The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR031521	Streptococcus pyogenes strain S119 genome assembly, chromosome: 1	1877450	36809	49122	1877450		Synechococcus_phage(28.57%)	8	NA	NA
VDC38291.1|36809_40535_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.3	1.5e-38
VDC38292.1|40695_42150_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	2.8e-54
VDC38293.1|42177_43200_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.1	1.1e-63
VDC38294.1|43367_43922_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	5.2e-25
VDC38295.1|44105_45653_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase purH	NA	E3SNU8	Prochlorococcus_phage	51.3	8.3e-44
VDC38296.1|45710_46835_-	amidase	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
VDC38297.1|47087_48353_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
VDC38298.1|48630_49122_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.6	2.1e-17
>prophage 2
LR031521	Streptococcus pyogenes strain S119 genome assembly, chromosome: 1	1877450	157736	197193	1877450	integrase,transposase,tRNA	Bacillus_phage(37.5%)	36	172245:172258	181656:181669
VDC38418.1|157736_160238_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.5	0.0e+00
VDC38420.1|160544_161978_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
VDC38421.1|162048_162327_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
VDC38422.1|162449_162935_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
VDC38423.1|163025_163688_+	3-keto-L-gulonate-6-phosphate decarboxylase ulaD	NA	NA	NA	NA	NA
VDC38424.1|163692_164556_+	L-xylulose 5-phosphate 3-epimerase	NA	NA	NA	NA	NA
VDC38425.1|164557_165262_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
VDC38426.1|165586_167233_+	transcription antiterminator	NA	NA	NA	NA	NA
VDC38427.1|167485_168577_+	L-ascorbate-6-phosphate lactonase	NA	NA	NA	NA	NA
VDC38428.1|169064_170261_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	4.0e-30
VDC38429.1|170276_172004_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
VDC38430.1|172134_174777_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	35.7	4.2e-64
172245:172258	attL	TACCAATGCCATTT	NA	NA	NA	NA
VDC38431.1|174963_175419_+	CoA-binding protein	NA	NA	NA	NA	NA
VDC38432.1|175470_175938_+	transcriptional repressor PerR	NA	NA	NA	NA	NA
VDC38433.1|176094_176394_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38434.1|176615_177950_+	phosphoadenosine phosphosulfate sulfurtransferase	NA	L0P6Z6	Lactobacillus_phage	39.5	6.8e-87
VDC38435.1|177942_178473_+	nuclease	NA	A0A220GKT8	Streptococcus_phage	68.6	7.1e-64
VDC38436.1|178465_178675_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38437.1|178801_178981_-|transposase	transposase	transposase	NA	NA	NA	NA
VDC38439.1|179056_179626_-|integrase	integrase	integrase	A0A1P8CWQ3	Bacillus_phage	39.0	2.6e-27
VDC38440.1|179658_179874_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
VDC38441.1|180029_181340_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
VDC38442.1|181563_182436_+	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
181656:181669	attR	TACCAATGCCATTT	NA	NA	NA	NA
VDC38443.1|182735_183542_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	4.9e-64
VDC38444.1|183562_184078_-|transposase	transposase	transposase	NA	NA	NA	NA
VDC38445.1|184163_185027_-	DUF975 domain-containing protein	NA	NA	NA	NA	NA
VDC38446.1|185245_186388_+|tRNA	Queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.9	2.2e-86
VDC38447.1|186604_186916_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38448.1|186919_187459_+	BioY family transporter	NA	NA	NA	NA	NA
VDC38449.1|187598_188378_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
VDC38450.1|188377_188893_+|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
VDC38451.1|189506_190727_-	S-layer homology domain	NA	NA	NA	NA	NA
VDC38452.1|191138_191843_+	exotoxin type G	NA	NA	NA	NA	NA
VDC38453.1|192298_193648_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
VDC38454.1|193996_195505_-	trans-acting positive regulator RivR	NA	NA	NA	NA	NA
VDC38456.1|196059_197193_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
LR031521	Streptococcus pyogenes strain S119 genome assembly, chromosome: 1	1877450	337026	343060	1877450		Streptococcus_phage(100.0%)	10	NA	NA
VDC38591.1|337026_337662_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	1.2e-65
VDC38592.1|337679_338555_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.4	2.2e-62
VDC38593.1|338573_338813_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38594.1|338901_339063_+	signal peptidase-like protein	NA	NA	NA	NA	NA
VDC38595.1|339217_339541_+	initiation-control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
VDC38597.1|339545_340409_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
VDC38598.1|340435_340828_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38599.1|340874_341504_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
VDC38600.1|341802_342159_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
VDC38601.1|342232_343060_-	exodeoxyribonuclease	NA	M1PSC0	Streptococcus_phage	79.1	1.4e-127
>prophage 4
LR031521	Streptococcus pyogenes strain S119 genome assembly, chromosome: 1	1877450	351401	394362	1877450	bacteriocin,transposase,tRNA	Mycobacterium_phage(18.18%)	50	NA	NA
VDC38607.1|351401_353399_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.0	4.6e-87
VDC38608.1|353893_354907_+	Ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.7	2.5e-97
VDC38609.1|354910_355399_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	36.7	1.4e-10
VDC38610.1|355365_357546_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.1	2.8e-170
VDC38611.1|357748_358501_-	ADP-ribosyltransferase SpyA	NA	NA	NA	NA	NA
VDC38612.1|358494_358602_-	ADP-ribosyltransferase SpyB	NA	NA	NA	NA	NA
VDC38613.1|358959_359496_+	putative membrane associated protein	NA	NA	NA	NA	NA
VDC38614.1|359769_360021_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38615.1|360114_360747_-	hypothetical protein	NA	NA	NA	NA	NA
VDC38616.1|361425_361746_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38617.1|362058_362757_-	exotoxin SpeJ	NA	NA	NA	NA	NA
VDC38618.1|363004_363619_-	hypothetical protein	NA	NA	NA	NA	NA
VDC38619.1|363979_364216_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
VDC38621.1|364208_364907_+	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.3	7.1e-11
VDC38622.1|364982_365942_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
VDC38623.1|366274_367612_+	MFS transporter	NA	NA	NA	NA	NA
VDC38625.1|367784_369167_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.0	3.8e-32
VDC38626.1|369197_369752_+	NUDIX hydrolase	NA	NA	NA	NA	NA
VDC38627.1|369751_370003_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38628.1|370022_370718_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
VDC38629.1|370868_371210_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38630.1|371310_371958_-	metal-dependent transcriptional regulator MtsR	NA	NA	NA	NA	NA
VDC38631.1|372103_373036_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDC38632.1|373099_373825_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
VDC38634.1|373825_374680_+	metal ABC transporter permease	NA	NA	NA	NA	NA
VDC38635.1|374827_375634_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
VDC38636.1|375850_378256_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.8e-88
VDC38637.1|378325_378679_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
VDC38639.1|378922_379348_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
VDC38640.1|379453_380143_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
VDC38641.1|380465_381194_+	Uridylate kinase	NA	NA	NA	NA	NA
VDC38643.1|381222_381780_+	ribosome-recycling factor	NA	NA	NA	NA	NA
VDC38644.1|381888_382746_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
VDC38645.1|382818_383328_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
VDC38646.1|383324_383540_+	YozE family protein	NA	NA	NA	NA	NA
VDC38647.1|383695_384865_+	hypothetical protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.5e-16
VDC38648.1|385178_386951_+	oleate hydratase	NA	NA	NA	NA	NA
VDC38650.1|387109_388162_+	phosphate starvation protein PhoH	NA	W8D063	Erwinia_phage	50.0	1.2e-46
VDC38651.1|388207_388783_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
VDC38652.1|388941_389439_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
VDC38653.1|389419_389827_+	diacylglycerol kinase	NA	NA	NA	NA	NA
VDC38654.1|389946_390843_+	GTPase Era	NA	NA	NA	NA	NA
VDC38655.1|390862_391339_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
VDC38656.1|391643_391898_-	hypothetical protein	NA	NA	NA	NA	NA
VDC38657.1|392295_392541_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
VDC38658.1|392555_392738_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
VDC38659.1|393046_393196_-|transposase	transposase	transposase	NA	NA	NA	NA
VDC38660.1|393192_393615_-|transposase	transposase	transposase	NA	NA	NA	NA
VDC38661.1|393965_394097_+|bacteriocin	bacteriocin class II with double-glycine leader peptide	bacteriocin	NA	NA	NA	NA
VDC38662.1|394161_394362_+|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
>prophage 5
LR031521	Streptococcus pyogenes strain S119 genome assembly, chromosome: 1	1877450	515514	570546	1877450	holin,capsid,terminase,tRNA	Temperate_phage(37.25%)	62	NA	NA
VDC38784.1|515514_516639_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
VDC38785.1|516792_517806_+	peptide chain release factor 2	NA	NA	NA	NA	NA
VDC38786.1|517824_518517_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
VDC38787.1|518509_519439_+	ABC transporter permease	NA	NA	NA	NA	NA
VDC38788.1|519748_520384_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	62.4	8.0e-78
VDC38789.1|520614_521229_+	acetoin reductase	NA	NA	NA	NA	NA
VDC38790.1|521528_523988_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.1	1.3e-203
VDC38791.1|524322_525516_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
VDC38792.1|525536_526883_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
VDC38793.1|527296_528187_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
VDC38794.1|528183_529161_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	2.1e-138
VDC38795.1|529157_530069_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.3e-105
VDC38796.1|530245_531661_-	recombinase family protein	NA	A5GZ62	Lactococcus_phage	47.0	2.3e-109
VDC38797.1|531784_532150_-	hypothetical protein	NA	Q9T1Z1	Lactococcus_phage	67.2	2.8e-19
VDC38798.1|532176_532938_-	XRE family transcriptional regulator	NA	X2KUB8	Streptococcus_phage	40.2	1.4e-39
VDC38799.1|533121_533352_+	XRE family transcriptional regulator	NA	A0A2H4J9X2	uncultured_Caudovirales_phage	63.2	2.3e-19
VDC38800.1|533420_533558_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38802.1|533559_533685_+	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	80.0	1.5e-09
VDC38803.1|533681_533909_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38804.1|533908_535228_+	chromosome segregation protein SMC	NA	A0A097BY67	Enterococcus_phage	63.6	1.1e-150
VDC38805.1|535242_536334_+	hypothetical protein	NA	A0A0K2CZH1	Paenibacillus_phage	52.0	1.0e-96
VDC38806.1|536373_536796_+	hypothetical protein	NA	M1I9V9	Streptococcus_phage	59.9	4.2e-35
VDC38807.1|536797_537532_+	hypothetical protein	NA	Q0R597	Streptococcus_phage	61.3	7.8e-77
VDC38808.1|537553_538189_+	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	46.7	4.3e-31
VDC38809.1|538188_539772_+	DEAD/DEAH box helicase	NA	A0A097BY72	Enterococcus_phage	77.4	1.3e-233
VDC38810.1|539781_540411_+	hypothetical protein	NA	A0A2R4P8H7	Staphylococcus_phage	43.1	9.1e-42
VDC38811.1|540400_542674_+	hypothetical protein	NA	Q5YA88	Bacillus_phage	64.2	3.8e-279
VDC38812.1|542951_543170_+	hypothetical protein	NA	A0A1S5SEA6	Streptococcus_phage	64.3	1.3e-16
VDC38813.1|543162_543558_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	65.6	9.4e-45
VDC38814.1|543554_543776_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38815.1|543778_544051_+	hypothetical protein	NA	A7J287	Streptococcus_phage	63.3	3.2e-20
VDC38816.1|544053_544389_+	hypothetical protein	NA	A0A097PAS4	Streptococcus_pyogenes_phage	100.0	4.7e-45
VDC38817.1|544378_544567_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38818.1|544579_544981_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38819.1|544980_545616_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.4	1.5e-87
VDC38820.1|545880_546318_+	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	100.0	3.6e-77
VDC38821.1|546479_547646_+	adenine methyltransferase	NA	Q708N6	Streptococcus_phage	53.9	7.9e-124
VDC38822.1|547988_548465_+	hypothetical protein	NA	Q938L4	Temperate_phage	68.4	4.9e-48
VDC38823.1|548547_549759_+|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
VDC38824.1|549772_551275_+|capsid	phage capsid protein	capsid	Q938L2	Temperate_phage	99.6	5.9e-281
VDC38825.1|551279_552773_+|capsid	phage capsid protein	capsid	Q938L1	Temperate_phage	80.8	2.1e-214
VDC38826.1|552772_553000_+	hypothetical protein	NA	NA	NA	NA	NA
VDC38827.1|553086_553353_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	8.3e-37
VDC38828.1|553478_554093_+	hypothetical protein	NA	Q938K8	Temperate_phage	95.0	3.1e-95
VDC38829.1|554096_554915_+|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
VDC38830.1|554968_555385_+	hypothetical protein	NA	Q938K7	Temperate_phage	99.1	4.3e-56
VDC38831.1|555374_555707_+	hypothetical protein	NA	Q79S86	Temperate_phage	100.0	9.6e-59
VDC38832.1|555706_556063_+|capsid	capsid protein	capsid	Q79S88	Temperate_phage	100.0	4.5e-62
VDC38833.1|556059_556458_+|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
VDC38834.1|556457_556943_+	hypothetical protein	NA	Q938K6	Temperate_phage	100.0	1.6e-86
VDC38835.1|556981_557416_+	hypothetical protein	NA	Q938K5	Temperate_phage	99.3	2.9e-71
VDC38836.1|557419_558001_+	hypothetical protein	NA	Q938K4	Temperate_phage	98.4	1.6e-104
VDC38837.1|557990_561251_+	tape measure domain-containing protein	NA	Q938K3	Temperate_phage	98.6	0.0e+00
VDC38838.1|561247_561964_+	hypothetical protein	NA	Q938K2	Temperate_phage	99.2	1.9e-136
VDC38839.1|561960_564105_+	phage protein	NA	Q938K1	Temperate_phage	94.1	0.0e+00
VDC38840.1|564101_565223_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	73.3	1.9e-127
VDC38841.1|565235_567149_+	hypothetical protein	NA	Q938J9	Temperate_phage	61.3	2.7e-92
VDC38843.1|567326_567944_+	hypothetical protein	NA	A3F662	Streptococcus_phage	93.7	7.2e-84
VDC38844.1|567953_568229_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
VDC38845.1|568225_568453_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
VDC38846.1|568568_569771_+	lysin	NA	Q938J4	Temperate_phage	95.2	3.4e-231
VDC38847.1|569838_570546_-	exotoxin type C	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.5	1.4e-09
>prophage 6
LR031521	Streptococcus pyogenes strain S119 genome assembly, chromosome: 1	1877450	664274	674877	1877450		Streptococcus_phage(57.14%)	9	NA	NA
VDC38930.1|664274_666485_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
VDC38931.1|666592_667756_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
VDC38932.1|667752_668439_+	3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
VDC38933.1|668532_669699_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.4	1.8e-38
VDC38934.1|669759_670101_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	5.9e-19
VDC38935.1|670321_671674_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	4.5e-30
VDC38936.1|671761_673030_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
VDC38937.1|673059_673500_-	membrane protein	NA	NA	NA	NA	NA
VDC38938.1|673734_674877_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	31.7	7.8e-15
>prophage 7
LR031521	Streptococcus pyogenes strain S119 genome assembly, chromosome: 1	1877450	1017665	1065404	1877450	tail,terminase,integrase,portal,head,holin	Streptococcus_pyogenes_phage(70.69%)	66	1023987:1024046	1061943:1062038
VDC39280.1|1017665_1020776_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	3.7e-120
VDC39281.1|1020960_1021332_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDC39282.1|1021331_1022030_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
VDC39283.1|1022039_1022825_+	hypothetical protein	NA	NA	NA	NA	NA
VDC39284.1|1022951_1023566_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	1.1e-50
1023987:1024046	attL	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTA	NA	NA	NA	NA
VDC39285.1|1024156_1024345_-	hypothetical protein	NA	J7KIW4	Streptococcus_phage	82.3	3.4e-21
VDC39286.1|1024564_1025320_+	exotoxin type A precursor SpeA	NA	A0A097PAT7	Streptococcus_pyogenes_phage	99.6	1.9e-142
VDC39287.1|1025441_1026101_-	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	100.0	8.5e-123
VDC39288.1|1026100_1026322_-	hypothetical protein	NA	A0A097PAX7	Streptococcus_pyogenes_phage	84.5	2.5e-18
VDC39289.1|1026331_1027105_-	hypothetical protein	NA	A0A097PAV0	Streptococcus_pyogenes_phage	100.0	3.9e-135
VDC39290.1|1027115_1027718_-	hypothetical protein	NA	A0A097PAX9	Streptococcus_pyogenes_phage	98.8	7.8e-91
VDC39291.1|1027729_1028494_-	cell wall hydrolase	NA	A0A097PAT3	Streptococcus_pyogenes_phage	98.4	8.0e-149
VDC39292.1|1028495_1028828_-|holin	putative holin	holin	A0A097PBF6	Streptococcus_pyogenes_phage	99.1	7.4e-51
VDC39293.1|1028827_1029151_-	hypothetical protein	NA	A0A097PAX2	Streptococcus_pyogenes_phage	100.0	7.7e-53
VDC39294.1|1029164_1029287_-	phage protein	NA	A0A097PAU6	Streptococcus_pyogenes_phage	100.0	4.8e-16
VDC39295.1|1029300_1029648_-	hypothetical protein	NA	A0A097PAX5	Streptococcus_pyogenes_phage	99.1	6.5e-58
VDC39296.1|1029658_1031521_-	hypothetical protein	NA	A0A097PAT0	Streptococcus_pyogenes_phage	99.4	0.0e+00
VDC39297.1|1031525_1034966_-	hypothetical protein	NA	A0A097PBF5	Streptococcus_pyogenes_phage	98.7	0.0e+00
VDC39298.1|1034966_1036451_-	hypothetical protein	NA	A0A097PAW9	Streptococcus_pyogenes_phage	99.8	4.3e-292
VDC39299.1|1036451_1038257_-|tail	tail protein	tail	A0A097PAU2	Streptococcus_pyogenes_phage	99.7	8.8e-263
VDC39300.1|1038249_1038708_-	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	100.0	2.3e-82
VDC39301.1|1038680_1038998_-	hypothetical protein	NA	A0A097PAS6	Streptococcus_pyogenes_phage	100.0	4.9e-52
VDC39302.1|1039010_1039517_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	100.0	2.6e-79
VDC39303.1|1039528_1039939_-	DUF5072 domain-containing protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	100.0	1.4e-70
VDC39304.1|1039940_1040324_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	100.0	1.7e-59
VDC39305.1|1040332_1040644_-	hypothetical protein	NA	A0A097PAW7	Streptococcus_pyogenes_phage	98.1	1.0e-49
VDC39306.1|1040640_1040985_-	hypothetical protein	NA	A0A097PAS2	Streptococcus_pyogenes_phage	100.0	1.1e-54
VDC39307.1|1040998_1041292_-	hypothetical protein	NA	A0A097PBF3	Streptococcus_pyogenes_phage	100.0	2.0e-47
VDC39308.1|1041304_1042195_-	hypothetical protein	NA	A0A097PAW2	Streptococcus_pyogenes_phage	99.4	8.6e-86
VDC39309.1|1042213_1042783_-	DUF4355 domain-containing protein	NA	A0A097PAW3	Streptococcus_pyogenes_phage	98.4	8.5e-71
VDC39310.1|1042891_1043026_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39311.1|1043027_1043297_-	hypothetical protein	NA	Q938K9	Temperate_phage	85.2	5.6e-33
VDC39312.1|1043303_1044212_-|head	phage head morphogenesis protein	head	A0A097PBF2	Streptococcus_pyogenes_phage	98.2	6.7e-86
VDC39313.1|1044180_1045506_-|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	97.2	1.6e-237
VDC39314.1|1045505_1046780_-|terminase	PBSX family phage terminase large subunit	terminase	A0A097PAV9	Streptococcus_pyogenes_phage	100.0	1.1e-251
VDC39315.1|1046769_1047150_-	hypothetical protein	NA	A0A097PAR5	Streptococcus_pyogenes_phage	100.0	1.0e-64
VDC39316.1|1047759_1048194_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	2.2e-71
VDC39317.1|1048479_1048746_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39318.1|1048742_1049267_-	DUF1642 domain-containing protein	NA	J7KK91	Streptococcus_phage	51.1	2.3e-38
VDC39319.1|1049269_1049902_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	2.3e-85
VDC39320.1|1050184_1050355_-	hypothetical phage protein	NA	Q938M0	Temperate_phage	87.1	7.9e-09
VDC39321.1|1050351_1050588_-	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	100.0	2.4e-40
VDC39322.1|1050587_1050719_-	hypothetical protein	NA	A0A097PBE9	Streptococcus_pyogenes_phage	100.0	4.7e-17
VDC39323.1|1050829_1051186_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
VDC39324.1|1051182_1051623_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.9	4.5e-80
VDC39325.1|1051831_1052257_-	single-stranded DNA-binding protein	NA	A0A097PAQ3	Streptococcus_pyogenes_phage	82.3	2.8e-55
VDC39326.1|1052249_1052924_-	single-stranded DNA-binding protein	NA	Q938M8	Temperate_phage	96.0	1.3e-102
VDC39327.1|1052924_1053407_-	hypothetical protein	NA	Q938M9	Temperate_phage	99.4	4.1e-50
VDC39328.1|1053428_1053683_-	hypothetical protein	NA	Q938N0	Temperate_phage	97.6	1.8e-41
VDC39329.1|1053663_1054017_-	hypothetical protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	54.0	2.8e-16
VDC39330.1|1054029_1054167_-	phage protein	NA	J7KBQ4	Streptococcus_phage	78.4	2.7e-07
VDC39331.1|1054157_1054940_-	DNA replication protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	96.9	3.9e-143
VDC39332.1|1054926_1055757_-	DnaD domain protein	NA	A0A1S5S918	Streptococcus_phage	54.7	6.4e-67
VDC39333.1|1055970_1056432_+	hypothetical protein	NA	NA	NA	NA	NA
VDC39334.1|1056562_1056772_+	hypothetical protein	NA	NA	NA	NA	NA
VDC39335.1|1056881_1057082_-	XRE family transcriptional regulator	NA	A0A141E205	Streptococcus_phage	59.6	2.7e-08
VDC39336.1|1057155_1057542_+	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
VDC39337.1|1057530_1057740_-	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
VDC39338.1|1057793_1058393_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
VDC39339.1|1058422_1058581_-	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	100.0	4.8e-24
VDC39340.1|1058937_1059762_+	XRE family transcriptional regulator	NA	A0A097PBE5	Streptococcus_pyogenes_phage	91.6	1.2e-131
VDC39341.1|1059797_1060691_+	hypothetical protein	NA	A0A1I9LJQ0	Stx_converting_phage	47.5	1.2e-68
VDC39342.1|1060811_1061900_+|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	99.2	4.7e-203
VDC39343.1|1062031_1062145_+	unknown phage protein	NA	NA	NA	NA	NA
1061943:1062038	attR	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTACATCAAGGTTTTTTCTTTTTGTCTTGTTCATGAGTT	NA	NA	NA	NA
VDC39344.1|1062262_1062883_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
VDC39345.1|1063139_1065404_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
>prophage 8
LR031521	Streptococcus pyogenes strain S119 genome assembly, chromosome: 1	1877450	1103369	1145312	1877450	protease,transposase,tRNA	Enterococcus_phage(30.0%)	40	NA	NA
VDC39381.1|1103369_1103885_+|transposase	transposase	transposase	NA	NA	NA	NA
VDC39382.1|1103905_1104712_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.0	4.9e-64
VDC39383.1|1104760_1105492_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
VDC39384.1|1105606_1105972_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
VDC39386.1|1106091_1107312_-	MFS transporter	NA	NA	NA	NA	NA
VDC39387.1|1107685_1109170_+	DUF1846 family protein	NA	NA	NA	NA	NA
VDC39388.1|1109276_1109678_-	thioesterase	NA	NA	NA	NA	NA
VDC39389.1|1109762_1110275_-	phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	97.1	3.0e-91
VDC39390.1|1110579_1111935_-|tRNA	tRNA (uracil-5-)-methyltransferase	tRNA	D0R096	Streptococcus_phage	98.2	2.3e-252
VDC39391.1|1112016_1113468_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
VDC39392.1|1113675_1114167_-	shikimate kinase	NA	NA	NA	NA	NA
VDC39393.1|1114159_1115443_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
VDC39394.1|1115553_1116519_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
VDC39395.1|1116520_1117381_-	methionine aminopeptidase	NA	NA	NA	NA	NA
VDC39396.1|1117396_1118680_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39397.1|1118688_1119231_-	N-acetyltransferase	NA	NA	NA	NA	NA
VDC39398.1|1119468_1120122_-	protein G alpha 2M-binding protein (Grab)	NA	NA	NA	NA	NA
VDC39399.1|1120479_1121739_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
VDC39400.1|1121912_1123109_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	65.2	1.3e-137
VDC39401.1|1123645_1126024_-	internalin A	NA	NA	NA	NA	NA
VDC39402.1|1126227_1127169_+	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
VDC39403.1|1127143_1127347_-	DUF3272 domain-containing protein	NA	NA	NA	NA	NA
VDC39404.1|1127441_1129112_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.1	5.1e-47
VDC39405.1|1129111_1129609_-	GAF domain containing protein	NA	NA	NA	NA	NA
VDC39406.1|1129753_1130563_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
VDC39407.1|1130615_1130879_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
VDC39408.1|1130958_1131585_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	2.2e-35
VDC39409.1|1131682_1132768_+	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	1.6e-33
VDC39410.1|1132878_1134153_-	deacetylase	NA	NA	NA	NA	NA
VDC39411.1|1134247_1135675_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VDC39412.1|1135859_1137593_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
VDC39413.1|1137597_1137861_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
VDC39414.1|1138253_1138472_+	NrdH-redoxin	NA	A0A249XUR7	Enterococcus_phage	49.3	1.1e-13
VDC39415.1|1138491_1140651_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.6	1.4e-262
VDC39416.1|1140983_1141943_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.5	3.7e-127
VDC39417.1|1142004_1143231_+	chloride channel protein	NA	NA	NA	NA	NA
VDC39418.1|1143368_1143662_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
VDC39419.1|1143694_1143991_+	DNA-binding protein	NA	NA	NA	NA	NA
VDC39420.1|1144339_1144525_+|transposase	transposase	transposase	NA	NA	NA	NA
VDC39421.1|1144616_1145312_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 9
LR031521	Streptococcus pyogenes strain S119 genome assembly, chromosome: 1	1877450	1183504	1221722	1877450	tail,terminase,integrase,portal,holin	Streptococcus_phage(72.34%)	59	1185709:1185728	1219107:1219126
VDC39462.1|1183504_1185367_-	PerR-regulated metal transporter A; heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.7	1.0e-88
1185709:1185728	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
VDC39463.1|1185897_1186080_-	paratox	NA	A3F673	Streptococcus_phage	76.7	1.4e-19
VDC39464.1|1186312_1187119_+	DNAse	NA	NA	NA	NA	NA
VDC39465.1|1187389_1187824_+	hypothetical protein	NA	NA	NA	NA	NA
VDC39466.1|1187893_1189099_-	phage associated protein	NA	Q938J4	Temperate_phage	84.3	5.9e-207
VDC39467.1|1189214_1189442_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
VDC39468.1|1189438_1189714_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
VDC39469.1|1189723_1190341_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	83.9	4.4e-73
VDC39470.1|1190337_1190775_-	DUF1617 domain-containing protein	NA	Q938J8	Temperate_phage	97.9	3.8e-71
VDC39471.1|1190786_1192655_-	hypothetical protein	NA	Q938J9	Temperate_phage	56.2	1.2e-89
VDC39472.1|1192651_1193347_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	29.6	7.6e-05
VDC39473.1|1193343_1195701_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.6	6.5e-141
VDC39474.1|1195700_1196072_-	hypothetical protein	NA	M1PL84	Streptococcus_phage	62.4	2.9e-35
VDC39475.1|1196086_1196350_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
VDC39476.1|1196360_1196954_-|tail	tail protein	tail	M1PKG8	Streptococcus_phage	62.5	3.5e-59
VDC39477.1|1196965_1197301_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
VDC39478.1|1197301_1197538_-	hypothetical protein	NA	A0A0B5A7G2	Streptococcus_phage	71.4	2.5e-21
VDC39479.1|1197530_1197869_-	hypothetical protein	NA	M1PFF8	Streptococcus_phage	70.3	2.2e-42
VDC39480.1|1197828_1198251_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	70.8	3.7e-47
VDC39481.1|1198260_1198461_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39482.1|1198460_1199372_-	hypothetical protein	NA	M1PFL0	Streptococcus_phage	67.3	9.9e-114
VDC39483.1|1199396_1199858_-	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	53.2	3.4e-38
VDC39484.1|1199938_1201354_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.2	2.9e-213
VDC39485.1|1201463_1201730_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	86.4	7.3e-33
VDC39486.1|1201722_1201902_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39487.1|1201951_1202176_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39488.1|1202181_1203675_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	54.6	2.2e-86
VDC39489.1|1203667_1204936_-|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	75.6	2.2e-188
VDC39490.1|1204932_1205289_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
VDC39491.1|1205437_1205782_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	68.5	5.5e-41
VDC39492.1|1205890_1206310_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	8.7e-57
VDC39493.1|1206577_1207213_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	69.4	2.0e-89
VDC39494.1|1207214_1207484_-	hypothetical protein	NA	A7J287	Streptococcus_phage	71.9	9.6e-25
VDC39495.1|1207567_1208080_-	hypothetical protein	NA	Q708P9	Streptococcus_phage	78.0	2.3e-67
VDC39496.1|1208076_1208418_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	4.8e-13
VDC39497.1|1208595_1208763_-	phage protein	NA	A0A1S5SEF3	Streptococcus_phage	51.9	3.3e-07
VDC39498.1|1208772_1209570_-	hypothetical protein	NA	J7KGZ1	Streptococcus_phage	84.5	6.0e-131
VDC39499.1|1209566_1210496_-	DNA recombination protein RecT	NA	M1NRN6	Streptococcus_phage	72.2	1.1e-91
VDC39500.1|1210498_1210828_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	83.5	2.1e-45
VDC39501.1|1210883_1211090_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39502.1|1211098_1211239_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39503.1|1211235_1211469_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
VDC39504.1|1211449_1211839_-	DnaD domain protein	NA	Q938N2	Temperate_phage	81.4	9.3e-45
VDC39505.1|1212322_1212508_-	hypothetical protein	NA	Q938N3	Temperate_phage	88.5	5.8e-21
VDC39506.1|1212509_1212821_-	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.4	4.1e-43
VDC39507.1|1212898_1213084_-	transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
VDC39508.1|1213250_1213490_+	hypothetical protein	NA	NA	NA	NA	NA
VDC39509.1|1213631_1214438_+	hypothetical protein	NA	A0A1S5SBU1	Streptococcus_phage	82.1	7.9e-123
VDC39510.1|1214670_1215387_-	phage antirepressor protein	NA	C9WB91	Streptococcus_virus	87.7	6.8e-118
VDC39511.1|1215398_1215590_-	hypothetical protein	NA	A7J270	Streptococcus_phage	92.1	4.0e-25
VDC39512.1|1216225_1216321_+	type I addiction module toxin, Fst family	NA	NA	NA	NA	NA
VDC39513.1|1216743_1217091_+	XRE family transcriptional regulator	NA	A0A1S5SEQ8	Streptococcus_phage	71.8	3.6e-40
VDC39514.1|1217094_1217475_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	61.1	8.0e-41
VDC39515.1|1217486_1217753_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
VDC39516.1|1217876_1219019_+|integrase	putative integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
VDC39517.1|1219108_1219384_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1219107:1219126	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
VDC39518.1|1219482_1220070_-	DUF2140 domain-containing protein	NA	NA	NA	NA	NA
VDC39519.1|1220047_1220890_-	lipase	NA	NA	NA	NA	NA
VDC39520.1|1220882_1221722_-	hypothetical protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	7.0e-13
>prophage 10
LR031521	Streptococcus pyogenes strain S119 genome assembly, chromosome: 1	1877450	1425574	1469641	1877450	tRNA,tail,terminase,integrase,portal,head	Streptococcus_phage(81.63%)	58	1425437:1425453	1466237:1466253
1425437:1425453	attL	AAGGAGAGGAGGGGATT	NA	NA	NA	NA
VDC39708.1|1425574_1425754_-	paratox	NA	A3F673	Streptococcus_phage	83.1	5.6e-21
VDC39709.1|1425992_1427165_+	streptodornase SdaD2	NA	A7J2B8	Streptococcus_phage	49.8	4.7e-76
VDC39710.1|1427280_1428477_-	phage associated protein	NA	Q938J4	Temperate_phage	82.2	6.1e-196
VDC39712.1|1428587_1428773_-	hypothetical protein	NA	Q938J5	Temperate_phage	93.4	9.5e-24
VDC39713.1|1428769_1429069_-	hypothetical protein	NA	Q938J6	Temperate_phage	82.3	3.5e-36
VDC39714.1|1429079_1429700_-	hypothetical protein	NA	A3F662	Streptococcus_phage	88.8	8.3e-80
VDC39715.1|1429702_1429864_-	Ribosome maturation factor RimP	NA	NA	NA	NA	NA
VDC39716.1|1429872_1431780_-	hypothetical protein	NA	Q938J9	Temperate_phage	60.9	1.3e-134
VDC39717.1|1431790_1432426_-	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	67.6	2.2e-75
VDC39718.1|1432425_1433481_-	hypothetical protein	NA	A3F657	Streptococcus_phage	73.2	1.2e-126
VDC39719.1|1433477_1435460_-	peptidase	NA	A7J2A7	Streptococcus_phage	92.5	0.0e+00
VDC39720.1|1435469_1436312_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	99.6	8.5e-160
VDC39721.1|1436323_1440706_-	hypothetical protein P9_gp39	NA	A7J2A5	Streptococcus_phage	76.4	3.2e-226
VDC39722.1|1440720_1440954_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	100.0	4.4e-34
VDC39723.1|1441028_1441484_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	100.0	8.3e-77
VDC39724.1|1441537_1442137_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	98.9	4.1e-92
VDC39725.1|1442148_1442508_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	97.5	6.8e-58
VDC39726.1|1442511_1442856_-	hypothetical protein	NA	A7J2A0	Streptococcus_phage	99.1	6.1e-56
VDC39727.1|1442852_1443131_-	hypothetical protein	NA	A7J299	Streptococcus_phage	98.9	4.2e-47
VDC39728.1|1443141_1443498_-	hypothetical protein	NA	A7J298	Streptococcus_phage	97.5	2.8e-56
VDC39729.1|1443509_1444397_-	hypothetical protein	NA	A7J297	Streptococcus_phage	99.7	3.6e-161
VDC39730.1|1444409_1444979_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	97.9	2.6e-80
VDC39731.1|1445134_1445401_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	88.6	1.7e-34
VDC39732.1|1445403_1445592_-	hypothetical protein	NA	A7J294	Streptococcus_phage	98.4	1.4e-22
VDC39733.1|1445622_1447068_-|head	phage head morphogenesis protein	head	A7J293	Streptococcus_phage	92.9	3.4e-257
VDC39734.1|1447027_1448560_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	98.2	1.3e-286
VDC39735.1|1448575_1449853_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	97.6	1.3e-241
VDC39736.1|1449842_1450295_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
VDC39737.1|1450384_1450801_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	100.0	6.6e-73
VDC39738.1|1450797_1450989_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39739.1|1450978_1451830_-	site-specific DNA-methyltransferase	NA	A0A1W6JMZ7	Lactococcus_phage	71.9	1.5e-100
VDC39740.1|1451838_1452105_-	hypothetical protein	NA	A7J287	Streptococcus_phage	65.2	5.4e-20
VDC39741.1|1452101_1452269_-	phage protein	NA	A7J285	Streptococcus_phage	94.5	1.9e-23
VDC39742.1|1452269_1453592_-	ATP-dependent helicase	NA	A7J284	Streptococcus_phage	98.4	1.9e-254
VDC39744.1|1453588_1453864_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	100.0	9.1e-47
VDC39745.1|1454250_1456635_-	DNA primase	NA	A7J282	Streptococcus_phage	94.4	4.1e-276
VDC39747.1|1456639_1458562_-	DNA polymerase	NA	A7J280	Streptococcus_phage	96.7	0.0e+00
VDC39748.1|1458604_1459162_-	DUF2815 domain-containing protein	NA	D2J040	Enterococcus_phage	57.9	2.5e-51
VDC39749.1|1459172_1459571_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39751.1|1459574_1460729_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	91.9	4.5e-204
VDC39752.1|1460728_1461028_-	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
VDC39753.1|1461115_1461319_-	hypothetical protein	NA	A7J276	Streptococcus_phage	95.5	2.3e-31
VDC39754.1|1461315_1461468_-	phage protein	NA	A7J275	Streptococcus_phage	92.0	4.1e-17
VDC39755.1|1461464_1461851_-	hypothetical protein	NA	A7J274	Streptococcus_phage	88.2	3.1e-56
VDC39756.1|1461847_1462051_-	hypothetical protein	NA	NA	NA	NA	NA
VDC39757.1|1462043_1462214_-	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	6.9e-21
VDC39759.1|1462210_1462486_-	hypothetical protein	NA	A7J272	Streptococcus_phage	95.6	5.9e-46
VDC39760.1|1462547_1462763_-	hypothetical protein	NA	M1Q1B4	Streptococcus_phage	76.8	4.2e-23
VDC39761.1|1462810_1463224_+	hypothetical protein	NA	NA	NA	NA	NA
VDC39762.1|1463204_1463360_-	phage protein	NA	NA	NA	NA	NA
VDC39764.1|1463634_1464036_+	XRE family transcriptional regulator	NA	A7J269	Streptococcus_phage	72.9	1.1e-40
VDC39765.1|1464049_1464433_+	hypothetical protein	NA	A7J268	Streptococcus_phage	99.2	5.3e-69
VDC39766.1|1464443_1464995_+	hypothetical protein P9_gp02	NA	A7J267	Streptococcus_phage	92.3	3.4e-85
VDC39767.1|1465111_1466191_+|integrase	site-specific integrase	integrase	A7J266	Streptococcus_phage	86.9	1.3e-176
VDC39768.1|1466388_1467024_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
1466237:1466253	attR	AAGGAGAGGAGGGGATT	NA	NA	NA	NA
VDC39769.1|1467023_1467815_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
VDC39770.1|1467878_1468913_-	multidrug ABC transporter permease	NA	NA	NA	NA	NA
VDC39771.1|1468915_1469641_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.0	3.9e-20
