter, periplasmic substrate-binding component	NA	NA	NA	NA	NA
VDY51464.1|2165004_2165925_+	dipeptide transport system permease DppB	NA	NA	NA	NA	NA
VDY51465.1|2165890_2166838_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
VDY51466.1|2166964_2168290_-	ribosomal protein S12p methylthiotransferase	NA	NA	NA	NA	NA
VDY51467.1|2168550_2169069_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51468.1|2169103_2170348_-	sucrose permease	NA	NA	NA	NA	NA
VDY51469.1|2170724_2171108_+	Biofilm regulator bssR	NA	NA	NA	NA	NA
VDY51470.1|2171211_2172324_+	Soluble aldose sugar dehydrogenase	NA	NA	NA	NA	NA
VDY51471.1|2172326_2172953_-	glutathione S-transferase-like protein	NA	NA	NA	NA	NA
VDY51472.1|2173042_2174338_-	transporter	NA	A0A0U2JGI6	Escherichia_phage	53.8	4.8e-122
VDY51473.1|2174337_2174553_-	putative excisionase	NA	NA	NA	NA	NA
VDY51474.1|2174640_2174985_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51475.1|2176013_2176238_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51476.1|2177107_2177335_+	DNA-binding transcriptional regulator DicC	NA	K7PHK4	Enterobacteria_phage	44.3	1.4e-08
VDY51477.1|2177318_2177744_+	Protein of uncharacterised function (DUF1019)	NA	NA	NA	NA	NA
VDY51478.1|2177757_2178012_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51479.1|2178008_2179085_+	Replication protein O	NA	U5P0A0	Shigella_phage	48.9	2.3e-21
VDY51480.1|2179097_2179391_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51481.1|2179592_2180378_+	PRTRC system ParB family protein	NA	A4JX52	Burkholderia_virus	51.3	6.9e-63
VDY51482.1|2180374_2181451_+	DGQHR domain	NA	T1SBJ4	Salmonella_phage	73.0	1.4e-146
VDY51483.1|2181443_2181833_+	Uncharacterised protein	NA	A0A220NQV2	Salmonella_phage	65.9	9.1e-08
VDY51484.1|2181825_2182017_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51485.1|2182454_2182748_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51486.1|2183168_2183402_+	DinI family protein	NA	H6WRY5	Salmonella_phage	70.1	5.8e-26
VDY51487.1|2183528_2183711_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51488.1|2183877_2184183_+	Protein of uncharacterised function (DUF968)	NA	Q6V7S4	Burkholderia_virus	55.8	1.2e-23
VDY51489.1|2184179_2184839_+	DNA adenine methylase	NA	Q8HA94	Salmonella_phage	80.8	2.2e-102
VDY51490.1|2184835_2185414_+	Protein of uncharacterised function (DUF1133)	NA	A0A0U2S606	Escherichia_phage	53.3	1.8e-44
VDY51491.1|2185556_2186948_+	Predicted ATPase (AAA+ superfamily)	NA	NA	NA	NA	NA
VDY51492.1|2187039_2187426_+	putative prophage membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.0e-56
VDY51493.1|2187693_2188323_+	lytic enzyme	NA	G8C7W0	Escherichia_phage	90.4	9.0e-106
VDY51494.1|2188330_2188606_+	Uncharacterised protein	NA	G8C7W1	Escherichia_phage	46.1	2.5e-12
VDY51495.1|2188747_2188897_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51496.1|2188841_2189126_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51497.1|2189769_2190009_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51498.1|2190005_2190167_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51499.1|2190373_2190547_+	GnsA/GnsB family	NA	NA	NA	NA	NA
VDY51500.1|2191635_2191821_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51501.1|2191911_2192244_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51502.1|2192243_2192663_+	Uncharacterised protein	NA	Q6UAS0	Klebsiella_phage	53.6	2.3e-33
VDY51503.1|2192956_2193502_+	Phage DNA packaging protein Nu1	NA	A0A0K2FIG2	Enterobacteria_phage	86.7	4.0e-86
VDY51504.1|2193476_2194973_+|terminase	phage terminase large subunit	terminase	E4WL19	Enterobacteria_phage	91.0	8.5e-280
VDY51505.1|2194978_2195398_+|tail	Bacteriophage tail assembly protein	tail	E4WL19	Enterobacteria_phage	82.7	2.0e-61
VDY51506.1|2195397_2195604_+	gpW	NA	K7PM10	Enterobacteria_phage	88.1	6.7e-26
VDY51507.1|2195600_2197193_+|portal	phage portal protein, lambda family	portal	E4WL21	Enterobacteria_phage	87.2	5.7e-274
VDY51508.1|2197173_2198505_+	serine peptidase	NA	O64320	Escherichia_phage	76.1	7.3e-174
VDY51509.1|2198514_2198847_+|head	Bacteriophage lambda head decoration protein D	head	E4WL24	Enterobacteria_phage	79.1	1.1e-43
VDY51510.1|2198913_2199939_+|capsid	Phage major capsid protein E	capsid	K7P6G7	Enterobacteria_phage	92.7	1.2e-179
VDY51511.1|2199990_2200398_+	Uncharacterised protein	NA	A0A2R9YJP4	Escherichia_phage	52.2	2.2e-20
VDY51512.1|2200408_2200762_+	Phage Head-Tail Attachment	NA	K7PHD8	Enterobacteria_phage	65.8	9.6e-41
VDY51513.1|2200770_2201355_+|tail	prophage minor tail Z family protein	tail	M9NZH5	Enterobacteria_phage	78.4	8.7e-79
VDY51514.1|2201351_2201750_+|tail	minor tail protein U	tail	K7P7G5	Enterobacteria_phage	73.5	8.6e-54
VDY51515.1|2201756_2202500_+	Bacterial Ig-like domain (group 2)	NA	K7PKX6	Enterobacterial_phage	86.2	1.5e-115
VDY51516.1|2202510_2202939_+	gp14	NA	M9NZD7	Enterobacteria_phage	59.3	1.7e-36
VDY51517.1|2203257_2206404_+|tail	phage tail tape measure protein, lambda family	tail	E4WL33	Enterobacteria_phage	70.5	0.0e+00
VDY51518.1|2206454_2206802_+|tail	phage minor tail protein	tail	K7PJT2	Enterobacteria_phage	65.2	6.4e-37
VDY51519.1|2206798_2207554_+	gp18	NA	Q6UAW5	Klebsiella_phage	86.1	1.1e-131
VDY51520.1|2207555_2208293_+	gp19	NA	Q6UAW4	Klebsiella_phage	90.6	2.2e-135
VDY51521.1|2208660_2209251_+|tail	bacteriophage lambda tail assembly I	tail	K7PHE5	Enterobacteria_phage	75.0	5.7e-78
VDY51522.1|2209323_2209956_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51523.1|2210118_2219433_+	gp24	NA	Q6UAW1	Klebsiella_phage	47.5	4.2e-34
VDY51524.1|2219461_2220667_+|tail	putative phage tail protein	tail	A0A0D4D9I5	Escherichia_phage	30.5	1.4e-19
VDY51525.1|2221171_2221411_+	Uncharacterised protein	NA	I6PD82	Cronobacter_phage	54.4	2.8e-20
VDY51526.1|2221413_2221713_+	Uncharacterised protein	NA	K7PGV5	Enterobacterial_phage	51.0	1.8e-19
VDY51527.1|2222088_2223300_+	D-alanyl-D-alanine carboxypeptidase fraction C	NA	B6DZZ7	Stx2-converting_phage	48.2	7.3e-96
VDY51528.1|2223330_2224089_-	Deoxyribose operon repressor	NA	A0A077SK06	Escherichia_phage	27.2	1.6e-11
VDY51529.1|2224213_2224807_-	permease	NA	NA	NA	NA	NA
VDY51530.1|2225126_2226362_+	multidrug translocase MdfA	NA	NA	NA	NA	NA
VDY51531.1|2226409_2227225_-	hydrolase	NA	NA	NA	NA	NA
VDY51532.1|2227224_2228346_-	major facilitator superfamily protein	NA	NA	NA	NA	NA
VDY51533.1|2228608_2229151_+	transcriptional regulator	NA	NA	NA	NA	NA
VDY51534.1|2229309_2230995_-	TrkA, Potassium channel-family protein	NA	NA	NA	NA	NA
VDY51535.1|2231262_2231646_+	inner membrane protein	NA	NA	NA	NA	NA
VDY51536.1|2231652_2231916_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
VDY51537.1|2232119_2232410_+	membrane protein	NA	NA	NA	NA	NA
VDY51538.1|2232393_2233116_+	Oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
VDY51539.1|2233232_2234135_+	ribosomal protein S6 glutaminyl transferase	NA	A0A1D7SR78	Cyanophage	34.5	3.5e-34
VDY51540.1|2234224_2234704_+	sensory transduction regulator	NA	NA	NA	NA	NA
VDY51541.1|2235052_2236165_+	putrescine transporter subunit: periplasmic-binding component of ABC superfamily	NA	NA	NA	NA	NA
VDY51542.1|2236222_2237401_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	34.9	6.1e-31
VDY51543.1|2237411_2238365_+	putrescine transport system permease protein PotH	NA	NA	NA	NA	NA
VDY51544.1|2238361_2239207_+	putrescine transporter subunit: membrane component of ABC superfamily	NA	NA	NA	NA	NA
VDY51545.1|2239264_2239753_+	inner membrane protein	NA	NA	NA	NA	NA
VDY51546.1|2239795_2240926_+	23S rRNA (Uracil-5-) -methyltransferase rumB	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.4e-29
VDY51547.1|2241004_2241721_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	3.2e-35
VDY51548.1|2241717_2243190_+	Osmosensitive K+ channel histidine kinase KdpD	NA	W8CYF6	Bacillus_phage	32.8	4.3e-26
VDY51549.1|2243406_2244138_-	Arginine ABC transporter	NA	NA	NA	NA	NA
VDY51550.1|2244309_2244978_-	Arginine ABC transporter	NA	NA	NA	NA	NA
VDY51551.1|2244977_2245694_-	Arginine ABC transporter	NA	NA	NA	NA	NA
VDY51552.1|2245700_2246432_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDY51553.1|2246451_2247180_-	arginine transport system ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
VDY51554.1|2247504_2248020_-	lipoprotein	NA	NA	NA	NA	NA
VDY51555.1|2248137_2248461_+	Domain of uncharacterised function (DUF74)	NA	NA	NA	NA	NA
VDY51556.1|2248457_2249288_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	28.9	2.8e-06
VDY51557.1|2249284_2250298_-	nucleotide di-P-sugar epimerase or dehydratase	NA	NA	NA	NA	NA
VDY51558.1|2250394_2251828_-	NAD-dependent epimerase/dehydratase	NA	NA	NA	NA	NA
VDY51559.1|2251838_2252840_-	Low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
VDY51560.1|2252994_2254713_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
VDY51561.1|2254865_2255300_+	DoxX family protein	NA	NA	NA	NA	NA
VDY51562.1|2255692_2256661_-	NADH oxidoreductase hcr	NA	NA	NA	NA	NA
VDY51563.1|2256671_2258324_-	hydroxylamine reductase	NA	NA	NA	NA	NA
VDY51564.1|2258467_2259367_-	surface protein	NA	NA	NA	NA	NA
VDY51565.1|2259490_2260186_-	aquaporin	NA	NA	NA	NA	NA
VDY51566.1|2260567_2262226_+	OLD family ATP-dependent endonuclease	NA	NA	NA	NA	NA
VDY51567.1|2262400_2263516_+	macrolide-specific efflux protein MacA	NA	NA	NA	NA	NA
VDY51568.1|2263512_2265459_+	macrolide export ATP-binding/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	4.2e-37
VDY51569.1|2265527_2265758_-	Cold shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
VDY51570.1|2266082_2266400_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
>prophage 4
LR133932	Klebsiella oxytoca strain NCTC11356 genome assembly, chromosome: 1	5856891	2582254	2683566	5856891	integrase,portal,protease,tRNA,tail,plate,capsid,terminase,transposase	Enterobacteria_phage(47.37%)	105	2581965:2582024	2691458:2692861
2581965:2582024	attL	CGCGCCTTGCCCGTATATGGACACCTCCCGTTATGCAAGCCATCTCTGCATTTTGTGTAA	NA	NA	NA	NA
VDY51848.1|2582254_2583277_-|transposase	transposase, IS110 family	transposase	NA	NA	NA	NA
VDY51849.1|2583638_2583920_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51850.1|2583970_2585017_-	ABC transporter	NA	NA	NA	NA	NA
VDY51851.1|2585013_2585799_-	spermidine/putrescine ABC transporter membrane protein	NA	NA	NA	NA	NA
VDY51852.1|2585795_2586653_-	Spermidine Putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
VDY51853.1|2586636_2587773_-	putrescine transport ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	42.0	1.7e-30
VDY51854.1|2588030_2589260_+	Tripeptide aminopeptidase	NA	NA	NA	NA	NA
VDY51855.1|2589307_2590429_-	putative enzyme	NA	NA	NA	NA	NA
VDY51856.1|2590515_2591982_-	sensor protein PhoQ	NA	NA	NA	NA	NA
VDY51857.1|2591978_2592653_-	DNA-binding transcriptional regulator PhoP	NA	NA	NA	NA	NA
VDY51858.1|2592737_2593184_-	transcriptional regulator	NA	NA	NA	NA	NA
VDY51859.1|2593285_2594500_+	major facilitator superfamily permease	NA	NA	NA	NA	NA
VDY51860.1|2594549_2595920_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	2.1e-107
VDY51861.1|2595923_2596565_-	putative lysogenization regulator	NA	NA	NA	NA	NA
VDY51862.1|2596624_2597776_-	thiouridylase	NA	NA	NA	NA	NA
VDY51863.1|2597769_2598246_-	Nudix-like NDP and NTP phosphohydrolase YmfB	NA	NA	NA	NA	NA
VDY51864.1|2598266_2598917_-	ribosomal large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
VDY51865.1|2599153_2600404_+	Isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
VDY51866.1|2600500_2600839_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51867.1|2601035_2602805_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	3.3e-20
VDY51868.1|2602900_2604088_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
VDY51869.1|2604366_2605410_+	L-asparaginase, type II	NA	NA	NA	NA	NA
VDY51870.1|2605318_2605804_-	iron(III) dicitrate transport ATP-binding protein FecE	NA	NA	NA	NA	NA
VDY51871.1|2605800_2606172_-	iron(III) dicitrate transport system periplasmic iron-binding protein FecB	NA	NA	NA	NA	NA
VDY51872.1|2606252_2608583_-	iron(III) dicitrate transport protein FecA	NA	NA	NA	NA	NA
VDY51873.1|2608680_2609628_-	iron(III) dicitrate transmembrane sensor protein FecR	NA	NA	NA	NA	NA
VDY51874.1|2609624_2610146_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
VDY51875.1|2610403_2611192_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
VDY51876.1|2611729_2612644_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	1.0e-73
VDY51877.1|2612733_2613372_+	transport protein	NA	NA	NA	NA	NA
VDY51878.1|2613500_2613764_+	inner membrane protein	NA	NA	NA	NA	NA
VDY51879.1|2614152_2614254_-	membrane protein	NA	NA	NA	NA	NA
VDY51880.1|2614311_2615325_-	GAF domain/diguanylate cyclase	NA	NA	NA	NA	NA
VDY51881.1|2615587_2616571_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	80.1	8.4e-151
VDY51882.1|2616686_2616986_-	Uncharacterised protein	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
VDY51883.1|2617106_2617385_+	Regulatory phage protein cox	NA	Q1JS60	Enterobacteria_phage	88.8	5.3e-42
VDY51884.1|2617405_2617624_+	Uncharacterised protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
VDY51885.1|2617639_2618017_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51886.1|2618032_2618305_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51887.1|2618373_2618598_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51888.1|2618594_2619173_+	exodeoxyribonuclease VIII	NA	A0A192Y6E0	Salmonella_phage	40.0	8.4e-34
VDY51889.1|2619261_2620281_+	phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase	NA	B7SYG0	Stenotrophomonas_phage	42.9	1.9e-65
VDY51890.1|2620277_2620451_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51891.1|2620450_2623069_+	gp36	NA	A0A0M4RTM8	Salmonella_phage	50.4	1.3e-190
VDY51892.1|2623065_2623323_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51893.1|2623640_2624564_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51894.1|2624547_2625141_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51895.1|2626425_2626926_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51896.1|2626957_2628004_-|portal	phage portal protein, PBSX family	portal	A0A0A7NPT9	Enterobacteria_phage	70.5	6.6e-146
VDY51897.1|2628006_2629734_-|terminase	terminase, ATPase subunit	terminase	A0A0A7NV54	Enterobacteria_phage	67.9	9.0e-233
VDY51898.1|2629890_2630730_+|capsid	Presumed capsid scaffolding protein (GpO)	capsid	A0A0A7NRY7	Enterobacteria_phage	67.0	3.9e-96
VDY51899.1|2630739_2631774_+|capsid	phage capsid protein	capsid	A0A0M3ULA3	Salmonella_phage	50.3	2.8e-96
VDY51900.1|2631823_2632690_+|terminase	phage terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.4	9.9e-71
VDY51901.1|2632794_2633310_+|capsid	capsid completion protein	capsid	A0A0A7NPU2	Enterobacteria_phage	50.0	1.8e-40
VDY51902.1|2633309_2633510_+|tail	phage tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
VDY51903.1|2633506_2633785_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51904.1|2633781_2634327_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.9	4.1e-30
VDY51905.1|2634528_2634849_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51906.1|2634849_2635317_+|tail	P2 phage tail completion protein R	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
VDY51907.1|2635313_2635949_+|tail	putative prophage, tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	51.0	5.0e-56
VDY51908.1|2635945_2636533_+|plate	baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	1.5e-59
VDY51909.1|2636529_2636880_+|plate	phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	55.7	2.7e-27
VDY51910.1|2636881_2637805_+|plate	baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
VDY51911.1|2637794_2640824_+|tail	putative prophage tail protein	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
VDY51912.1|2640820_2641036_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY51913.1|2641020_2642118_+	Tail fiber protein	NA	A0A0M3ULH6	Salmonella_phage	29.0	1.9e-10
VDY51914.1|2642370_2644116_-	AIPR protein	NA	NA	NA	NA	NA
VDY51915.1|2644226_2644694_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.1	2.7e-51
VDY51916.1|2644709_2647685_-	phage protein	NA	A0A0A7NRZ9	Enterobacteria_phage	46.9	2.8e-221
VDY51917.1|2647829_2648147_-|tail	phage tail protein E	tail	A0A0A7NPZ0	Enterobacteria_phage	46.8	2.2e-12
VDY51918.1|2648192_2648708_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.8	2.2e-57
VDY51919.1|2648707_2649880_-|tail	phage tail sheath protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
VDY51920.1|2650034_2651174_+	late control gene D protein	NA	B9A7A9	Serratia_phage	70.5	1.8e-144
VDY51921.1|2651732_2651972_+	putative lipoprotein	NA	NA	NA	NA	NA
VDY51922.1|2651975_2652323_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
VDY51923.1|2652309_2652819_-	purine nucleoside phosphorylase	NA	NA	NA	NA	NA
VDY51924.1|2653091_2653673_+	CTP synthase	NA	NA	NA	NA	NA
VDY51925.1|2653710_2654895_-	cyanate transporter	NA	NA	NA	NA	NA
VDY51926.1|2654995_2655787_+	transcriptional regulator	NA	NA	NA	NA	NA
VDY51927.1|2655770_2656217_-	inner membrane protein	NA	NA	NA	NA	NA
VDY51928.1|2656396_2656897_-|tRNA	YbaK/prolyl-tRNA synthetase-associated domain protein	tRNA	NA	NA	NA	NA
VDY51929.1|2656930_2658427_-	two-component response regulator and GGDEF family protein YeaJ	NA	A0A127AWB9	Bacillus_phage	31.8	1.7e-09
VDY51930.1|2658881_2660039_+	LOS biosynthesis enzyme LBGB	NA	NA	NA	NA	NA
VDY51931.1|2660083_2661367_-	YeaH	NA	A0A140HLI1	Bacillus_phage	37.1	3.4e-11
VDY51932.1|2661497_2663054_-	Serine protein kinase (prkA protein)	NA	NA	NA	NA	NA
VDY51933.1|2663053_2663431_-	Serine protein kinase (prkA protein)	NA	NA	NA	NA	NA
VDY51934.1|2663858_2664605_+	MltA-interacting protein MipA	NA	NA	NA	NA	NA
VDY51935.1|2664698_2665553_+	oxidoreductase YeaE	NA	NA	NA	NA	NA
VDY51936.1|2665716_2666601_-	aldose 1-epimerase family protein YeaD	NA	NA	NA	NA	NA
VDY51937.1|2666869_2667865_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VDY51938.1|2668204_2668618_+	peptide methionine sulfoxide reductase MsrB	NA	NA	NA	NA	NA
VDY51939.1|2668661_2668937_+	Protein of uncharacterised function (DUF1315)	NA	NA	NA	NA	NA
VDY51940.1|2668986_2669331_-	cytoplasmic protein	NA	NA	NA	NA	NA
VDY51941.1|2669431_2670685_-	chitinase	NA	A0A2K9L3D4	Tupanvirus	27.9	4.1e-25
VDY51942.1|2671008_2672085_+	oxidoreductase YdjL	NA	NA	NA	NA	NA
VDY51943.1|2672111_2673491_+	transport protein YdjK	NA	NA	NA	NA	NA
VDY51944.1|2673508_2674552_+	zinc-type alcohol dehydrogenase-like protein YdjJ	NA	NA	NA	NA	NA
VDY51945.1|2674576_2675413_+	aldolase YdjI	NA	NA	NA	NA	NA
VDY51946.1|2675417_2676365_+	sugar kinase YdjH	NA	NA	NA	NA	NA
VDY51947.1|2676380_2677358_+	oxidoreductase YdjG	NA	A0A2H4PQR8	Staphylococcus_phage	23.9	1.9e-06
VDY51948.1|2677493_2678252_+	HTH-type transcriptional regulator YdjF	NA	NA	NA	NA	NA
VDY51949.1|2678393_2679752_+	metabolite transport protein	NA	NA	NA	NA	NA
VDY51950.1|2679789_2680431_-	nicotinamidase	NA	A0A2K9L6K4	Tupanvirus	38.5	4.5e-20
VDY51951.1|2680441_2681458_-	L-asparaginase	NA	NA	NA	NA	NA
VDY51952.1|2681712_2683566_-|protease	protease	protease	NA	NA	NA	NA
2691458:2692861	attR	CGCGCCTTGCCCGTATATGGACACCTCCCGTTATGCAAGCCATCTCTGCATTTTGTGTAACGGGGTAAGTTGCGTTCGTATATCCGGCCTCTCTTACGATACCGTCGTATCCGGGCCATGATGTTATCTGCGCATCTGTTTCCATTCGGGCTAGCGGCTTTGCTTATCAGGGAGCCTTCGGCCAGGCCGGAGTGACTGATGCTGGTCTTACCTGTTACTCATCTCGCTTCTCTGGCTGCAACCTTACGGCAGGTTATTGCTCTTTTAACGCATGGGATACTGGCCGCCGGTTAACCGGTGACCTGTATCCCATGGTAATCCTCTTCACGACTCAGCAGCGCCCATGCTATACGGGCATTCTTGTTCGCCAGCGCCACCGTCGCGATGTTCCGGTTTCGTCTCTCCGACACCCCCTGCAACCACTGGCTGCGCCTGTCAGTTTTATTCTGACACGCATTCAGCACTGCCCGCGCTCCATGGATTATCAGCGTCCGCACGTAGCGGTCCCCCCGCTTGCTGATATGGCCCAGTCGCGCCTTTCCTCCGCTTGAGTGCTGCCGCGGAACCAGCCCCAGATAAGCCGCCATTTCCCGGCCGCTCCTGAACTGTCTGCCATCACCCACTGCAGCCACCAGGGCACTGGCCACCACCGGACCCATCCCCTCTATCGCCAGCAGCCTTTTTATCCGGATATCATCCCGTGCTGACTGCTGAAGCCGCCTGTCGTGGCGGGCGACACGCTCATCCAGTCCCTGCAGCTCTTCTGACAGTTCGCACAGCAGACGAATAAAACACTCATCCCACTGCACCTGCTGCGACACTATCTCCGGTAGCGCCTTACGCAGTTGCGCTATTCCCGCTGGCAACACCACACCGAACTCCCCCAGCAGACCCCGTATCTCATTGCTCAGGGCTGTCCGGGCACGGATGAGTCTGGCCCGGACGCGGTGCTCCGCCTGCAGCGTCTGCTGCCTTTCCGTTCTGATCGCCACGAAGCGCATCCCGGGGCGGCTGACAGCCTCGCAGATAGCTTCGGCATCGTTGGCATCATTCTTCTGGCCTTTAAGATAAGGCTTAACCAGCCGGGGCGGGATAATGCGTACGGTATGCCCCATACGGGTCAGCTCCCGGGCCCAGTAGTGGGCAGAGCCACAGGCTTCAATACCGATAAGGCACGGTGAGAGTTGGGTGAAAAAGGCCGCCATGCGGTCACGGCGCAGGGTTTTACGAAGGACAACATGCTCACGGTGATCCACGGCATGTATCTGGAAGACATTTTTTGCCAGGTCGAGACCAATACGTTTAATATTCATGATGGACACCTCCTCCAGTTAACTGTAGGTACACCTCAGTCTGGCACTTTGATGCCGTAAGGGGGAGGTGTCCATCACATCGGGCTACGGG	NA	NA	NA	NA
>prophage 5
LR133932	Klebsiella oxytoca strain NCTC11356 genome assembly, chromosome: 1	5856891	2853148	2897961	5856891	integrase,portal,protease,tRNA,tail,capsid,terminase,head,transposase	Klebsiella_phage(51.02%)	58	2849461:2849475	2865456:2865470
2849461:2849475	attL	CTATATGGCGGCTTT	NA	NA	NA	NA
VDY52112.1|2853148_2854441_-|integrase,transposase	putative transposase/integrase	integrase,transposase	Q8W658	Enterobacteria_phage	65.2	4.0e-169
VDY52113.1|2854492_2854732_-	Putative excisionase (DUF1233)	NA	Q8W657	Enterobacteria_phage	82.1	6.5e-33
VDY52114.1|2854739_2854886_-	Uncharacterised protein	NA	H6WZF8	Escherichia_phage	75.0	9.2e-14
VDY52115.1|2854957_2855260_-	Uncharacterised protein	NA	A0A1B5FPC7	Escherichia_phage	71.4	6.6e-14
VDY52116.1|2855256_2855481_-	Uncharacterised protein	NA	A0A286S2B3	Klebsiella_phage	79.7	3.6e-25
VDY52117.1|2855477_2855603_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY52118.1|2855586_2856024_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY52119.1|2856013_2856718_-	DNA-binding protein Roi	NA	A0A286S260	Klebsiella_phage	87.3	6.3e-108
VDY52120.1|2856726_2857308_-	2-polyprenylphenol hydroxylase related flavodoxin oxidoreductase	NA	A0A286S1S7	Klebsiella_phage	80.3	2.3e-87
VDY52121.1|2857288_2857720_-	Uncharacterised protein	NA	A0A286S1S2	Klebsiella_phage	93.6	1.7e-71
VDY52122.1|2857804_2858161_-	Uncharacterised protein	NA	A0A286SGR4	Klebsiella_phage	89.3	2.5e-36
VDY52123.1|2858153_2858519_-	Uncharacterised protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
VDY52124.1|2858688_2858877_-	Uncharacterised protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
VDY52125.1|2858869_2859184_-	Uncharacterised protein	NA	A0A286S1T9	Klebsiella_phage	99.0	1.3e-49
VDY52126.1|2859354_2860023_-	XRE family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.1	1.6e-124
VDY52127.1|2860120_2860342_+	helix-turn-helix domain-containing protein	NA	A0A286S2C1	Klebsiella_phage	98.6	8.7e-32
VDY52128.1|2860316_2860610_+	Uncharacterised protein	NA	A0A286S2B5	Klebsiella_phage	95.1	4.1e-37
VDY52129.1|2860916_2862569_+	putative helicase	NA	A0A286N2P9	Klebsiella_phage	80.8	1.7e-273
VDY52130.1|2862570_2863533_+	putative phage DNA primase	NA	A0A286N2Q0	Klebsiella_phage	97.5	4.5e-181
VDY52131.1|2863529_2864312_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	88.1	4.1e-132
VDY52132.1|2864598_2865096_-	Uncharacterised protein	NA	A0A077K9U2	Edwardsiella_phage	50.3	3.6e-33
VDY52133.1|2865192_2865396_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY52134.1|2866005_2866317_+	drug/metabolite transporter (DMT) superfamily permease	NA	A0A286N2Q5	Klebsiella_phage	99.0	2.5e-48
2865456:2865470	attR	AAAGCCGCCATATAG	NA	NA	NA	NA
VDY52135.1|2866313_2866856_+	Predicted lysozyme (DUF847)	NA	A0A286N2Q6	Klebsiella_phage	77.5	6.8e-78
VDY52136.1|2866858_2867197_+	Uncharacterised protein	NA	A0A286N2Q7	Klebsiella_phage	83.9	5.8e-43
VDY52137.1|2867193_2867469_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY52138.1|2867413_2867611_+	Uncharacterised protein	NA	A0A286SGR9	Klebsiella_phage	86.0	1.6e-21
VDY52139.1|2868311_2868512_+	Uncharacterised protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	7.6e-19
VDY52140.1|2868576_2868822_+	Protein of uncharacterised function (DUF2560)	NA	A0A286N2R1	Klebsiella_phage	58.0	8.8e-17
VDY52141.1|2868983_2869313_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY52142.1|2869334_2869697_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	76.1	3.4e-49
VDY52143.1|2869880_2870444_+	NUMOD4 motif	NA	A0A0A0RV67	Bacillus_phage	25.9	9.1e-09
VDY52144.1|2870532_2870997_+|terminase	phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
VDY52145.1|2870950_2872687_+|terminase	phage terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.2	4.0e-140
VDY52146.1|2872686_2873961_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	84.7	2.4e-214
VDY52147.1|2873978_2874659_+|head,protease	phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	78.9	9.7e-98
VDY52148.1|2874660_2875827_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	85.1	1.1e-184
VDY52149.1|2875858_2876185_+|head,tail	Phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
VDY52150.1|2876184_2876523_+|head,tail	head-tail adaptor protein	head,tail	K7P7L2	Enterobacteria_phage	65.2	4.0e-36
VDY52151.1|2876519_2876969_+	phage protein, HK97 gp10 family	NA	Q9MCS9	Enterobacteria_phage	83.2	1.0e-63
VDY52152.1|2876965_2877313_+	Protein of uncharacterised function (DUF3168)	NA	K7PKL6	Enterobacterial_phage	61.1	1.4e-31
VDY52153.1|2877369_2878080_+|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	68.2	1.1e-83
VDY52154.1|2878110_2878515_+|tail	phage tail assembly chaperone	tail	Q9MCS5	Enterobacteria_phage	56.5	2.5e-32
VDY52155.1|2878526_2878823_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	64.3	5.1e-27
VDY52156.1|2878873_2879059_+	Uncharacterised protein	NA	K7PH36	Enterobacterial_phage	77.0	1.9e-19
VDY52157.1|2879100_2881365_+|tail	tail length tape measure protein	tail	Q9MCS3	Enterobacteria_phage	71.6	4.3e-243
VDY52158.1|2881450_2882458_+|tail	tail length tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	29.2	1.2e-22
VDY52159.1|2882478_2882952_+	membrane protein	NA	A0A286S298	Klebsiella_phage	62.7	6.4e-56
VDY52160.1|2882938_2883415_+	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	65.8	1.1e-50
VDY52161.1|2883427_2883808_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.9	1.1e-61
VDY52162.1|2883804_2886882_+	kinase	NA	A0A286S259	Klebsiella_phage	61.6	0.0e+00
VDY52163.1|2886960_2889927_+	flagellar biosynthesis, cell-distal portion of basal-body rod	NA	A0A286S1P0	Klebsiella_phage	72.0	8.1e-40
VDY52164.1|2889936_2890665_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY52165.1|2890783_2891101_+	Error-prone repair protein UmuD	NA	K7PGV5	Enterobacterial_phage	50.0	2.4e-22
VDY52166.1|2892250_2893234_+	zinc transporter	NA	NA	NA	NA	NA
VDY52167.1|2893701_2895090_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	1.8e-50
VDY52168.1|2895134_2896070_-|tRNA	tRNA(Cytosine32)-2-thiocytidine synthetase	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	2.4e-139
VDY52169.1|2897022_2897961_+|protease	protease VII (Omptin)	protease	NA	NA	NA	NA
>prophage 6
LR133932	Klebsiella oxytoca strain NCTC11356 genome assembly, chromosome: 1	5856891	2904988	2910542	5856891		Enterobacterial_phage(33.33%)	9	NA	NA
VDY52175.1|2904988_2905690_+	phage repressor	NA	K7PKK1	Enterobacteria_phage	40.0	5.1e-33
VDY52176.1|2906151_2906514_+	phage anti-termination protein N	NA	C6ZR44	Salmonella_phage	55.8	1.5e-28
VDY52177.1|2906590_2906983_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	67.8	7.9e-36
VDY52178.1|2906972_2907245_+	membrane protein	NA	K7PKN9	Enterobacterial_phage	56.6	1.2e-17
VDY52179.1|2907252_2907795_+	Predicted lysozyme (DUF847)	NA	A0A0U2I1S0	Escherichia_phage	64.0	1.9e-67
VDY52180.1|2908024_2908390_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY52181.1|2908717_2908990_+	lipoprotein	NA	NA	NA	NA	NA
VDY52182.1|2908986_2909427_-	Heat shock protein hslJ	NA	NA	NA	NA	NA
VDY52183.1|2909552_2910542_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
>prophage 7
LR133932	Klebsiella oxytoca strain NCTC11356 genome assembly, chromosome: 1	5856891	4131828	4201290	5856891	protease,tRNA,transposase	Enterobacteria_phage(41.67%)	49	NA	NA
VDY53725.1|4131828_4133190_+|protease	protease	protease	Q6DW11	Phage_TP	91.8	3.6e-200
VDY53727.1|4133433_4134327_+	transcription regulator	NA	A0A1V0SBJ0	Catovirus	30.2	1.6e-15
VDY53729.1|4134327_4134798_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY53731.1|4134784_4135594_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
VDY53733.1|4136011_4136785_-	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	40.1	1.7e-26
VDY53735.1|4136795_4137659_-	putative dipeptide ABC transport system ATP-binding component	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
VDY53737.1|4137630_4138536_-	dipeptide transport system permease DppC	NA	NA	NA	NA	NA
VDY53739.1|4138532_4139570_-	dipeptide transport system permease DppB	NA	NA	NA	NA	NA
VDY53741.1|4139566_4141189_-	putative dipeptide ABC transport system periplasmic binding component	NA	NA	NA	NA	NA
VDY53743.1|4141307_4142462_-	putative mandelate racemase / muconate lactonizing enzyme	NA	NA	NA	NA	NA
VDY53745.1|4142759_4143422_-	2-deoxyglucose-6-phosphate hydrolase YniC	NA	NA	NA	NA	NA
VDY53747.1|4143470_4144748_-	ribitol/Xylitol/Arabitol transporter	NA	NA	NA	NA	NA
VDY53749.1|4144817_4146281_-	Xylulose kinase	NA	NA	NA	NA	NA
VDY53751.1|4146290_4147658_-	D-arabinitol dehydrogenase	NA	H8ZJP8	Ostreococcus_tauri_virus	28.5	2.8e-43
VDY53753.1|4147864_4148806_+	putative SorC-family transcriptional regulator	NA	NA	NA	NA	NA
VDY53755.1|4148828_4149830_-	ribitol operon repressor	NA	NA	NA	NA	NA
VDY53757.1|4150087_4150837_+	ribitol 2-dehydrogenase	NA	NA	NA	NA	NA
VDY53759.1|4150867_4152475_+	D-ribulokinase	NA	NA	NA	NA	NA
VDY53761.1|4152528_4153581_-	Fructose-bisphosphate aldolase class I	NA	NA	NA	NA	NA
VDY53763.1|4153729_4154530_-	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VDY53765.1|4154526_4155300_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
VDY53767.1|4155663_4157640_+	hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.0	2.8e-161
VDY53769.1|4157698_4158634_-	LysR family transcriptional regulator YfeR	NA	NA	NA	NA	NA
VDY53771.1|4158733_4160545_+	putative amidohydrolase	NA	NA	NA	NA	NA
VDY53773.1|4160547_4161891_+	xanthine/uracil/thiamine/ascorbate permease family protein	NA	NA	NA	NA	NA
VDY53775.1|4162204_4163227_+|transposase	transposase, IS110 family	transposase	NA	NA	NA	NA
VDY53777.1|4163836_4164859_+|transposase	transposase, IS110 family	transposase	NA	NA	NA	NA
VDY53779.1|4165343_4166366_+|transposase	transposase, IS110 family	transposase	NA	NA	NA	NA
VDY53781.1|4166733_4167654_-	transcriptional regulator	NA	NA	NA	NA	NA
VDY53783.1|4167823_4168141_+	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
VDY53785.1|4168200_4168530_-	Uncharacterised protein	NA	NA	NA	NA	NA
VDY53787.1|4168881_4169991_-	Scaffold protein for [4Fe-4S] cluster assembly ApbC	NA	NA	NA	NA	NA
VDY53789.1|4170133_4172176_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	27.3	6.8e-54
VDY53791.1|4172323_4172827_+	169 kd lipoprotein	NA	NA	NA	NA	NA
VDY53793.1|4173018_4176579_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY53795.1|4176591_4180329_+	WGR domain	NA	NA	NA	NA	NA
VDY53797.1|4180344_4183980_+	WGR domain	NA	NA	NA	NA	NA
VDY53799.1|4183994_4187585_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY53801.1|4187815_4188904_+	gas vesicle protein GvpN	NA	NA	NA	NA	NA
VDY53803.1|4188914_4191200_+	Uncharacterised protein	NA	NA	NA	NA	NA
VDY53805.1|4191199_4192336_+	Mg-chelatase subunit ChlD	NA	Q9EYF7	Enterobacteria_phage	85.3	4.4e-143
VDY53807.1|4192332_4194339_+	SWIM zinc finger	NA	Q9EYF6	Enterobacteria_phage	63.4	3.4e-239
VDY53809.1|4194351_4194813_+	169 kd lipoprotein	NA	NA	NA	NA	NA
VDY53811.1|4194937_4195405_-	Protein of uncharacterised function (DUF1456)	NA	Q9EYF4	Enterobacteria_phage	78.6	3.3e-65
VDY53813.1|4195458_4196178_-	response regulatory protein yehT	NA	NA	NA	NA	NA
VDY53815.1|4196171_4197860_-	autolysin sensor kinase	NA	Q9EYF3	Enterobacteria_phage	84.3	4.6e-258
VDY53817.1|4198070_4198829_+	HTH-type transcriptional regulator mlrA	NA	Q9EYF2	Enterobacteria_phage	69.8	9.5e-78
VDY53819.1|4199159_4200146_+|transposase	transposase, IS110 family	transposase	NA	NA	NA	NA
VDY53821.1|4200267_4201290_+|transposase	transposase, IS110 family	transposase	NA	NA	NA	NA
