The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR130528	Pseudomonas aeruginosa isolate paerg000 genome assembly, chromosome: 0	6493562	669446	690096	6493562		Pseudomonas_phage(66.67%)	27	NA	NA
VDK90982.1|669446_670217_-	HTH-type transcriptional regulator PrtR	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
VDK90984.1|670301_670472_-	hypothetical protein	NA	NA	NA	NA	NA
VDK90986.1|670674_670875_+	RNA polymerase-binding transcription factor DksA	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
VDK90988.1|670922_671282_+	hypothetical protein	NA	NA	NA	NA	NA
VDK90990.1|671738_672086_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	51.8	3.9e-26
VDK90992.1|672101_672731_+	hypothetical protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
VDK90994.1|672727_673090_+	hypothetical protein	NA	NA	NA	NA	NA
VDK90997.1|673086_673344_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
VDK90999.1|673659_674154_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.1e-45
VDK91001.1|674165_674513_+	hypothetical protein	NA	NA	NA	NA	NA
VDK91003.1|674542_674797_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	1.4e-09
VDK91005.1|674843_676682_+	hypothetical protein	NA	A0A0S2SYD9	Pseudomonas_phage	35.8	2.6e-28
VDK91007.1|676674_677016_+	hypothetical protein	NA	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
VDK91009.1|677023_677719_+	hypothetical protein	NA	A0A1B0VNE0	Pseudomonas_phage	50.2	3.0e-70
VDK91011.1|677721_678492_+	hypothetical protein	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
VDK91013.1|678546_679149_+	hypothetical protein	NA	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
VDK91015.1|679207_682822_+	hypothetical protein	NA	A0A0S2SYC5	Pseudomonas_phage	55.2	0.0e+00
VDK91017.1|683250_683391_-	hypothetical protein	NA	NA	NA	NA	NA
VDK91019.1|684329_684965_+	hypothetical protein	NA	A0A0S3UG21	Pseudomonas_phage	34.3	8.4e-19
VDK91021.1|684964_685300_+	hypothetical protein	NA	NA	NA	NA	NA
VDK91022.1|685280_685511_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	64.0	1.1e-18
VDK91024.1|685606_686659_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.5	2.7e-62
VDK91026.1|686658_686961_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	70.0	6.3e-33
VDK91028.1|686957_687188_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	1.4e-24
VDK91030.1|687606_688212_+	Anthranilate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
VDK91032.1|688213_689263_+	Anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
VDK91034.1|689259_690096_+	Indole-3-glycerol phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
LR130528	Pseudomonas aeruginosa isolate paerg000 genome assembly, chromosome: 0	6493562	947991	984086	6493562	tail,integrase	Pseudomonas_virus(94.74%)	44	942077:942092	949481:949496
942077:942092	attL	GGCACCAGGAGTCGAA	NA	NA	NA	NA
VDK91509.1|947991_949311_-|integrase	Prophage integrase IntA	integrase	Q7M297	Enterobacteria_phage	34.0	1.0e-63
VDK91511.1|949846_950353_-	hypothetical protein	NA	NA	NA	NA	NA
949481:949496	attR	GGCACCAGGAGTCGAA	NA	NA	NA	NA
VDK91513.1|950356_950527_-	hypothetical protein	NA	NA	NA	NA	NA
VDK91515.1|950819_951848_-	Tyrosine recombinase XerC	NA	V9IQN0	Stenotrophomonas_phage	40.2	7.1e-60
VDK91517.1|951965_952178_-	hypothetical protein	NA	NA	NA	NA	NA
VDK91518.1|952174_952363_-	hypothetical protein	NA	Q38017	Pseudomonas_virus	76.5	7.0e-06
VDK91520.1|952373_954059_-	hypothetical protein	NA	L7TH64	Pseudomonas_virus	90.8	4.8e-287
VDK91522.1|954051_954303_-	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	100.0	6.4e-39
VDK91524.1|954362_954569_-	hypothetical protein	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
VDK91526.1|954580_954934_-	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	96.6	2.1e-59
VDK91528.1|954978_957699_-	hypothetical protein	NA	Q9ZXI8	Pseudomonas_virus	96.6	0.0e+00
VDK91530.1|957695_957929_-	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
VDK91532.1|957999_958350_-	hypothetical protein	NA	NA	NA	NA	NA
VDK91534.1|958346_958640_-	hypothetical protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
VDK91536.1|958636_959137_-	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	92.9	7.7e-76
VDK91538.1|959938_960055_+	hypothetical protein	NA	Q9ZXJ4	Pseudomonas_virus	94.7	1.2e-11
VDK91540.1|960107_960458_+	hypothetical protein	NA	Q9ZXJ5	Pseudomonas_virus	89.6	2.9e-53
VDK91542.1|961928_963215_-	hypothetical protein	NA	Q9ZXJ8	Pseudomonas_virus	96.2	3.1e-230
VDK91544.1|963211_963652_-	hypothetical protein	NA	Q9ZXJ9	Pseudomonas_virus	99.3	1.8e-76
VDK91546.1|963657_966405_-	hypothetical protein	NA	Q9ZXK0	Pseudomonas_virus	94.1	0.0e+00
VDK91548.1|966522_966852_-	hypothetical protein	NA	Q9ZXK2	Pseudomonas_virus	96.3	5.3e-49
VDK91550.1|966906_967422_-	hypothetical protein	NA	Q9ZXK3	Pseudomonas_virus	94.2	2.1e-89
VDK91552.1|967478_968654_-|tail	Putative prophage major tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.5	2.3e-219
VDK91555.1|968744_969209_-	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	60.7	2.3e-42
VDK91557.1|969205_971563_-	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	87.4	0.0e+00
VDK91559.1|971564_972101_-	hypothetical protein	NA	Q9ZXK7	Pseudomonas_virus	99.4	3.1e-99
VDK91561.1|972100_973015_-	hypothetical protein	NA	Q9ZXK8	Pseudomonas_virus	96.7	7.0e-160
VDK91564.1|973011_973356_-	hypothetical protein	NA	Q9ZXK9	Pseudomonas_virus	97.4	4.6e-56
VDK91566.1|973352_973925_-	hypothetical protein	NA	Q9ZXL0	Pseudomonas_virus	96.8	9.7e-91
VDK91569.1|974102_974531_+	hypothetical protein	NA	NA	NA	NA	NA
VDK91571.1|974540_974999_-	hypothetical protein	NA	Q9ZXL2	Pseudomonas_virus	91.3	9.8e-70
VDK91573.1|974991_975528_-	hypothetical protein	NA	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
VDK91575.1|975605_976067_-	hypothetical protein	NA	Q9ZXL5	Pseudomonas_virus	86.9	1.5e-62
VDK91577.1|976063_976306_-	hypothetical protein	NA	NA	NA	NA	NA
VDK91578.1|976302_977109_-	Zinc D-Ala-D-Ala carboxypeptidase	NA	Q9ZXL6	Pseudomonas_virus	96.9	9.0e-143
VDK91581.1|977105_977378_-	hypothetical protein	NA	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
VDK91584.1|977379_977733_-	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	99.1	1.7e-58
VDK91585.1|977757_977970_-	hypothetical protein	NA	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
VDK91588.1|977969_978431_-	hypothetical protein	NA	Q9ZXM1	Pseudomonas_virus	97.4	6.8e-79
VDK91590.1|978534_979236_-	hypothetical protein	NA	Q9ZXM2	Pseudomonas_virus	98.3	6.9e-123
VDK91592.1|979241_980258_-	hypothetical protein	NA	Q9ZXM3	Pseudomonas_virus	99.1	6.6e-191
VDK91594.1|980293_981115_-	hypothetical protein	NA	Q9ZXM4	Pseudomonas_virus	98.9	2.2e-128
VDK91596.1|981249_983031_+	hypothetical protein	NA	Q9ZXM5	Pseudomonas_virus	99.7	0.0e+00
VDK91598.1|983030_984086_+	hypothetical protein	NA	Q9ZXM6	Pseudomonas_virus	96.5	6.0e-195
>prophage 3
LR130528	Pseudomonas aeruginosa isolate paerg000 genome assembly, chromosome: 0	6493562	4267573	4274465	6493562	protease,tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
VDK97587.1|4267573_4268242_+|protease	Modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
VDK97590.1|4268476_4268746_+	Putative sulfurtransferase DsrE	NA	A0A2H4JA39	uncultured_Caudovirales_phage	69.0	1.2e-27
VDK97593.1|4268742_4269102_+	Intracellular sulfur oxidation protein DsrF	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
VDK97596.1|4269101_4269407_+	Protein TusB	NA	NA	NA	NA	NA
VDK97599.1|4269403_4269739_+	Sulfurtransferase TusE	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.2e-37
VDK97602.1|4269735_4270719_+	Anthranilate phosphoribosyltransferase	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
VDK97605.1|4270806_4271781_+	Glutathionyl-hydroquinone reductase YqjG	NA	NA	NA	NA	NA
VDK97609.1|4271785_4273183_-	Siroheme synthase	NA	NA	NA	NA	NA
VDK97611.1|4273184_4274465_-|tRNA	Serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	4.8e-98
>prophage 4
LR130528	Pseudomonas aeruginosa isolate paerg000 genome assembly, chromosome: 0	6493562	4406175	4437320	6493562	transposase,integrase	Pseudomonas_phage(41.67%)	25	4414930:4414978	4438464:4438512
VDK97968.1|4406175_4406472_-|transposase	Putative transposase (identified by ISEscan HMM)	transposase	NA	NA	NA	NA
VDK97971.1|4406504_4406813_-|transposase	Putative transposase (identified by ISEscan HMM)	transposase	Q716C1	Shigella_phage	44.4	1.5e-13
VDK97974.1|4407212_4408520_-	hypothetical protein	NA	NA	NA	NA	NA
VDK97977.1|4408773_4409058_-	hypothetical protein	NA	A0A2D1GR59	Pseudomonas_phage	87.1	5.2e-37
VDK97980.1|4409164_4409491_-	hypothetical protein	NA	NA	NA	NA	NA
VDK97983.1|4409878_4410142_+|transposase	Putative transposase (identified by ISEscan HMM)	transposase	NA	NA	NA	NA
VDK97986.1|4410174_4411017_+|transposase	Putative transposase (identified by ISEscan HMM)	transposase	S5WIU1	Leptospira_phage	38.7	4.3e-47
VDK97990.1|4411416_4412211_-	hypothetical protein	NA	A0A0S2SY75	Pseudomonas_phage	96.4	3.6e-144
VDK97993.1|4412213_4412720_-	hypothetical protein	NA	A0A0S2SY57	Pseudomonas_phage	98.7	1.3e-86
VDK97996.1|4412937_4413060_+	hypothetical protein	NA	A0A2K8HK84	Pseudomonas_phage	95.0	2.5e-12
VDK97999.1|4413110_4413443_+	hypothetical protein	NA	L7TJJ9	Pseudomonas_virus	98.2	7.9e-53
VDK98002.1|4413516_4413732_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98005.1|4413731_4414844_+	hypothetical protein	NA	A0A0U4JIT5	Pseudomonas_phage	34.1	1.3e-38
4414930:4414978	attL	TTTGGTCGGGACGGAGTGATTCGAACACTCGACCCCTTGCACCCCATGC	NA	NA	NA	NA
VDK98008.1|4415288_4416626_+|integrase	Prophage integrase IntA	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	38.0	2.4e-55
VDK98011.1|4416812_4418042_-	Serine/threonine-protein kinase PrkC	NA	V5L5T2	Insectomime_virus	31.3	2.0e-08
VDK98014.1|4418852_4420538_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98017.1|4420534_4421677_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98020.1|4421680_4422457_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98024.1|4422504_4426794_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98027.1|4426790_4427345_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98030.1|4428112_4429633_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98032.1|4429632_4431756_-	putative type I restriction enzymeP M protein	NA	B3GAM1	uncultured_virus	40.1	1.1e-17
VDK98035.1|4432175_4433090_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98038.1|4433298_4436451_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98041.1|4436477_4437320_-|transposase	Putative transposase (identified by ISEscan HMM)	transposase	S5WIU1	Leptospira_phage	41.5	3.8e-51
4438464:4438512	attR	TTTGGTCGGGACGGAGTGATTCGAACACTCGACCCCTTGCACCCCATGC	NA	NA	NA	NA
>prophage 5
LR130528	Pseudomonas aeruginosa isolate paerg000 genome assembly, chromosome: 0	6493562	5489845	5498907	6493562		Bacillus_phage(33.33%)	10	NA	NA
VDL01611.1|5489845_5490886_-	Protein RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
VDL01615.1|5491019_5491526_-	Nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
VDL01619.1|5491673_5492681_+	Protein TolB	NA	NA	NA	NA	NA
VDL01620.1|5492806_5493727_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
VDL01624.1|5493739_5495374_+	DNA mismatch repair protein MutS	NA	A0A2I2L537	Orpheovirus	31.2	6.5e-23
VDL01630.1|5495440_5495764_+	Ferredoxin-1	NA	NA	NA	NA	NA
VDL01634.1|5496191_5497196_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
VDL01638.1|5497300_5498194_-	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
VDL01642.1|5498239_5498365_-	Protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
VDL01644.1|5498361_5498907_-	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	54.1	1.0e-41
