The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	30618	68770	4108173	transposase	Bacillus_phage(22.22%)	44	NA	NA
VDK97510.1|30618_31278_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK97513.1|31649_31958_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.7	4.7e-07
VDK97516.1|31960_32968_-	exported protein	NA	NA	NA	NA	NA
VDK97519.1|33116_33944_-	transcriptional regulator	NA	NA	NA	NA	NA
VDK97522.1|33949_34747_-	haloacid dehalogenase	NA	NA	NA	NA	NA
VDK97525.1|34892_36068_+	bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II-like protein	NA	M4QPK3	Synechococcus_phage	40.3	4.5e-34
VDK97528.1|36081_36603_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	34.5	1.8e-11
VDK97531.1|36574_37075_+	transcription antitermination protein NusB	NA	NA	NA	NA	NA
VDK97534.1|37132_38131_+	thiamine monophosphate kinase	NA	NA	NA	NA	NA
VDK97537.1|38127_38670_+	phosphatidylglycerophosphatase	NA	NA	NA	NA	NA
VDK97540.1|38666_39233_+	Nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	40.5	3.4e-19
VDK97543.1|39369_40191_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
VDK97547.1|40198_41518_-	NADH dehydrogenase	NA	NA	NA	NA	NA
VDK97549.1|41568_41922_-	diacylglycerol kinase	NA	NA	NA	NA	NA
VDK97552.1|42054_42939_-	serum resistance protein	NA	NA	NA	NA	NA
VDK97555.1|43246_44680_+	BrkA autotransporter	NA	NA	NA	NA	NA
VDK97558.1|44676_45396_+	BrkA autotransporter	NA	NA	NA	NA	NA
VDK97561.1|45347_46277_+	BrkA autotransporter	NA	NA	NA	NA	NA
VDK97564.1|46380_48024_-	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	59.7	3.9e-169
VDK97567.1|48056_48344_-	co-chaperonin GroES	NA	A0A221S4A8	uncultured_virus	52.1	1.2e-20
VDK97570.1|48677_49307_-	hypothetical protein	NA	NA	NA	NA	NA
VDK97573.1|49303_49975_-	maleate isomerase	NA	NA	NA	NA	NA
VDK97576.1|50053_50689_-	hypothetical protein	NA	NA	NA	NA	NA
VDK97579.1|50732_52442_-	dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	27.4	2.7e-27
VDK97582.1|52503_53454_-	exported protein	NA	NA	NA	NA	NA
VDK97585.1|53650_53875_-	hypothetical protein	NA	NA	NA	NA	NA
VDK97588.1|54059_54986_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK97591.1|55120_56866_+	FAD-binding dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	25.1	6.5e-21
VDK97595.1|57092_57353_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK97598.1|57603_58044_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK97601.1|58144_58234_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK97604.1|58654_59095_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK97607.1|59176_59824_+	Nicotinamidase	NA	NA	NA	NA	NA
VDK97610.1|59838_61266_-	membrane protein	NA	A0A127AWB9	Bacillus_phage	40.0	6.5e-19
VDK97613.1|61431_62037_-	Cyclic di-GMP phosphodiesterase response regulator RpfG	NA	NA	NA	NA	NA
VDK97616.1|62195_62396_+	hypothetical protein	NA	NA	NA	NA	NA
VDK97619.1|62417_62684_-	hypothetical protein	NA	NA	NA	NA	NA
VDK97622.1|63049_63250_+	hypothetical protein	NA	NA	NA	NA	NA
VDK97625.1|63311_63524_+	hypothetical protein	NA	NA	NA	NA	NA
VDK97630.1|63730_65098_-	Hercynine oxygenase	NA	NA	NA	NA	NA
VDK97633.1|65137_66112_-	Histidine N-alpha-methyltransferase	NA	NA	NA	NA	NA
VDK97636.1|66443_67043_+	membrane protein	NA	NA	NA	NA	NA
VDK97639.1|67030_68461_+	phospholipase D family protein	NA	NA	NA	NA	NA
VDK97642.1|68470_68770_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	145868	190619	4108173	transposase	Lake_Baikal_phage(16.67%)	45	NA	NA
VDK97884.1|145868_146390_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK97887.1|146376_146817_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK97890.1|146932_148000_+	choloylglycine hydrolase	NA	NA	NA	NA	NA
VDK97893.1|149357_150719_-	ribonuclease E	NA	NA	NA	NA	NA
VDK97896.1|150715_151204_-	ribonuclease E	NA	NA	NA	NA	NA
VDK97899.1|151771_152677_+	ribosomal large subunit pseudouridine synthase C	NA	NA	NA	NA	NA
VDK97900.1|153191_153350_+	hydrolase	NA	NA	NA	NA	NA
VDK97903.1|153506_154466_+	sulfite oxidase subunit YedY	NA	NA	NA	NA	NA
VDK97906.1|154473_155136_+	sulfite oxidase heme-binding subunit YedZ	NA	NA	NA	NA	NA
VDK97909.1|155132_155573_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK97912.1|156207_157461_+	CAIB/BAIF family protein	NA	NA	NA	NA	NA
VDK97915.1|157438_158401_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK97918.1|158538_159027_+	MaoC family protein	NA	NA	NA	NA	NA
VDK97921.1|159048_160257_+	dehydratase/racemase	NA	NA	NA	NA	NA
VDK97924.1|160391_160628_-	hypothetical protein	NA	NA	NA	NA	NA
VDK97927.1|160685_160916_-	hypothetical protein	NA	NA	NA	NA	NA
VDK97930.1|161002_161284_+	exported protein	NA	NA	NA	NA	NA
VDK97933.1|161270_161540_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK97936.1|161536_162256_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK97939.1|162399_162804_+	translational inhibitor	NA	NA	NA	NA	NA
VDK97942.1|163111_166333_+	molybdopterin oxidoreductase	NA	NA	NA	NA	NA
VDK97945.1|166363_167827_+	short-chain fatty acids transporter	NA	NA	NA	NA	NA
VDK97948.1|167835_169464_+	delta-1-pyrroline-5-carboxylate dehydrogenase	NA	NA	NA	NA	NA
VDK97951.1|169564_170209_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDK97954.1|170238_170460_-	exported protein	NA	NA	NA	NA	NA
VDK97957.1|171189_171393_+	cold shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	5.8e-14
VDK97960.1|171568_172474_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK97963.1|172572_173094_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK97966.1|173172_173523_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK97969.1|174049_175255_+	CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.6	1.4e-22
VDK97972.1|175303_176497_-	thiolase	NA	NA	NA	NA	NA
VDK97975.1|176562_177591_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDK97979.1|177617_178778_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDK97982.1|178915_179893_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK97985.1|179903_180875_-	exported protein	NA	NA	NA	NA	NA
VDK97988.1|180941_181727_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
VDK97991.1|181719_182952_-	racemase	NA	NA	NA	NA	NA
VDK97994.1|182948_183902_-	membrane protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.8e-42
VDK97997.1|184012_184531_+	Mg(2+) transporter	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
VDK98000.1|184527_186339_-	elongation factor G	NA	A0A2K9L2P9	Tupanvirus	24.9	1.7e-24
VDK98003.1|186343_187720_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDK98006.1|187819_188164_+	Beta-lactamase hydrolase-like protein	NA	NA	NA	NA	NA
VDK98009.1|188252_188723_+	universal stress protein	NA	NA	NA	NA	NA
VDK98012.1|189135_189534_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
VDK98016.1|189665_190619_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	198815	290261	4108173	transposase,tRNA,integrase	Streptococcus_phage(33.33%)	104	216438:216458	224606:224626
VDK98040.1|198815_199283_-|integrase	integrase	integrase	NA	NA	NA	NA
VDK98044.1|199269_199797_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98047.1|199889_200357_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98050.1|200519_201572_+	glycosyl transferase family protein	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
VDK98053.1|201568_203188_+	membrane protein	NA	NA	NA	NA	NA
VDK98055.1|203147_203543_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98058.1|203561_204479_+	Chitooligosaccharide deacetylase ChbG	NA	NA	NA	NA	NA
VDK98061.1|204475_204931_+	membrane protein	NA	NA	NA	NA	NA
VDK98064.1|204936_205860_-	exported protein	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
VDK98067.1|205949_206609_-	membrane protein	NA	NA	NA	NA	NA
VDK98071.1|206605_207442_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98074.1|207608_208133_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98077.1|208089_208560_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98080.1|208635_209616_+	exported protein	NA	NA	NA	NA	NA
VDK98083.1|210074_210674_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98086.1|210748_211735_+	exported protein	NA	NA	NA	NA	NA
VDK98088.1|211772_213374_+	Thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
VDK98091.1|213414_214296_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK98094.1|214308_216015_+	acetolactate synthase large subunit	NA	NA	NA	NA	NA
VDK98097.1|216152_217361_+	CAIB/BAIF family protein	NA	NA	NA	NA	NA
216438:216458	attL	GACGTGCTGATCGAGAACTTC	NA	NA	NA	NA
VDK98100.1|217357_218128_+	enoyl-CoA hydratase/isomerase	NA	NA	NA	NA	NA
VDK98103.1|218176_218878_+	lipoprotein	NA	NA	NA	NA	NA
VDK98105.1|218804_219278_-|integrase	integrase	integrase	NA	NA	NA	NA
VDK98108.1|219264_219792_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98111.1|219890_220844_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
VDK98114.1|221148_221958_+	transcriptional regulator	NA	NA	NA	NA	NA
VDK98117.1|222058_223411_+	Thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
VDK98122.1|223371_223692_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98125.1|223688_224333_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98128.1|224329_225550_+	CAIB/BAIF family protein	NA	NA	NA	NA	NA
224606:224626	attR	GACGTGCTGATCGAGAACTTC	NA	NA	NA	NA
VDK98131.1|225572_226568_+	membrane protein	NA	NA	NA	NA	NA
VDK98134.1|226640_227846_-	racemase	NA	NA	NA	NA	NA
VDK98138.1|227842_228091_-	Glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
VDK98140.1|228087_228972_-	D-proline reductase subunit gamma	NA	NA	NA	NA	NA
VDK98143.1|229649_230090_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98146.1|230086_230659_-	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.5	3.2e-25
VDK98149.1|230655_231594_-	tetrapyrrole methylase	NA	NA	NA	NA	NA
VDK98152.1|231895_232195_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98154.1|232194_232767_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	40.5	3.0e-15
VDK98159.1|232795_233536_+	exported protein	NA	NA	NA	NA	NA
VDK98161.1|233532_234024_+	thioredoxin	NA	NA	NA	NA	NA
VDK98164.1|234164_234953_-	exported protein	NA	NA	NA	NA	NA
VDK98166.1|235214_236117_+	acetylglutamate kinase	NA	NA	NA	NA	NA
VDK98169.1|236116_236863_+	hydrolase	NA	NA	NA	NA	NA
VDK98172.1|236912_237488_+	nucleoid occlusion protein	NA	NA	NA	NA	NA
VDK98175.1|237700_239194_+	Sodium:sulfate symportert	NA	NA	NA	NA	NA
VDK98178.1|239204_240260_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
VDK98181.1|240285_241422_-	rod shape-determining protein	NA	NA	NA	NA	NA
VDK98184.1|241418_243371_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
VDK98187.1|243384_243948_-	cell shape-determining protein	NA	NA	NA	NA	NA
VDK98190.1|243934_244756_-	cell shape-determining protein MreC	NA	NA	NA	NA	NA
VDK98193.1|244906_245950_-	cell shape-determining protein MreB	NA	NA	NA	NA	NA
VDK98196.1|246180_246489_+|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit C	tRNA	NA	NA	NA	NA
VDK98199.1|246491_247577_+|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit A	tRNA	NA	NA	NA	NA
VDK98203.1|247528_248029_+|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit A	tRNA	NA	NA	NA	NA
VDK98206.1|248031_249468_+|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit B	tRNA	NA	NA	NA	NA
VDK98210.1|249597_250272_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
VDK98213.1|250409_251198_+	endonuclease	NA	M1PSC0	Streptococcus_phage	25.7	1.2e-19
VDK98216.1|251620_252964_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
VDK98219.1|253000_253639_-	membrane protein	NA	NA	NA	NA	NA
VDK98222.1|253826_254606_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98225.1|254687_255314_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98228.1|255286_255637_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98231.1|255596_256556_-	exported protein	NA	NA	NA	NA	NA
VDK98234.1|256813_257554_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
VDK98237.1|257767_258778_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
VDK98239.1|258796_259276_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98242.1|259300_260761_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
VDK98245.1|260805_261537_-	PqqC-like protein	NA	NA	NA	NA	NA
VDK98248.1|261656_263165_-	membrane protein	NA	NA	NA	NA	NA
VDK98251.1|263395_264139_+	membrane protein	NA	NA	NA	NA	NA
VDK98254.1|264237_264960_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDK98257.1|265071_265698_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98260.1|265670_266021_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98263.1|266017_266950_-	ornithine cyclodeaminase	NA	NA	NA	NA	NA
VDK98266.1|266960_267257_-	ferredoxin	NA	NA	NA	NA	NA
VDK98269.1|267284_267584_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98271.1|267585_267903_-	ferredoxin	NA	NA	NA	NA	NA
VDK98274.1|268216_268408_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98277.1|268581_269091_+	heme uptake regulator	NA	NA	NA	NA	NA
VDK98280.1|269069_270044_+	heme uptake transmembrane sensor	NA	NA	NA	NA	NA
VDK98283.1|270271_272788_+	outer membrane heme receptor	NA	NA	NA	NA	NA
VDK98286.1|272823_273870_+	hemin transport protein	NA	NA	NA	NA	NA
VDK98289.1|273878_274529_+	hemin binding protein	NA	NA	NA	NA	NA
VDK98292.1|274480_274735_+	hemin binding protein	NA	NA	NA	NA	NA
VDK98295.1|274882_275722_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98298.1|275736_276525_+	hemin importer ATP-binding protein HmuV	NA	NA	NA	NA	NA
VDK98301.1|276528_277029_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98304.1|277172_277895_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98307.1|277906_278557_+	alkylated DNA repair protein	NA	NA	NA	NA	NA
VDK98310.1|278634_279165_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	39.5	1.3e-20
VDK98313.1|279259_280402_+	membrane protein	NA	G3MA91	Bacillus_virus	35.9	5.7e-18
VDK98316.1|280411_281236_-	exported protein	NA	NA	NA	NA	NA
VDK98319.1|281238_282174_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98322.1|282122_282605_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK98325.1|282930_283926_+	exported protein	NA	NA	NA	NA	NA
VDK98328.1|283938_284823_+	metallo-beta-lactamase family protein	NA	NA	NA	NA	NA
VDK98331.1|284909_286106_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
VDK98334.1|286102_286516_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98337.1|286528_287545_+	exported protein	NA	NA	NA	NA	NA
VDK98340.1|287595_289233_+	coenzyme A ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.4	1.8e-20
VDK98343.1|289238_289604_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98346.1|289600_289807_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98349.1|289766_290261_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	317912	343811	4108173	protease,transposase	Acanthamoeba_castellanii_mimivirus(33.33%)	30	NA	NA
VDK98435.1|317912_318263_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98438.1|318235_318865_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98441.1|319433_319697_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98444.1|319947_320388_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98447.1|320447_321008_+	5'(3')-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
VDK98450.1|321137_322034_+	Inositol 2-dehydrogenase/D-chiro-inositol 3-dehydrogenase	NA	NA	NA	NA	NA
VDK98453.1|322030_322477_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98456.1|322510_323392_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK98459.1|323505_324708_+	transporter	NA	NA	NA	NA	NA
VDK98462.1|324836_326696_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
VDK98465.1|326773_327583_-	transcriptional regulator	NA	NA	NA	NA	NA
VDK98468.1|327653_328655_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
VDK98471.1|328686_329547_-	transcriptional regulator	NA	NA	NA	NA	NA
VDK98474.1|329746_330751_+	acetyl esterase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	31.5	7.5e-30
VDK98477.1|330747_332334_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
VDK98480.1|332342_333269_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
VDK98483.1|333291_333918_+	regulatory protein	NA	NA	NA	NA	NA
VDK98486.1|334016_334646_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98488.1|334618_334969_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98491.1|334965_336135_-|protease	protease	protease	W5SAB9	Pithovirus	31.2	1.2e-07
VDK98495.1|336155_336932_+	GTP cyclohydrolase 1 type 2	NA	NA	NA	NA	NA
VDK98498.1|336956_337415_-	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
VDK98501.1|337500_338196_+	ubiquinol-cytochrome C reductase iron-sulfur subunit	NA	NA	NA	NA	NA
VDK98504.1|338260_339643_+	cytochrome B	NA	NA	NA	NA	NA
VDK98507.1|339668_340517_+	cytochrome C1	NA	NA	NA	NA	NA
VDK98510.1|340675_341287_+	stringent starvation protein A	NA	NA	NA	NA	NA
VDK98513.1|341296_341746_+	stringent starvation protein B	NA	NA	NA	NA	NA
VDK98516.1|342412_342574_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98519.1|342853_343555_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98522.1|343496_343811_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	354426	405287	4108173	tRNA,transposase,protease	uncultured_Caudovirales_phage(25.0%)	50	NA	NA
VDK98566.1|354426_354867_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98569.1|354853_355378_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98572.1|355395_356073_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDK98575.1|356108_357089_+	exported protein	NA	NA	NA	NA	NA
VDK98578.1|357102_358227_+	CAIB/BAIF family protein	NA	NA	NA	NA	NA
VDK98581.1|358234_359989_-	gamma-glutamyltranspeptidase	NA	NA	NA	NA	NA
VDK98583.1|360095_360995_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK98586.1|361059_362043_-	exported protein	NA	NA	NA	NA	NA
VDK98589.1|362247_363159_+	membrane protein	NA	NA	NA	NA	NA
VDK98592.1|363175_364567_-	fumarate hydratase	NA	NA	NA	NA	NA
VDK98595.1|364791_365256_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein TsaE	tRNA	NA	NA	NA	NA
VDK98599.1|365425_366571_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	3.7e-17
VDK98602.1|366714_367353_-	membrane protein	NA	NA	NA	NA	NA
VDK98603.1|367439_368978_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.4	3.9e-54
VDK98605.1|368920_369328_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.4	1.1e-11
VDK98607.1|369324_370266_+|tRNA	tRNA dimethylallyltransferase	tRNA	NA	NA	NA	NA
VDK98610.1|370371_371421_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
VDK98613.1|371673_372375_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
VDK98616.1|372371_373070_+	putative phosphatase	NA	NA	NA	NA	NA
VDK98619.1|373070_374426_+	poly(A) polymerase	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
VDK98622.1|374422_374914_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridinepyrophosphokinase	NA	NA	NA	NA	NA
VDK98625.1|374932_375889_-	exported protein	NA	NA	NA	NA	NA
VDK98628.1|375915_376746_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98631.1|377299_378559_-	membrane protein	NA	NA	NA	NA	NA
VDK98634.1|378564_379404_-	membrane protein	NA	NA	NA	NA	NA
VDK98637.1|379574_380618_+	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDK98640.1|380691_381405_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDK98643.1|381421_382177_-	3-hydroxyisobutyrate dehydrogenase	NA	D2K0C8	Staphylococcus_phage	55.0	4.6e-32
VDK98646.1|382261_382372_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
VDK98649.1|382426_382837_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
VDK98652.1|382964_383681_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98655.1|383786_384584_+	beta-D-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
VDK98658.1|384681_385206_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98661.1|385162_385648_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98664.1|385653_386580_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98667.1|386666_387107_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98670.1|387093_387615_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98673.1|387729_388491_-	restriction endonuclease	NA	NA	NA	NA	NA
VDK98676.1|388487_389384_-	exported protein	NA	NA	NA	NA	NA
VDK98679.1|389702_391616_+	phosphomethylpyrimidine synthase	NA	NA	NA	NA	NA
VDK98682.1|391657_393088_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
VDK98685.1|393200_394613_-	oxidoreductase	NA	NA	NA	NA	NA
VDK98688.1|394629_395328_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDK98691.1|395609_396071_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98694.1|396067_396499_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98697.1|396523_397423_-	virginiamycin B lyase	NA	NA	NA	NA	NA
VDK98700.1|397577_398126_+	acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
VDK98703.1|398164_398884_-	7-cyano-7-deazaguanine synthase	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
VDK98707.1|399054_401898_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
VDK98710.1|402491_405287_+|protease	autotransporter subtilisin-like protease	protease	NA	NA	NA	NA
>prophage 6
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	414367	456073	4108173	tRNA,transposase	Planktothrix_phage(25.0%)	45	NA	NA
VDK98744.1|414367_414541_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98747.1|414480_414720_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98750.1|414692_415325_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98753.1|415423_415921_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
VDK98756.1|415938_416904_-	exported protein	NA	NA	NA	NA	NA
VDK98760.1|416935_418147_-	CAIB/BAIF family protein	NA	NA	NA	NA	NA
VDK98763.1|418216_418957_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDK98766.1|419101_421966_-	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
VDK98769.1|422025_422400_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
VDK98772.1|422481_423582_-	glycine cleavage system aminomethyltransferase	NA	NA	NA	NA	NA
VDK98775.1|423976_424870_-	metal transporter	NA	NA	NA	NA	NA
VDK98778.1|424866_425502_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
VDK98781.1|425604_425904_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98784.1|425857_426046_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98787.1|426032_426557_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98790.1|426655_427861_-	exported protein	NA	NA	NA	NA	NA
VDK98793.1|427931_430202_-	Orn/Arg/Lys decarboxylase	NA	NA	NA	NA	NA
VDK98796.1|430356_430806_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98799.1|431079_431427_+	Mycothiol acetyltransferase	NA	NA	NA	NA	NA
VDK98802.1|431455_431875_+	lyase	NA	NA	NA	NA	NA
VDK98805.1|431902_432325_+	hypothetical protein	NA	NA	NA	NA	NA
VDK98808.1|432332_432896_-	deoxycytidine triphosphate deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
VDK98811.1|432956_434876_-	exported protein	NA	NA	NA	NA	NA
VDK98814.1|434932_435679_-	exported protein	NA	NA	NA	NA	NA
VDK98817.1|435639_436641_-	exported protein	NA	NA	NA	NA	NA
VDK98820.1|436637_438542_-	exported protein	NA	NA	NA	NA	NA
VDK98823.1|438545_439631_-	iron sulfur binding protein	NA	NA	NA	NA	NA
VDK98826.1|439732_440005_+	exported protein	NA	NA	NA	NA	NA
VDK98829.1|440254_442333_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
VDK98831.1|442369_443104_-	rhodanese superfamily protein	NA	NA	NA	NA	NA
VDK98834.1|443164_443980_-	lipoprotein	NA	NA	NA	NA	NA
VDK98837.1|444071_444599_-	lipoprotein	NA	NA	NA	NA	NA
VDK98840.1|445244_445718_+	two-component response regulator	NA	NA	NA	NA	NA
VDK98843.1|445714_446497_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK98846.1|446872_447349_+	bacterioferritin	NA	NA	NA	NA	NA
VDK98849.1|447430_448102_-	exported protein	NA	NA	NA	NA	NA
VDK98852.1|448138_449620_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	39.4	7.0e-08
VDK98855.1|449793_450423_-	LysE family efflux protein	NA	NA	NA	NA	NA
VDK98858.1|451563_451887_-	ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	48.2	1.6e-05
VDK98861.1|452169_452799_+	exported protein	NA	NA	NA	NA	NA
VDK98864.1|452776_453757_+	membrane protein	NA	NA	NA	NA	NA
VDK98867.1|453687_454341_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	1.9e-13
VDK98870.1|454328_454937_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.6e-06
VDK98874.1|455123_455750_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98877.1|455722_456073_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	484849	513534	4108173	tRNA,transposase	Bacillus_virus(50.0%)	32	NA	NA
VDK98961.1|484849_485797_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK98964.1|486027_486357_-	hypothetical protein	NA	NA	NA	NA	NA
VDK98967.1|486311_486956_-	S-adenosylmethionine/S-adenosylhomocysteine transporter	NA	NA	NA	NA	NA
VDK98970.1|487087_487942_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK98973.1|487969_488254_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
VDK98976.1|488364_489747_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
VDK98979.1|489802_490450_+	membrane protein	NA	NA	NA	NA	NA
VDK98982.1|490875_492576_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
VDK98985.1|492666_493920_-	amidase	NA	NA	NA	NA	NA
VDK98988.1|494828_495203_+	Catabolite control protein A	NA	NA	NA	NA	NA
VDK98991.1|495199_496210_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDK98994.1|496211_496898_+	molybdenum ABC transporter permease ModB	NA	NA	NA	NA	NA
VDK98997.1|496885_497035_+	hypothetical protein	NA	NA	NA	NA	NA
VDK99000.1|497046_497880_+	ABC transporter permease	NA	NA	NA	NA	NA
VDK99003.1|497876_498782_+	sulfate/thiosulfate transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	9.8e-21
VDK99006.1|498963_499410_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK99009.1|499396_499837_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK99012.1|499937_500759_+	3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA	NA	NA	NA	NA	NA
VDK99015.1|500864_501905_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
VDK99018.1|501947_503240_+	glycerol-3-phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDK99021.1|503250_504126_+	binding-protein-dependent transport system inner membrane protein	NA	NA	NA	NA	NA
VDK99025.1|504122_504923_+	binding-protein-dependent transport system inner membrane protein	NA	NA	NA	NA	NA
VDK99028.1|504998_505670_-|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDK99031.1|506302_506620_-	hypothetical protein	NA	NA	NA	NA	NA
VDK99034.1|506710_507058_-	hypothetical protein	NA	NA	NA	NA	NA
VDK99037.1|507345_509028_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
VDK99041.1|509526_509721_+	exported protein	NA	NA	NA	NA	NA
VDK99042.1|509782_510412_+	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
VDK99045.1|510492_511686_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
VDK99050.1|511947_512487_+	LysE family efflux protein	NA	NA	NA	NA	NA
VDK99053.1|512585_513107_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK99056.1|513093_513534_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	541352	570818	4108173	transposase	Sphingobium_phage(33.33%)	35	NA	NA
VDK99156.1|541352_541469_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99158.1|541452_542247_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99162.1|542375_542465_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK99165.1|542885_543326_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK99168.1|543322_544732_-	signal recognition particle protein	NA	NA	NA	NA	NA
VDK99171.1|544837_545680_+	membrane protein	NA	NA	NA	NA	NA
VDK99174.1|545681_545933_+	exported protein	NA	NA	NA	NA	NA
VDK99177.1|546021_546603_+	N-acetylmuramoyl-L-alanine amidas	NA	A0A1W6DX33	Sphingobium_phage	54.3	1.7e-05
VDK99180.1|546634_547255_+	glutathione S-transferase	NA	NA	NA	NA	NA
VDK99183.1|547416_549324_-	chaperone protein HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.2	1.1e-117
VDK99186.1|550516_550819_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99189.1|550924_551236_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99192.1|551177_551879_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99195.1|552067_552280_+	2-aminobenzenesulfonate 2,3-dioxygenase subunit beta	NA	NA	NA	NA	NA
VDK99198.1|552300_553482_+	exported protein	NA	NA	NA	NA	NA
VDK99201.1|554111_555383_+	integral membrane protein	NA	NA	NA	NA	NA
VDK99204.1|555417_556476_+	oxidoreductase	NA	NA	NA	NA	NA
VDK99207.1|556909_557491_+	Protein/nucleic acid deglycase 2	NA	NA	NA	NA	NA
VDK99210.1|557547_558522_+	exported protein	NA	NA	NA	NA	NA
VDK99213.1|558693_559887_+	hypothetical protein	NA	NA	NA	NA	NA
VDK99216.1|560247_560490_+	DNA-binding protein	NA	NA	NA	NA	NA
VDK99219.1|560489_561716_+	hypothetical protein	NA	NA	NA	NA	NA
VDK99224.1|561862_562396_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDK99227.1|562515_563037_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK99230.1|563023_563464_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK99233.1|563557_564457_+	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDK99236.1|564536_565298_+	glutamate/aspartate transport system permease	NA	NA	NA	NA	NA
VDK99239.1|565294_565984_+	glutamate/aspartate transport system permease	NA	NA	NA	NA	NA
VDK99242.1|566008_566599_+	glutamate/aspartate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
VDK99245.1|566734_567337_+	aspartate/glutamate racemase	NA	NA	NA	NA	NA
VDK99248.1|567394_567709_-	hypothetical protein	NA	NA	NA	NA	NA
VDK99251.1|567731_568457_-	outer membrane porin protein	NA	NA	NA	NA	NA
VDK99254.1|568568_569780_-	muropeptide transporter	NA	NA	NA	NA	NA
VDK99257.1|569867_570218_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99260.1|570296_570818_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	576344	632979	4108173	tRNA,transposase	Synechococcus_phage(12.5%)	55	NA	NA
VDK99287.1|576344_576695_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99290.1|576773_577301_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99293.1|577318_577618_+	hypothetical protein	NA	NA	NA	NA	NA
VDK99296.1|577746_578277_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
VDK99299.1|578286_578682_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
VDK99303.1|578752_579646_-	hypothetical protein	NA	NA	NA	NA	NA
VDK99305.1|579632_580361_-	acyltransferase	NA	NA	NA	NA	NA
VDK99307.1|580364_580904_-	D,D-heptose 1,7-bisphosphate phosphatase	NA	NA	NA	NA	NA
VDK99310.1|580900_583039_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
VDK99313.1|583040_583550_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
VDK99316.1|584199_585426_+	transporter	NA	NA	NA	NA	NA
VDK99319.1|585385_585814_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99322.1|585810_586098_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99324.1|586492_587914_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
VDK99326.1|587956_588784_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
VDK99328.1|588957_589893_+	transcriptional regulator	NA	NA	NA	NA	NA
VDK99330.1|590100_590598_+	MaoC family protein	NA	NA	NA	NA	NA
VDK99333.1|590609_591821_+	thiolase	NA	NA	NA	NA	NA
VDK99336.1|591859_592288_+	hypothetical protein	NA	NA	NA	NA	NA
VDK99339.1|592347_592647_+	racemase	NA	NA	NA	NA	NA
VDK99342.1|592728_592818_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK99345.1|593249_593681_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK99348.1|593677_594388_-	two-component response regulator	NA	NA	NA	NA	NA
VDK99351.1|594762_595278_+	two component response regulator	NA	NA	NA	NA	NA
VDK99354.1|595220_595487_+	two-component response regulator	NA	NA	NA	NA	NA
VDK99357.1|595504_595756_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
VDK99360.1|595752_596610_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
VDK99363.1|596678_598694_+	Alginate biosynthesis sensor protein KinB	NA	NA	NA	NA	NA
VDK99366.1|599015_600086_-	membrane protein	NA	NA	NA	NA	NA
VDK99369.1|600566_600839_+	lipoprotein	NA	NA	NA	NA	NA
VDK99372.1|600947_605192_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	24.7	3.5e-68
VDK99375.1|605191_609304_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.8	2.4e-21
VDK99378.1|609463_609805_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
VDK99381.1|609928_610453_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
VDK99384.1|610695_611394_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
VDK99387.1|611396_611828_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
VDK99390.1|611891_612425_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.5	1.4e-11
VDK99395.1|612434_612716_-	protein translocase subunit SecE	NA	NA	NA	NA	NA
VDK99398.1|613053_614244_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	29.2	3.1e-14
VDK99401.1|614839_615022_-	putative L-asparaginase	NA	NA	NA	NA	NA
VDK99404.1|615055_615841_-	putative L-asparaginase	NA	NA	NA	NA	NA
VDK99407.1|615833_616751_-	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	38.1	1.9e-16
VDK99410.1|616794_617556_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
VDK99413.1|617562_618360_-	ParA family protein	NA	Q8JL10	Natrialba_phage	34.9	5.6e-20
VDK99416.1|618356_619049_-	rRNA small subunit methyltransferase G	NA	NA	NA	NA	NA
VDK99419.1|619045_620965_-|tRNA	tRNA uridine 5-carboxymethylaminomethyl modification protein	tRNA	NA	NA	NA	NA
VDK99422.1|622689_622896_-	cold shock-like protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	60.9	2.4e-15
VDK99425.1|623295_624462_+	aminotransferase	NA	NA	NA	NA	NA
VDK99428.1|624537_626061_-	membrane protein	NA	NA	NA	NA	NA
VDK99431.1|626057_626495_-	membrane protein	NA	NA	NA	NA	NA
VDK99434.1|626599_627604_-	exported protein	NA	NA	NA	NA	NA
VDK99437.1|627606_628368_+	hypothetical protein	NA	NA	NA	NA	NA
VDK99440.1|629172_629853_-	response regulator protein	NA	NA	NA	NA	NA
VDK99443.1|630600_631425_+	membrane protein	NA	NA	NA	NA	NA
VDK99446.1|631626_632979_-|tRNA	tRNA modification GTPase	tRNA	NA	NA	NA	NA
>prophage 10
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	645357	695378	4108173	transposase	Planktothrix_phage(50.0%)	51	NA	NA
VDK99484.1|645357_646308_+|transposase	transposase	transposase	NA	NA	NA	NA
VDK99487.1|646267_646774_-	exported protein	NA	NA	NA	NA	NA
VDK99490.1|646854_648045_-	CAIB/BAIF family protein	NA	NA	NA	NA	NA
VDK99492.1|648174_648954_-	enoyl-CoA hydratase/isomerase	NA	NA	NA	NA	NA
VDK99495.1|648950_649934_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
VDK99498.1|650137_650818_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VDK99501.1|650898_651660_-	nitroreductase family protein	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	31.0	2.0e-19
VDK99504.1|651656_652481_-	enoyl-CoA hydratase/isomerase	NA	NA	NA	NA	NA
VDK99507.1|652482_653451_-	lipoprotein	NA	NA	NA	NA	NA
VDK99510.1|653473_654886_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
VDK99513.1|654925_656080_-	CAIB/BAIF family protein	NA	NA	NA	NA	NA
VDK99515.1|656069_656969_-	racemase	NA	NA	NA	NA	NA
VDK99518.1|656980_657934_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99521.1|658033_658987_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99524.1|659169_659943_-	ubiE/COQ5 methyltransferase family protein	NA	NA	NA	NA	NA
VDK99527.1|660032_660842_+	hypothetical protein	NA	NA	NA	NA	NA
VDK99530.1|660852_661929_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
VDK99533.1|663037_664093_-	hypothetical protein	NA	NA	NA	NA	NA
VDK99536.1|664316_665690_+	hypothetical protein	NA	NA	NA	NA	NA
VDK99539.1|665780_666428_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
VDK99541.1|666638_667349_-	cell division protein FtsX	NA	NA	NA	NA	NA
VDK99544.1|667357_667546_-	cell division protein FtsX	NA	NA	NA	NA	NA
VDK99547.1|667542_667968_-	cell division ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	9.3e-14
VDK99550.1|667964_668291_-	cell division ATP-binding protein	NA	NA	NA	NA	NA
VDK99553.1|668530_669547_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.1	1.0e-71
VDK99556.1|669666_670857_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
VDK99559.1|670858_671959_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
VDK99561.1|672013_672754_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	4.4e-35
VDK99564.1|672874_673897_+	exported protein	NA	NA	NA	NA	NA
VDK99567.1|673896_674364_+	membrane protein	NA	NA	NA	NA	NA
VDK99569.1|674382_675909_-	glycerol kinase	NA	NA	NA	NA	NA
VDK99572.1|675895_677281_-	multidrug resistance protein	NA	NA	NA	NA	NA
VDK99575.1|677449_677638_+	hypothetical protein	NA	NA	NA	NA	NA
VDK99578.1|677664_678552_+	Segregation and condensation protein A	NA	NA	NA	NA	NA
VDK99581.1|678595_679438_+	pantothenate synthetase	NA	NA	NA	NA	NA
VDK99584.1|679535_679883_+	regulatory protein	NA	NA	NA	NA	NA
VDK99587.1|679965_680709_-	hypothetical protein	NA	NA	NA	NA	NA
VDK99589.1|680949_681789_+	type 4 prepilin-like proteins leader peptide processing enzyme	NA	NA	NA	NA	NA
VDK99592.1|681797_682442_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
VDK99594.1|682483_683236_+	cell division protein ZapD	NA	NA	NA	NA	NA
VDK99597.1|683416_684667_+	HlyD family secretion protein	NA	NA	NA	NA	NA
VDK99599.1|684663_687606_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
VDK99602.1|687605_687731_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
VDK99605.1|687727_690835_+	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
VDK99608.1|690831_692007_+	outer membrane efflux protein	NA	NA	NA	NA	NA
VDK99611.1|692000_692324_+	outer membrane efflux protein	NA	NA	NA	NA	NA
VDK99614.1|692320_692761_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99617.1|692747_693272_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99620.1|693372_693546_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99623.1|693485_694328_-|transposase	transposase	transposase	NA	NA	NA	NA
VDK99626.1|694523_695378_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	885257	973952	4108173	tRNA,integrase,transposase	uncultured_Mediterranean_phage(10.53%)	97	932701:932718	977348:977365
VDL00449.1|885257_885608_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL00455.1|885604_886249_-	potassium channel	NA	NA	NA	NA	NA
VDL00459.1|886436_886796_-	potassium channel	NA	NA	NA	NA	NA
VDL00463.1|886917_887682_-	Ectoine dioxygenase	NA	NA	NA	NA	NA
VDL00466.1|887768_888872_-	membrane protein	NA	NA	NA	NA	NA
VDL00471.1|889071_889740_-|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL00475.1|889712_890006_-|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL00478.1|890374_890863_+	cytidylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	34.1	1.6e-17
VDL00482.1|890883_891819_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
VDL00486.1|891843_892203_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00490.1|892206_892887_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.8	3.5e-15
VDL00493.1|892948_893800_-	phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
VDL00497.1|893796_894594_-	thiazole synthase	NA	NA	NA	NA	NA
VDL00501.1|894697_895591_-	cobalmin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL00505.1|895602_897492_-	outer membrane protein	NA	A0A0P0I887	Acinetobacter_phage	30.8	7.6e-07
VDL00509.1|897828_901602_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	50.8	8.6e-10
VDL00513.1|901598_902069_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL00517.1|902065_902551_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL00519.1|902705_902846_+	hypothetical protein	NA	NA	NA	NA	NA
VDL00523.1|902859_903552_-	3,4-dihydroxy-2-butanone 4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
VDL00527.1|903925_904426_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00531.1|904532_905453_+	membrane protein	NA	NA	NA	NA	NA
VDL00535.1|905469_905946_-	AsnC family transcription regulator	NA	NA	NA	NA	NA
VDL00539.1|906048_907890_+	acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
VDL00543.1|907942_908701_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
VDL00548.1|908728_910162_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
VDL00552.1|910235_911015_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
VDL00556.1|911027_911861_-	ABC transporter permease	NA	NA	NA	NA	NA
VDL00560.1|911869_912640_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
VDL00565.1|912639_913704_-	exported protein	NA	NA	NA	NA	NA
VDL00569.1|913855_916486_-	DNA topoisomerase III	NA	J3E777	Acanthamoeba_polyphaga_lentillevirus	25.8	8.0e-23
VDL00573.1|916549_917812_+	membrane protein	NA	NA	NA	NA	NA
VDL00577.1|917978_918194_+	membrane protein	NA	NA	NA	NA	NA
VDL00581.1|918199_919168_+	membrane protein	NA	NA	NA	NA	NA
VDL00585.1|919154_919679_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
VDL00589.1|920095_920554_-	Protein Smg	NA	NA	NA	NA	NA
VDL00593.1|920832_921621_-	heme receptor	NA	NA	NA	NA	NA
VDL00597.1|921755_923303_+	hypothetical protein	NA	NA	NA	NA	NA
VDL00601.1|923271_925296_-	inner membrane protein	NA	NA	NA	NA	NA
VDL00605.1|925419_926382_-	exported protein	NA	NA	NA	NA	NA
VDL00608.1|926593_927733_+	low-specificity D-threonine aldolase	NA	NA	NA	NA	NA
VDL00612.1|927755_928721_-	exported protein	NA	NA	NA	NA	NA
VDL00617.1|928916_930107_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
VDL00621.1|930120_930366_+	hypothetical protein	NA	NA	NA	NA	NA
VDL00625.1|930394_932416_-	biotin carboxylase	NA	NA	NA	NA	NA
VDL00629.1|932462_934070_-	carboxyltransferase subunit of acetyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
932701:932718	attL	ACGGTGGCCAGCACGCTG	NA	NA	NA	NA
VDL00633.1|934170_935340_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
VDL00637.1|935387_935969_-	Isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
VDL00641.1|936002_937247_-	Isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
VDL00645.1|937285_938158_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL00649.1|938221_938848_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL00653.1|938820_939171_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL00657.1|939194_939665_-	metallo-beta-lactamase family protein	NA	NA	NA	NA	NA
VDL00659.1|939604_940252_-	metallo-beta-lactamase family protein	NA	NA	NA	NA	NA
VDL00664.1|940326_940701_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VDL00668.1|940914_941259_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL00673.1|941255_942209_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL00677.1|942301_943672_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00681.1|943765_944611_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VDL00685.1|944698_945862_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
VDL00690.1|946280_946562_-	exported protein	NA	NA	NA	NA	NA
VDL00694.1|946512_947250_-	exported protein	NA	NA	NA	NA	NA
VDL00697.1|947288_948716_-	amidase	NA	NA	NA	NA	NA
VDL00701.1|948835_949627_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL00705.1|949745_952199_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
VDL00709.1|952293_953403_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
VDL00712.1|953405_954815_-	chromosomal replication initiation protein DnaA	NA	NA	NA	NA	NA
VDL00716.1|955220_955355_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
VDL00720.1|955450_955822_+	ribonuclease P protein component	NA	NA	NA	NA	NA
VDL00724.1|955818_956091_+	membrane protein insertion efficiency factor	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
VDL00728.1|956139_957831_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
VDL00732.1|958061_959015_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL00736.1|959096_959351_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
VDL00742.1|959472_960396_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL00746.1|960404_960680_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00750.1|960714_960804_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00754.1|961045_962863_+	hypothetical protein	NA	NA	NA	NA	NA
VDL00758.1|962886_963015_+	hypothetical protein	NA	NA	NA	NA	NA
VDL00762.1|963003_964317_-	sensor kinase	NA	NA	NA	NA	NA
VDL00766.1|964500_965490_+|integrase	integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
VDL00769.1|965486_965687_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00773.1|965687_965807_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00777.1|965799_966162_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	47.9	1.8e-13
VDL00781.1|966151_967336_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
VDL00783.1|967372_967900_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00787.1|967957_968605_-	phage-related exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
VDL00791.1|968601_969588_-	phage-related DNA recombination protein	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
VDL00796.1|969591_969774_-	phage-related membrane protein	NA	NA	NA	NA	NA
VDL00800.1|969770_970148_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00804.1|970150_970342_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00807.1|970382_970850_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
VDL00811.1|970885_971326_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL00815.1|971312_971840_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL00822.1|971938_972181_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00826.1|972347_972989_-	hypothetical protein	NA	NA	NA	NA	NA
VDL00830.1|972999_973350_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL00834.1|973322_973952_-|transposase	transposase	transposase	NA	NA	NA	NA
977348:977365	attR	ACGGTGGCCAGCACGCTG	NA	NA	NA	NA
>prophage 12
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	994119	1023054	4108173	tRNA,transposase	Chrysochromulina_ericina_virus(12.5%)	37	NA	NA
VDL00911.1|994119_994470_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL00915.1|994442_995069_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL00918.1|995187_996168_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.3	9.9e-27
VDL00923.1|996127_997165_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.0e-22
VDL00927.1|997140_997368_-	ornithine aminotransferase	NA	NA	NA	NA	NA
VDL00931.1|997529_998051_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL00934.1|998037_998478_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL00938.1|998474_999149_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL00943.1|999233_1000229_-	exported protein	NA	NA	NA	NA	NA
VDL00949.1|1000384_1001605_-	Gamma-glutamylputrescine oxidoreductase	NA	NA	NA	NA	NA
VDL00953.1|1001841_1002117_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
VDL00957.1|1002223_1003543_+	ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
VDL00961.1|1003613_1004156_-	bacterioferritin	NA	NA	NA	NA	NA
VDL00965.1|1004363_1004951_+	lysine decarboxylase	NA	A0A2I2L3F0	Orpheovirus	23.3	1.1e-07
VDL00969.1|1004957_1005560_+	hypothetical protein	NA	NA	NA	NA	NA
VDL00973.1|1005556_1006213_+	haloacid dehalogenase	NA	NA	NA	NA	NA
VDL00976.1|1006209_1006836_+	hypothetical protein	NA	NA	NA	NA	NA
VDL00981.1|1006858_1007797_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-09
VDL00985.1|1007862_1008813_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL00989.1|1008911_1009424_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.3	8.5e-22
VDL00993.1|1009525_1010500_-	kynureninase	NA	NA	NA	NA	NA
VDL00997.1|1010862_1011396_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
VDL01001.1|1011496_1012531_+	DNA processing protein DprA	NA	S6BFL3	Thermus_phage	35.0	1.7e-21
VDL01005.1|1012512_1012608_+	hypothetical protein	NA	NA	NA	NA	NA
VDL01010.1|1012721_1013630_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
VDL01014.1|1013772_1014249_+	membrane protein	NA	NA	NA	NA	NA
VDL01018.1|1014283_1015300_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	43.8	3.5e-75
VDL01022.1|1015413_1016655_-	aminotransferase	NA	A0A1X9I5H2	Streptococcus_phage	24.9	1.9e-14
VDL01026.1|1017262_1017631_+	Pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
VDL01030.1|1017788_1018754_+	exported protein	NA	NA	NA	NA	NA
VDL01034.1|1018800_1019292_-	exported protein	NA	NA	NA	NA	NA
VDL01036.1|1019387_1020287_-	chromosome replication initiation inhibitor protein	NA	NA	NA	NA	NA
VDL01040.1|1020352_1021051_+	transporter	NA	NA	NA	NA	NA
VDL01044.1|1021047_1022001_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL01048.1|1022100_1022541_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL01052.1|1022527_1022884_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL01056.1|1022964_1023054_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	1247146	1303590	4108173	transposase,tRNA,integrase	Pandoravirus(14.29%)	60	1240203:1240223	1302516:1302536
1240203:1240223	attL	GACGAGCAGGTCGGCCGGCAC	NA	NA	NA	NA
VDL02006.1|1247146_1247536_-|integrase	integrase	integrase	NA	NA	NA	NA
VDL02010.1|1247613_1248057_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL02014.1|1248375_1248534_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02018.1|1248533_1248623_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02022.1|1248659_1249793_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02026.1|1249891_1250845_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02028.1|1250824_1251958_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL02033.1|1252067_1252970_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL02037.1|1252971_1253826_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
VDL02041.1|1253872_1254982_-	exported protein	NA	NA	NA	NA	NA
VDL02045.1|1254992_1255508_-	monooxygenase component	NA	NA	NA	NA	NA
VDL02049.1|1255537_1256170_-	pyridoxine/pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
VDL02054.1|1256241_1256901_-	Glutathione-specific gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
VDL02058.1|1256897_1258037_-	inner membrane efflux protein	NA	NA	NA	NA	NA
VDL02062.1|1258395_1259259_+	adenylyltransferase	NA	NA	NA	NA	NA
VDL02066.1|1259414_1260152_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL02070.1|1260154_1261750_-	fatty acid CoA ligase	NA	NA	NA	NA	NA
VDL02074.1|1261881_1262871_+	membrane protein	NA	NA	NA	NA	NA
VDL02078.1|1262867_1263578_+	oxidoreductase	NA	NA	NA	NA	NA
VDL02081.1|1264357_1264609_-|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL02084.1|1264967_1265594_-	putative branched-chain-amino-acid aminotransferase	NA	NA	NA	NA	NA
VDL02088.1|1265649_1266777_-	aminodeoxychorismate synthase subunit I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
VDL02093.1|1266782_1272500_-	excinuclease ABC subunit	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
VDL02097.1|1272870_1272999_+	exported protein	NA	NA	NA	NA	NA
VDL02101.1|1273067_1274012_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
VDL02105.1|1274200_1275136_+	glycosyl transferase family protein	NA	NA	NA	NA	NA
VDL02109.1|1275253_1276825_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL02113.1|1276903_1278112_+	transport system permease	NA	NA	NA	NA	NA
VDL02117.1|1277981_1278497_-	hypothetical protein	NA	NA	NA	NA	NA
VDL02121.1|1278609_1279527_+	membrane protein	NA	NA	NA	NA	NA
VDL02125.1|1280141_1281242_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	3.9e-32
VDL02129.1|1281262_1281745_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02133.1|1281887_1282109_+	osmotically inducible lipoprotein B	NA	NA	NA	NA	NA
VDL02137.1|1282526_1282775_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL02141.1|1282791_1283382_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL02144.1|1283543_1283795_-	cell division topological specificity factor	NA	NA	NA	NA	NA
VDL02147.1|1283798_1284614_-	septum site-determining protein	NA	NA	NA	NA	NA
VDL02151.1|1284726_1285605_-	septum site-determining protein	NA	NA	NA	NA	NA
VDL02154.1|1285716_1287480_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
VDL02158.1|1287595_1288060_+	transmembrane cytochrome oxidase	NA	NA	NA	NA	NA
VDL02162.1|1288010_1288934_+	transmembrane cytochrome oxidase	NA	NA	NA	NA	NA
VDL02166.1|1289210_1289990_+	cytochrome oxidase	NA	NA	NA	NA	NA
VDL02173.1|1290006_1291431_-	two-component sensor kinase	NA	NA	NA	NA	NA
VDL02176.1|1291430_1292132_-	two component response regulator	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
VDL02180.1|1292325_1293225_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02184.1|1293239_1293554_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02188.1|1293635_1294262_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02192.1|1294234_1294585_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02195.1|1294671_1295652_+	exported protein	NA	NA	NA	NA	NA
VDL02199.1|1295656_1296337_-	membrane protein	NA	NA	NA	NA	NA
VDL02203.1|1296474_1296867_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02207.1|1297213_1297639_-|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL02211.1|1297611_1297905_-|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL02215.1|1298234_1299020_-	enoyl-ACP reductase	NA	NA	NA	NA	NA
VDL02219.1|1299114_1300524_-	membrane-bound lytic murein transglycosylase D	NA	NA	NA	NA	NA
VDL02224.1|1300534_1301305_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
VDL02227.1|1301357_1302128_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02230.1|1302170_1302638_+	ribonuclease H	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
1302516:1302536	attR	GACGAGCAGGTCGGCCGGCAC	NA	NA	NA	NA
VDL02234.1|1302634_1302985_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL02238.1|1302957_1303590_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	1390893	1459763	4108173	transposase,protease,integrase,tRNA	Tupanvirus(20.0%)	69	1393569:1393587	1413456:1413474
VDL02577.1|1390893_1392753_+|protease	Beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
VDL02581.1|1392749_1393349_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
VDL02585.1|1393397_1394297_+	4-diphosphocytidyl-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
1393569:1393587	attL	CTGCCTGGCGTGGCCGAGT	NA	NA	NA	NA
VDL02589.1|1394505_1395456_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.5	7.3e-43
VDL02593.1|1395578_1396193_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
VDL02597.1|1396270_1396918_+|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
VDL02601.1|1396923_1397697_+	membrane protein	NA	NA	NA	NA	NA
VDL02604.1|1397769_1398861_+	GTP-binding protein	NA	NA	NA	NA	NA
VDL02608.1|1399140_1400268_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	33.6	1.4e-48
VDL02612.1|1400609_1401656_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02617.1|1401803_1402811_+	restriction endonuclease	NA	NA	NA	NA	NA
VDL02621.1|1402921_1404136_+	restriction endonuclease	NA	NA	NA	NA	NA
VDL02624.1|1404135_1404921_+	restriction endonuclease	NA	NA	NA	NA	NA
VDL02628.1|1404922_1407874_+	modification methylase	NA	G8I4P9	Mycobacterium_phage	25.1	2.9e-21
VDL02632.1|1407889_1409101_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
VDL02636.1|1409284_1409983_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02640.1|1409924_1410236_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02644.1|1410600_1410747_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02648.1|1410750_1411008_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02652.1|1411032_1412463_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02656.1|1412559_1412829_+	ATP-dependent DNA helicase	NA	A0A1V0SIN4	Klosneuvirus	34.1	6.5e-05
VDL02660.1|1412907_1413609_-	hypothetical protein	NA	NA	NA	NA	NA
1413456:1413474	attR	ACTCGGCCACGCCAGGCAG	NA	NA	NA	NA
VDL02664.1|1413612_1414053_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL02668.1|1414983_1417548_-	autotransporter	NA	NA	NA	NA	NA
VDL02672.1|1417592_1419440_-	autotransporter	NA	NA	NA	NA	NA
VDL02676.1|1419772_1421344_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02680.1|1421394_1421898_-	exported protein	NA	NA	NA	NA	NA
VDL02684.1|1421913_1422399_-	exported protein	NA	NA	NA	NA	NA
VDL02688.1|1422783_1423308_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02692.1|1423264_1423735_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02696.1|1423820_1424561_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VDL02700.1|1424787_1425729_-	hypothetical protein	NA	NA	NA	NA	NA
VDL02704.1|1426377_1427127_+	membrane protein	NA	NA	NA	NA	NA
VDL02708.1|1427123_1427558_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL02712.1|1427554_1428082_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL02716.1|1428275_1429091_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VDL02720.1|1429223_1430663_+	Gamma-glutamylputrescine oxidoreductase	NA	NA	NA	NA	NA
VDL02722.1|1430676_1431018_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02726.1|1431072_1432728_+	gamma-glutamyltranspeptidase	NA	NA	NA	NA	NA
VDL02730.1|1432879_1433971_+	exported protein	NA	NA	NA	NA	NA
VDL02734.1|1434023_1434797_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL02738.1|1434871_1435243_+	amino acid efflux protein	NA	NA	NA	NA	NA
VDL02742.1|1435324_1435849_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02747.1|1435835_1436276_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02751.1|1436366_1436795_+	regulatory protein	NA	NA	NA	NA	NA
VDL02755.1|1436791_1438228_+	ferric siderophore receptor	NA	NA	NA	NA	NA
VDL02759.1|1438566_1438932_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02763.1|1438947_1439427_+	membrane protein	NA	NA	NA	NA	NA
VDL02766.1|1439578_1439878_+	exported protein	NA	NA	NA	NA	NA
VDL02769.1|1439923_1440046_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02773.1|1440137_1440719_-	hypothetical protein	NA	NA	NA	NA	NA
VDL02777.1|1440809_1441691_+	hydrolase	NA	NA	NA	NA	NA
VDL02781.1|1441826_1442582_+	molybdate ABC transporter substrate-binding protein ModA	NA	NA	NA	NA	NA
VDL02785.1|1442603_1443284_+	molybdenum ABC transporter permease ModB	NA	NA	NA	NA	NA
VDL02789.1|1443295_1444405_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.5	7.5e-23
VDL02793.1|1444411_1446094_-	phospholipase D	NA	NA	NA	NA	NA
VDL02797.1|1446201_1446642_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL02801.1|1446670_1447156_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL02805.1|1447294_1448047_+	uracil-DNA glycosylase	NA	A0A1Y0B680	Bovine_alphaherpesvirus	47.5	2.5e-46
VDL02809.1|1448321_1450094_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.7e-48
VDL02813.1|1450099_1451290_+	hypothetical protein	NA	NA	NA	NA	NA
VDL02816.1|1451304_1452399_-|tRNA	tRNA CCA-pyrophosphorylase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.5	2.4e-50
VDL02840.1|1452395_1454522_-	transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	36.6	5.5e-14
VDL02844.1|1454534_1455215_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
VDL02847.1|1455450_1456866_+	integral membrane transport protein	NA	NA	NA	NA	NA
VDL02850.1|1456867_1457806_+	aminohydrolase	NA	A0A2K9L473	Tupanvirus	34.1	2.2e-15
VDL02854.1|1457949_1458921_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL02858.1|1458985_1459426_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL02862.1|1459412_1459763_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	1479633	1543469	4108173	protease,transposase	Erwinia_phage(33.33%)	59	NA	NA
VDL02949.1|1479633_1480173_+|protease	ATP-dependent protease subunit HsIV	protease	NA	NA	NA	NA
VDL02954.1|1480194_1481529_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.6	3.5e-43
VDL02958.1|1481542_1481848_-	exported protein	NA	NA	NA	NA	NA
VDL02962.1|1482272_1482854_+	Cobalamin adenosyltransferase	NA	NA	NA	NA	NA
VDL02966.1|1482935_1483565_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02970.1|1483537_1483888_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02974.1|1484279_1484510_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02977.1|1484496_1484937_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL02982.1|1484975_1485329_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
VDL02985.1|1485377_1486211_-	oxidoreductase	NA	NA	NA	NA	NA
VDL02989.1|1486338_1487943_-	gamma-glutamyltranspeptidase	NA	NA	NA	NA	NA
VDL02993.1|1488199_1489705_-	membrane protein	NA	NA	NA	NA	NA
VDL02997.1|1489719_1490184_-	membrane protein	NA	NA	NA	NA	NA
VDL03001.1|1490473_1490914_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03006.1|1491524_1491641_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03010.1|1491848_1492475_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03014.1|1492721_1493168_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03018.1|1493167_1493479_+	Cell division protein ZapA	NA	NA	NA	NA	NA
VDL03022.1|1493923_1494361_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03026.1|1494347_1494872_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03030.1|1495032_1495605_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03034.1|1495579_1496368_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
VDL03038.1|1496707_1498048_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
VDL03042.1|1498161_1498494_+	cytochrome c-552	NA	NA	NA	NA	NA
VDL03046.1|1498517_1499078_+	methionine sulfoxide reductase A	NA	NA	NA	NA	NA
VDL03050.1|1499145_1500258_-	hemolysin	NA	NA	NA	NA	NA
VDL03054.1|1500425_1500887_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
VDL03058.1|1507648_1508014_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03062.1|1508342_1508621_-	hypothetical protein	NA	NA	NA	NA	NA
VDL03066.1|1508770_1509964_+	hydrolase	NA	NA	NA	NA	NA
VDL03069.1|1509975_1511040_+	dihydroorotase	NA	NA	NA	NA	NA
VDL03073.1|1511079_1513128_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	29.1	1.0e-41
VDL03077.1|1513767_1514118_+	cell division protein MraZ	NA	NA	NA	NA	NA
VDL03081.1|1514102_1514420_-	hypothetical protein	NA	NA	NA	NA	NA
VDL03085.1|1514898_1515219_+	rRNA small subunit methyltransferase H	NA	NA	NA	NA	NA
VDL03087.1|1515218_1515497_+	cell division protein FtsL	NA	NA	NA	NA	NA
VDL03090.1|1515493_1517224_+	peptidoglycan synthetase	NA	NA	NA	NA	NA
VDL03094.1|1517220_1520058_+	bifunctional UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase/UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase	NA	NA	NA	NA	NA
VDL03098.1|1520047_1521217_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
VDL03102.1|1521213_1522746_+	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	NA	NA	NA	NA
VDL03106.1|1522742_1523936_+	lipid II flippase FtsW	NA	NA	NA	NA	NA
VDL03110.1|1523932_1525012_+	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
VDL03114.1|1525008_1526415_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
VDL03118.1|1526411_1527362_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
VDL03122.1|1527374_1528196_+	cell division protein FtsQ	NA	NA	NA	NA	NA
VDL03126.1|1528200_1529427_+	cell division protein FtsA	NA	NA	NA	NA	NA
VDL03130.1|1529615_1530800_+	cell division protein FtsZ	NA	NA	NA	NA	NA
VDL03135.1|1531028_1531952_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
VDL03139.1|1532599_1533586_+	M23/M37 family peptidase	NA	A0A292GJG6	Xanthomonas_phage	51.8	3.4e-27
VDL03143.1|1533765_1536501_+	protein translocase subunit SecA	NA	NA	NA	NA	NA
VDL03146.1|1536517_1537186_+	dioxygenase	NA	NA	NA	NA	NA
VDL03150.1|1537415_1538405_+	membrane protein	NA	NA	NA	NA	NA
VDL03153.1|1538414_1538969_-	3-mercaptopropionate dioxygenase	NA	NA	NA	NA	NA
VDL03157.1|1539083_1539896_+	oxidoreductase	NA	NA	NA	NA	NA
VDL03161.1|1539951_1541208_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
VDL03166.1|1541225_1541684_+	glutamate uptake regulatory protein	NA	NA	NA	NA	NA
VDL03170.1|1541863_1542472_+	Glutathione-specific gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
VDL03174.1|1542468_1543017_-	lipid A palmitoyltransferase	NA	NA	NA	NA	NA
VDL03178.1|1543025_1543469_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	1572999	1605808	4108173	tRNA,transposase,protease	Chrysochromulina_ericina_virus(16.67%)	35	NA	NA
VDL03292.1|1572999_1574481_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
VDL03298.1|1574541_1574811_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03302.1|1575304_1576999_+	Protein lysine acetyltransferase Pka	NA	NA	NA	NA	NA
VDL03306.1|1576995_1577946_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03310.1|1578044_1578719_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDL03316.1|1579015_1580512_+	integral membrane protein	NA	NA	NA	NA	NA
VDL03320.1|1580628_1582053_+	ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	33.5	4.8e-54
VDL03324.1|1582123_1582513_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03328.1|1582524_1583217_-	hydrolase	NA	NA	NA	NA	NA
VDL03332.1|1583231_1584068_-	ABC transporter permease	NA	NA	NA	NA	NA
VDL03337.1|1584070_1584880_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	2.6e-33
VDL03341.1|1584876_1585488_-	hypothetical protein	NA	NA	NA	NA	NA
VDL03345.1|1585547_1585895_-	hypothetical protein	NA	NA	NA	NA	NA
VDL03349.1|1586136_1586811_-	carboxylesterase	NA	NA	NA	NA	NA
VDL03352.1|1586824_1587376_-	hypothetical protein	NA	NA	NA	NA	NA
VDL03356.1|1587434_1588799_+|protease	Metalloprotease PmbA	protease	NA	NA	NA	NA
VDL03360.1|1589140_1590238_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL03364.1|1590533_1590962_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
VDL03367.1|1590971_1591364_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
VDL03371.1|1591556_1592621_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
VDL03375.1|1592657_1593404_+	integral membrane protein	NA	NA	NA	NA	NA
VDL03377.1|1593491_1593863_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	56.9	4.7e-30
VDL03380.1|1593932_1595069_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
VDL03384.1|1595074_1596490_-	M23/M37 family peptidase	NA	A8ATH6	Listeria_phage	46.9	1.9e-18
VDL03388.1|1596581_1596932_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03392.1|1596904_1597534_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03396.1|1597801_1599031_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
VDL03400.1|1599066_1599723_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03405.1|1599934_1601182_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.7	1.1e-99
VDL03406.1|1601339_1601822_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
VDL03411.1|1601834_1602245_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VDL03415.1|1602816_1603380_-	hypothetical protein	NA	NA	NA	NA	NA
VDL03421.1|1603618_1604710_+	riboflavin-specific deaminase	NA	A0A1V0SE20	Indivirus	34.0	3.1e-37
VDL03424.1|1604855_1604972_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03428.1|1605283_1605808_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	1636827	1749396	4108173	protease,integrase,transposase,tRNA	Bacillus_virus(15.38%)	113	1718767:1718789	1749471:1749493
VDL03563.1|1636827_1637454_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03567.1|1637426_1637777_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03571.1|1637875_1638247_-	DNA-binding protein	NA	NA	NA	NA	NA
VDL03575.1|1638428_1639202_+	hydrolase	NA	NA	NA	NA	NA
VDL03579.1|1639280_1640672_+|protease	Metalloprotease TldD	protease	NA	NA	NA	NA
VDL03583.1|1640929_1642003_+	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A2I6UFP9	Klebsiella_phage	46.4	3.9e-77
VDL03587.1|1642024_1654678_-	adhesin	NA	A0A0R6PJK4	Moraxella_phage	30.5	1.2e-15
VDL03591.1|1654807_1656217_+	oxidoreductase	NA	NA	NA	NA	NA
VDL03595.1|1656351_1657851_+	glycolate oxidase subunit	NA	NA	NA	NA	NA
VDL03599.1|1657862_1658972_+	glycolate oxidase FAD binding subunit	NA	NA	NA	NA	NA
VDL03603.1|1659004_1660234_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
VDL03607.1|1660224_1661136_-	exported protein	NA	NA	NA	NA	NA
VDL03611.1|1661138_1663352_-	ferric enterobactin receptor	NA	NA	NA	NA	NA
VDL03617.1|1664128_1664539_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL03621.1|1664582_1666019_-	NAD(P) transhydrogenase subunit beta	NA	NA	NA	NA	NA
VDL03625.1|1666015_1666138_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
VDL03629.1|1666335_1667454_-	NAD(P) transhydrogenase subunit alpha part 1	NA	NA	NA	NA	NA
VDL03633.1|1667708_1668584_-	hydrolase	NA	NA	NA	NA	NA
VDL03637.1|1668640_1669627_-	exported protein	NA	NA	NA	NA	NA
VDL03641.1|1669797_1670718_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.5	2.7e-26
VDL03643.1|1670772_1671846_+|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
VDL03649.1|1671946_1672765_+	integral membrane protein	NA	NA	NA	NA	NA
VDL03653.1|1672861_1673473_-	stringent starvation protein A	NA	NA	NA	NA	NA
VDL03657.1|1673741_1675010_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.9	5.8e-104
VDL03661.1|1675072_1675531_+	c'cytochrome	NA	NA	NA	NA	NA
VDL03665.1|1675615_1676311_-	integral membrane protein	NA	NA	NA	NA	NA
VDL03669.1|1676372_1676654_-	hypothetical protein	NA	NA	NA	NA	NA
VDL03673.1|1677264_1677969_+	lipoprotein	NA	NA	NA	NA	NA
VDL03678.1|1678013_1679090_+	exported protein	NA	NA	NA	NA	NA
VDL03682.1|1679086_1680037_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03686.1|1680139_1680802_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDL03690.1|1680896_1681067_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03694.1|1681063_1681540_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03698.1|1682422_1683619_+	CAIB/BAIF family protein	NA	NA	NA	NA	NA
VDL03702.1|1683639_1684443_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
VDL03706.1|1684523_1684820_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03711.1|1684850_1685414_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03715.1|1685454_1686312_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL03719.1|1686319_1687069_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	6.2e-29
VDL03723.1|1687090_1687963_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03727.1|1687991_1688771_+	oxidoreductase	NA	NA	NA	NA	NA
VDL03732.1|1688804_1689683_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL03736.1|1689855_1691049_+	binding-protein-dependent transport protein	NA	NA	NA	NA	NA
VDL03740.1|1691053_1691473_+	acetyl-CoA synthetase	NA	NA	NA	NA	NA
VDL03745.1|1691337_1692186_-	hypothetical protein	NA	NA	NA	NA	NA
VDL03749.1|1692256_1692649_+	endoribonuclease	NA	NA	NA	NA	NA
VDL03753.1|1692642_1693503_+	high-affinity branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
VDL03756.1|1693506_1694469_+	branched-chain amino acid ABC transporter permease/ATP-binding protein	NA	NA	NA	NA	NA
VDL03760.1|1694465_1695092_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	40.7	6.2e-06
VDL03764.1|1695058_1695934_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-12
VDL03768.1|1695952_1696804_+	N-ethylmaleimide reductase	NA	NA	NA	NA	NA
VDL03772.1|1696794_1697145_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03776.1|1697117_1697747_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03780.1|1697810_1698086_+	NADPH dehydrogenase	NA	NA	NA	NA	NA
VDL03784.1|1698096_1698966_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL03788.1|1699060_1699732_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03792.1|1699721_1700231_+|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
VDL03796.1|1700227_1701448_+	membrane transport protein	NA	NA	NA	NA	NA
VDL03800.1|1701395_1702298_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL03804.1|1702485_1703091_+	exported protein	NA	NA	NA	NA	NA
VDL03808.1|1703183_1703708_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03812.1|1703694_1704471_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03816.1|1704509_1705883_+	amidase	NA	NA	NA	NA	NA
VDL03820.1|1705921_1706623_-	riboflavin synthase subunit alpha	NA	NA	NA	NA	NA
VDL03824.1|1706921_1707911_+	exported protein	NA	NA	NA	NA	NA
VDL03828.1|1708011_1708473_+	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
VDL03832.1|1708488_1709037_-	3-mercaptopropionate dioxygenase	NA	NA	NA	NA	NA
VDL03836.1|1709178_1710654_-	acid CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	3.0e-35
VDL03840.1|1710759_1711122_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03844.1|1711073_1711850_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03848.1|1711853_1712636_-	ABC transporter permease	NA	NA	NA	NA	NA
VDL03852.1|1712645_1713434_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.0	1.1e-33
VDL03856.1|1713445_1714327_-	exported protein	NA	NA	NA	NA	NA
VDL03860.1|1714326_1714524_-	hypothetical protein	NA	NA	NA	NA	NA
VDL03864.1|1714560_1714995_-	Acyl-coenzyme A thioesterase PaaI	NA	NA	NA	NA	NA
VDL03868.1|1714991_1716002_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
VDL03873.1|1716045_1716972_-	dioxygenase	NA	NA	NA	NA	NA
VDL03877.1|1717257_1717626_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03881.1|1717842_1718364_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03885.1|1718350_1718794_+|transposase	transposase	transposase	NA	NA	NA	NA
1718767:1718789	attL	ATACAACCTATTGAATCTTCACA	NA	NA	NA	NA
VDL03889.1|1718838_1721265_+	cation-transporting ATPase	NA	A0A218MNH6	uncultured_virus	33.8	1.2e-86
VDL03893.1|1721313_1722006_+	putative protein YedJ	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	4.7e-07
VDL03897.1|1722078_1723278_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
VDL03901.1|1723295_1724201_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL03904.1|1724316_1725246_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03908.1|1725271_1726618_+	membrane transport protein	NA	NA	NA	NA	NA
VDL03912.1|1726630_1727395_+	short chain dehydrogenase	NA	A0A0M4JSW6	Mollivirus	26.5	3.1e-12
VDL03916.1|1727408_1728191_+	short chain dehydrogenase	NA	NA	NA	NA	NA
VDL03920.1|1728383_1729010_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03924.1|1728982_1729333_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03928.1|1729394_1730504_-	outer membrane porin protein	NA	NA	NA	NA	NA
VDL03932.1|1730888_1731101_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03936.1|1731016_1731853_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
VDL03940.1|1731979_1732888_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL03945.1|1732884_1733835_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03949.1|1734151_1734763_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03953.1|1735075_1735810_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03957.1|1735796_1736321_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03961.1|1736307_1736748_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03965.1|1737402_1738527_+	hypothetical protein	NA	NA	NA	NA	NA
VDL03968.1|1738720_1739344_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL03975.1|1739661_1740402_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
VDL03979.1|1740562_1741126_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VDL03983.1|1741229_1741751_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03987.1|1741737_1742178_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL03993.1|1742174_1744283_-	exported protein	NA	NA	NA	NA	NA
VDL03997.1|1744427_1745039_-	hydrolase	NA	NA	NA	NA	NA
VDL04000.1|1745118_1745700_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04004.1|1745858_1746044_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04008.1|1746095_1746848_-	DNA-binding protein	NA	NA	NA	NA	NA
VDL04021.1|1746854_1748114_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL04025.1|1748158_1748797_-|integrase	integrase	integrase	NA	NA	NA	NA
VDL04030.1|1748769_1749396_-|transposase	transposase	transposase	NA	NA	NA	NA
1749471:1749493	attR	ATACAACCTATTGAATCTTCACA	NA	NA	NA	NA
>prophage 19
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	1759171	1859254	4108173	tRNA,transposase,protease	Planktothrix_phage(18.18%)	104	NA	NA
VDL04082.1|1759171_1760119_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04086.1|1760078_1761323_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
VDL04090.1|1761403_1761577_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04094.1|1761728_1762358_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04098.1|1762889_1763687_-	lipoprotein	NA	NA	NA	NA	NA
VDL04102.1|1763734_1764388_-	methionine ABC transporter permease	NA	NA	NA	NA	NA
VDL04106.1|1764344_1765433_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
VDL04109.1|1765597_1767823_-	Alpha-xylosidase	NA	NA	NA	NA	NA
VDL04113.1|1768116_1768809_-|tRNA	tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC	tRNA	NA	NA	NA	NA
VDL04116.1|1768754_1769942_-|tRNA	tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC	tRNA	NA	NA	NA	NA
VDL04120.1|1770686_1770998_+	inositol monophosphatase	NA	NA	NA	NA	NA
VDL04124.1|1771118_1771745_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04128.1|1771717_1772068_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04133.1|1772064_1773741_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.3e-33
VDL04137.1|1773817_1775014_+	hydrolase	NA	NA	NA	NA	NA
VDL04141.1|1775027_1775906_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL04145.1|1776012_1777059_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04147.1|1777122_1777533_+	thioesterase	NA	NA	NA	NA	NA
VDL04151.1|1777543_1779016_+	cation transport protein	NA	NA	NA	NA	NA
VDL04155.1|1779211_1779733_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04159.1|1779719_1780073_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04163.1|1780156_1781107_-	iron-sulfur protein	NA	NA	NA	NA	NA
VDL04167.1|1781046_1781307_-	iron-sulfur protein	NA	NA	NA	NA	NA
VDL04171.1|1781615_1782467_-	integral membrane protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	23.5	2.5e-10
VDL04175.1|1782637_1783603_-	exported protein	NA	NA	NA	NA	NA
VDL04179.1|1783738_1784608_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL04183.1|1784694_1784961_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
VDL04187.1|1785194_1785878_+	geranyltranstransferase	NA	NA	NA	NA	NA
VDL04191.1|1785927_1787790_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
VDL04195.1|1787946_1788744_+	GTP cyclohydrolase	NA	NA	NA	NA	NA
VDL04199.1|1788963_1789344_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
VDL04203.1|1789466_1789715_+	primosomal replication protein N	NA	NA	NA	NA	NA
VDL04207.1|1789807_1790080_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
VDL04211.1|1790095_1790551_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
VDL04215.1|1790667_1791504_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04219.1|1791500_1792874_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	58.2	4.0e-135
VDL04223.1|1792894_1793020_-	exported protein	NA	NA	NA	NA	NA
VDL04227.1|1793349_1793778_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04231.1|1793940_1794918_-	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
VDL04235.1|1795022_1796369_-	PhoH-like protein	NA	A0A2I7SAD7	Vibrio_phage	35.8	1.1e-65
VDL04239.1|1796780_1797245_-	bacterioferritin comigratory protein	NA	NA	NA	NA	NA
VDL04243.1|1797247_1797700_-	hypothetical protein	NA	NA	NA	NA	NA
VDL04249.1|1797916_1799104_+	aminotransferase	NA	NA	NA	NA	NA
VDL04253.1|1799100_1800405_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
VDL04257.1|1800401_1801808_+	threonine synthase	NA	NA	NA	NA	NA
VDL04261.1|1802021_1802243_+	lipoprotein	NA	NA	NA	NA	NA
VDL04265.1|1802451_1802712_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04269.1|1802687_1802975_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04273.1|1802961_1803405_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04276.1|1803461_1804574_+	malate dehydrogenase	NA	NA	NA	NA	NA
VDL04280.1|1804622_1805582_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
VDL04284.1|1805581_1806364_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
VDL04288.1|1806409_1806961_+	exported protein	NA	NA	NA	NA	NA
VDL04292.1|1806957_1807398_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04296.1|1807384_1807621_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04300.1|1808018_1808453_+	exported protein	NA	NA	NA	NA	NA
VDL04304.1|1808512_1809280_+	alpha-dehydro-beta-deoxy-D-glucarate aldolase	NA	NA	NA	NA	NA
VDL04308.1|1809397_1809661_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
VDL04312.1|1809799_1810765_-	membrane protein	NA	NA	NA	NA	NA
VDL04316.1|1810965_1812342_-	MurJ-like protein	NA	NA	NA	NA	NA
VDL04320.1|1812422_1812566_-	MurJ-like protein	NA	NA	NA	NA	NA
VDL04324.1|1812591_1813350_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
VDL04328.1|1813441_1814098_-	adenylate kinase	NA	NA	NA	NA	NA
VDL04332.1|1814188_1814953_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
VDL04336.1|1814962_1815151_-	hypothetical protein	NA	NA	NA	NA	NA
VDL04340.1|1815206_1816250_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
VDL04344.1|1816246_1816660_-	biopolymer transport protein	NA	NA	NA	NA	NA
VDL04349.1|1816656_1817277_-	biopolymer transport protein	NA	NA	NA	NA	NA
VDL04354.1|1817557_1818511_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04358.1|1820142_1820721_+	superoxide dismutase	NA	NA	NA	NA	NA
VDL04362.1|1820837_1822235_+	chloride-channel protein	NA	NA	NA	NA	NA
VDL04366.1|1822350_1823556_+	beta-ketoadipyl CoA thiolase	NA	NA	NA	NA	NA
VDL04369.1|1823655_1824147_-	exported protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	4.8e-14
VDL04372.1|1824268_1824514_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
VDL04375.1|1824741_1825056_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
VDL04378.1|1825154_1829357_+	exported protein	NA	NA	NA	NA	NA
VDL04381.1|1829356_1830334_+	exported protein	NA	NA	NA	NA	NA
VDL04384.1|1830330_1832499_+	penicillin-binding protein	NA	NA	NA	NA	NA
VDL04387.1|1832554_1834870_+|protease	ATP-dependent Clp protease ATP-binding protein	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
VDL04390.1|1834997_1836194_+	exported protein	NA	NA	NA	NA	NA
VDL04392.1|1836212_1837886_+	membrane protein	NA	NA	NA	NA	NA
VDL04396.1|1837890_1838559_+	lipoprotein	NA	NA	NA	NA	NA
VDL04398.1|1838715_1842537_+	trifunctional transcriptional regulator/proline dehydrogenase/pyrroline-5-carboxylate dehydrogenase	NA	NA	NA	NA	NA
VDL04401.1|1842867_1843395_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04404.1|1843391_1843709_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04406.1|1843648_1843822_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04409.1|1843843_1844989_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL04411.1|1845137_1846067_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL04414.1|1846063_1847152_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VDL04417.1|1847148_1847952_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
VDL04419.1|1847948_1848680_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
VDL04422.1|1848737_1850027_-	membrane transport protein	NA	NA	NA	NA	NA
VDL04425.1|1850123_1850726_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04428.1|1850964_1851285_+	autotransporter	NA	NA	NA	NA	NA
VDL04430.1|1851835_1853956_+	autotransporter	NA	NA	NA	NA	NA
VDL04433.1|1854018_1854537_-	Ammonia channel	NA	NA	NA	NA	NA
VDL04437.1|1854533_1855259_-	Ammonia channel	NA	NA	NA	NA	NA
VDL04438.1|1855284_1855623_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
VDL04441.1|1856330_1856597_+	putative protein YqiC	NA	NA	NA	NA	NA
VDL04444.1|1856703_1857750_+	chelatase (pseudogene)	NA	NA	NA	NA	NA
VDL04447.1|1857746_1858205_+	chelatase (pseudogene)	NA	NA	NA	NA	NA
VDL04450.1|1858303_1858567_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04453.1|1858596_1858827_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04456.1|1858813_1859254_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	1867279	1915463	4108173	protease,transposase	Streptococcus_phage(20.0%)	54	NA	NA
VDL04483.1|1867279_1867720_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04486.1|1867706_1868231_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04489.1|1868329_1868587_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04492.1|1868758_1869280_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04495.1|1869378_1869813_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04498.1|1869841_1870027_-	hypothetical protein	NA	NA	NA	NA	NA
VDL04502.1|1870386_1872231_+	membrane transport ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	2.5e-124
VDL04505.1|1872509_1872800_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL04508.1|1872772_1873366_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL04511.1|1873632_1874223_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04513.1|1874313_1874619_-	exported protein	NA	NA	NA	NA	NA
VDL04516.1|1875086_1876094_+	biotin synthase	NA	NA	NA	NA	NA
VDL04519.1|1876090_1876966_+	exported protein	NA	NA	NA	NA	NA
VDL04522.1|1877040_1878507_-	membrane transport protein	NA	NA	NA	NA	NA
VDL04526.1|1878518_1879022_-	AhpC/TSA-family protein	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
VDL04529.1|1879266_1879626_+	lipoprotein	NA	NA	NA	NA	NA
VDL04532.1|1879574_1879697_+	lipoprotein	NA	NA	NA	NA	NA
VDL04535.1|1879706_1880591_-	hydrolase	NA	NA	NA	NA	NA
VDL04540.1|1880608_1884070_-	exported protein	NA	NA	NA	NA	NA
VDL04543.1|1884205_1884691_+	cyclic pyranopterin monophosphate synthase accessory protein	NA	NA	NA	NA	NA
VDL04545.1|1884671_1884923_+	molybdopterin converting factor	NA	NA	NA	NA	NA
VDL04548.1|1884928_1885411_+	molybdopterin converting factor	NA	NA	NA	NA	NA
VDL04551.1|1885407_1885929_+	molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
VDL04554.1|1885935_1887141_+	molybdopterin cofactor biosynthesis protein	NA	NA	NA	NA	NA
VDL04558.1|1887285_1888383_-	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
VDL04561.1|1888393_1889500_-	molybdenum-binding protein	NA	NA	NA	NA	NA
VDL04564.1|1889634_1890156_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04567.1|1890142_1890571_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04570.1|1890687_1891272_+	Putative NAD(P)H nitroreductase YdjA	NA	NA	NA	NA	NA
VDL04573.1|1891340_1892762_-	argininosuccinate lyase	NA	NA	NA	NA	NA
VDL04576.1|1892869_1894216_+	membrane transport protein	NA	NA	NA	NA	NA
VDL04579.1|1894253_1895888_+	NAD synthetase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	8.3e-87
VDL04582.1|1895931_1896270_+	nitrogen regulatory protein	NA	NA	NA	NA	NA
VDL04585.1|1896294_1896669_-	endonuclease	NA	F4YXR7	Roseobacter_phage	54.4	2.1e-25
VDL04588.1|1896783_1897128_+	Heat shock protein 15	NA	NA	NA	NA	NA
VDL04591.1|1897244_1898702_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04593.1|1898665_1899181_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04596.1|1899293_1899521_-	hypothetical protein	NA	NA	NA	NA	NA
VDL04599.1|1899783_1900665_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04602.1|1900772_1902401_+	gamma-glutamyltranspeptidase	NA	NA	NA	NA	NA
VDL04604.1|1902442_1903960_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL04606.1|1904054_1904999_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL04608.1|1904995_1905883_+	binding-protein-dependent transport permease	NA	NA	NA	NA	NA
VDL04611.1|1906180_1907083_-	ribosome biogenesis GTPase	NA	NA	NA	NA	NA
VDL04613.1|1907079_1908345_-|protease	integral membrane zinc-metalloprotease	protease	NA	NA	NA	NA
VDL04615.1|1908969_1909656_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
VDL04617.1|1909627_1909864_-	phenylacetic acid degradation operon negative regulatory protein	NA	NA	NA	NA	NA
VDL04620.1|1910726_1911716_+	phenylacetate-CoA oxygenase subunit PaaA	NA	NA	NA	NA	NA
VDL04622.1|1911780_1912065_+	phenylacetate-CoA oxygenase subunit PaaB	NA	NA	NA	NA	NA
VDL04624.1|1912080_1912845_+	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
VDL04627.1|1912841_1913348_+	phenylacetic acid degradation protein	NA	NA	NA	NA	NA
VDL04629.1|1913359_1914523_+	molybdopterin oxidoreductase	NA	V5UTY8	Synechococcus_phage	46.7	5.9e-10
VDL04632.1|1914509_1915031_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04635.1|1915109_1915463_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	1920835	1974615	4108173	tRNA,transposase	Burkholderia_phage(20.0%)	53	NA	NA
VDL04658.1|1920835_1921660_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04661.1|1921783_1922134_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04664.1|1922106_1922739_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04667.1|1922999_1924028_-	exported protein	NA	NA	NA	NA	NA
VDL04670.1|1924106_1925405_-	membrane permease	NA	NA	NA	NA	NA
VDL04673.1|1925401_1925938_-	integral membrane protein	NA	NA	NA	NA	NA
VDL04676.1|1926295_1930342_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	67.4	6.3e-160
VDL04679.1|1930739_1931903_+	adhesin	NA	A0A0R6PJK4	Moraxella_phage	30.9	1.1e-24
VDL04682.1|1931845_1934053_+	adhesin	NA	NA	NA	NA	NA
VDL04685.1|1933992_1935933_+	adhesin	NA	NA	NA	NA	NA
VDL04688.1|1936148_1938248_+	adhesin	NA	NA	NA	NA	NA
VDL04691.1|1938244_1938595_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04694.1|1938567_1939197_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04697.1|1939278_1940340_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
VDL04700.1|1940336_1940810_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04703.1|1940949_1941531_-	transcriptional regulatory protein	NA	NA	NA	NA	NA
VDL04706.1|1941705_1942506_+	aldolase	NA	NA	NA	NA	NA
VDL04709.1|1942560_1943652_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL04712.1|1943673_1944117_-	6-carboxy-5,6,7,8-tetrahydropterin synthase	NA	NA	NA	NA	NA
VDL04715.1|1944145_1944778_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
VDL04718.1|1944888_1945305_+|tRNA	Peptidyl-tRNA hydrolase ArfB	tRNA	NA	NA	NA	NA
VDL04721.1|1945297_1945990_+	membrane protein	NA	NA	NA	NA	NA
VDL04724.1|1946096_1946471_+	exported protein	NA	NA	NA	NA	NA
VDL04727.1|1946547_1947234_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04730.1|1947452_1948397_+	dihydrodipicolinate synthase	NA	NA	NA	NA	NA
VDL04733.1|1948435_1949407_+	exported protein	NA	NA	NA	NA	NA
VDL04736.1|1949497_1949935_-	exported protein	NA	NA	NA	NA	NA
VDL04739.1|1949993_1950797_-	hypothetical protein	NA	NA	NA	NA	NA
VDL04742.1|1951356_1951629_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04745.1|1951878_1952472_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04748.1|1952471_1952756_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04751.1|1952771_1954154_+	FAD-binding dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	28.4	7.9e-30
VDL04754.1|1954192_1955170_+	exported protein	NA	NA	NA	NA	NA
VDL04757.1|1955542_1956037_+	short chain dehydrogenase	NA	NA	NA	NA	NA
VDL04760.1|1956044_1956785_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04763.1|1956865_1958470_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
VDL04766.1|1958509_1959298_-	glycerol-3-phosphate regulon repressor protein	NA	A0A077SK06	Escherichia_phage	30.4	2.0e-22
VDL04769.1|1959423_1961589_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	1.9e-14
VDL04772.1|1961680_1961965_-	hypothetical protein	NA	NA	NA	NA	NA
VDL04775.1|1962054_1962477_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL04778.1|1962469_1963282_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL04781.1|1963294_1963603_+	integral membrane protein	NA	NA	NA	NA	NA
VDL04784.1|1963720_1965451_+	exported protein	NA	NA	NA	NA	NA
VDL04787.1|1965452_1966598_-	lipoprotein	NA	NA	NA	NA	NA
VDL04790.1|1966727_1967039_-	exported protein	NA	NA	NA	NA	NA
VDL04793.1|1967047_1967395_-	exported protein	NA	NA	NA	NA	NA
VDL04796.1|1967516_1967984_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
VDL04799.1|1968119_1969502_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
VDL04802.1|1969498_1970623_+	exonuclease	NA	NA	NA	NA	NA
VDL04805.1|1970619_1972953_+	GTP-binding protein	NA	NA	NA	NA	NA
VDL04808.1|1972952_1973255_+	GTP-binding protein	NA	NA	NA	NA	NA
VDL04811.1|1973325_1973607_-	exported protein	NA	NA	NA	NA	NA
VDL04814.1|1973670_1974615_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	1996297	2032462	4108173	transposase	Salmonella_phage(50.0%)	42	NA	NA
VDL04877.1|1996297_1996648_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04880.1|1996627_1997209_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VDL04883.1|1997269_1998997_-	solute transport protein	NA	NA	NA	NA	NA
VDL04886.1|1999108_2000467_+	Ribonuclease	NA	NA	NA	NA	NA
VDL04888.1|2000759_2001284_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04892.1|2001240_2001711_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04895.1|2001751_2002822_+	membrane protein	NA	NA	NA	NA	NA
VDL04898.1|2003894_2004866_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VDL04900.1|2005028_2005871_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04903.1|2006033_2006714_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04906.1|2006707_2007877_+	L-amino acid dehydrogenase	NA	NA	NA	NA	NA
VDL04910.1|2007873_2008905_+	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
VDL04913.1|2008948_2010190_+	membrane protein	NA	NA	NA	NA	NA
VDL04917.1|2010224_2011427_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04920.1|2011836_2012460_+	regulatory protein	NA	NA	NA	NA	NA
VDL04923.1|2012827_2013103_+	membrane transport protein	NA	NA	NA	NA	NA
VDL04926.1|2013138_2013609_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04929.1|2013781_2013922_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04932.1|2013933_2015040_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
VDL04935.1|2015076_2016591_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL04938.1|2016594_2017554_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL04941.1|2017531_2018386_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL04944.1|2018387_2020022_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
VDL04947.1|2020105_2021167_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
VDL04949.1|2021365_2021635_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04952.1|2021638_2022163_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
VDL04954.1|2022171_2022561_-	hypothetical protein	NA	NA	NA	NA	NA
VDL04957.1|2022578_2022668_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04960.1|2023089_2023527_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04963.1|2023523_2024093_-	integral membrane protein	NA	NA	NA	NA	NA
VDL04966.1|2024035_2024557_-	integral membrane protein	NA	NA	NA	NA	NA
VDL04969.1|2024665_2025304_+	DedA family integral membrane protein	NA	NA	NA	NA	NA
VDL04971.1|2025598_2025826_+	Ribosomal-protein-alanine acetyltransferase	NA	NA	NA	NA	NA
VDL04973.1|2025948_2026662_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04975.1|2026906_2027857_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL04977.1|2027996_2028242_+	hypothetical protein	NA	NA	NA	NA	NA
VDL04980.1|2028356_2029805_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDL04982.1|2029915_2030542_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04985.1|2030659_2030866_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04986.1|2030862_2031312_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
VDL04989.1|2031506_2031992_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL04992.1|2031988_2032462_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2086362	2167413	4108173	protease,transposase,tRNA	Salmonella_phage(16.67%)	84	NA	NA
VDL05119.1|2086362_2086884_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05121.1|2086870_2087311_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05123.1|2087313_2088267_+	exported protein	NA	NA	NA	NA	NA
VDL05125.1|2088294_2089146_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.6	2.1e-33
VDL05127.1|2089151_2090180_-	dehydrogenase	NA	NA	NA	NA	NA
VDL05129.1|2090176_2091151_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL05131.1|2091287_2092277_-	dipeptidase	NA	NA	NA	NA	NA
VDL05133.1|2092594_2093848_+	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
VDL05135.1|2093858_2094131_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
VDL05137.1|2094127_2097067_+	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
VDL05139.1|2097074_2097674_+	sarcosine oxidase subunit gamma	NA	NA	NA	NA	NA
VDL05141.1|2097674_2098523_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
VDL05143.1|2098560_2099547_+	exported protein	NA	NA	NA	NA	NA
VDL05145.1|2099562_2100999_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05147.1|2101011_2101803_+	hydrolase	NA	NA	NA	NA	NA
VDL05149.1|2102121_2103177_+	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
VDL05151.1|2103213_2104023_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
VDL05153.1|2104023_2104572_-	Outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
VDL05155.1|2104704_2105142_+	ferric ion uptake regulator	NA	NA	NA	NA	NA
VDL05157.1|2105216_2106878_-	DNA repair protein	NA	NA	NA	NA	NA
VDL05159.1|2106893_2107793_-	NAD kinase	NA	NA	NA	NA	NA
VDL05161.1|2107907_2108912_+	heat-inducible transcription repressor	NA	NA	NA	NA	NA
VDL05163.1|2108969_2110058_+	ferrochelatase	NA	NA	NA	NA	NA
VDL05165.1|2110139_2110382_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05167.1|2110600_2111077_+	heat shock protein GrpE	NA	NA	NA	NA	NA
VDL05169.1|2111084_2111465_+	thioredoxin	NA	NA	NA	NA	NA
VDL05171.1|2111554_2113480_+	chaperone protein DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.1e-146
VDL05173.1|2113580_2114714_+	chaperone protein DnaJ	NA	A0A1V0SBY2	Catovirus	60.8	3.9e-19
VDL05175.1|2114882_2117633_-|protease	zinc protease	protease	A0A2K9LA15	Tupanvirus	28.1	1.5e-19
VDL05177.1|2117965_2118340_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05179.1|2118514_2118919_+	acetyltransferase	NA	NA	NA	NA	NA
VDL05181.1|2118922_2120095_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05183.1|2120088_2121006_-	ATP-binding protein	NA	NA	NA	NA	NA
VDL05185.1|2121098_2121449_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05187.1|2121421_2122051_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05189.1|2122217_2122571_+	cytochrome	NA	NA	NA	NA	NA
VDL05191.1|2122583_2122946_+	cytochrome	NA	NA	NA	NA	NA
VDL05193.1|2122987_2123413_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05195.1|2123615_2124872_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
VDL05197.1|2125070_2126051_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05199.1|2126200_2127442_+	exported protein	NA	NA	NA	NA	NA
VDL05201.1|2127540_2128167_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05203.1|2128139_2128490_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05205.1|2128498_2129194_-	two component system transcriptional regulatory protein	NA	NA	NA	NA	NA
VDL05207.1|2129238_2130531_-	two component sensor protein	NA	NA	NA	NA	NA
VDL05209.1|2130613_2132173_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05211.1|2132016_2132562_-	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
VDL05213.1|2132624_2134862_-	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
VDL05215.1|2134812_2136597_-	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
VDL05217.1|2136596_2136686_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05219.1|2136682_2136781_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05221.1|2137378_2137651_+	integral membrane protein	NA	NA	NA	NA	NA
VDL05223.1|2137650_2139717_+	membrane transport protein	NA	NA	NA	NA	NA
VDL05225.1|2139713_2140154_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05227.1|2140140_2140668_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05229.1|2140783_2141116_-	mebrane transport protein	NA	NA	NA	NA	NA
VDL05231.1|2141112_2141799_-	putative DNA endonuclease SmrA	NA	NA	NA	NA	NA
VDL05232.1|2141785_2142745_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
VDL05234.1|2142777_2145147_+	cell division protein	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
VDL05236.1|2145146_2145779_+	outer-membrane lipoprotein carrier protein	NA	NA	NA	NA	NA
VDL05238.1|2145880_2147221_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
VDL05240.1|2147267_2148623_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
VDL05242.1|2148900_2149149_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05244.1|2149114_2149267_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05246.1|2149336_2149609_-	virulence protein	NA	NA	NA	NA	NA
VDL05248.1|2149926_2150145_-	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	2.8e-06
VDL05250.1|2150533_2150695_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05252.1|2150710_2151466_-	membrane protein	NA	NA	NA	NA	NA
VDL05254.1|2151804_2152011_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05256.1|2152018_2152678_-	membrane efflux protein	NA	NA	NA	NA	NA
VDL05258.1|2152972_2153440_-	ferric alcaligin siderophore receptor	NA	NA	NA	NA	NA
VDL05260.1|2153561_2155178_-	ferric alcaligin siderophore receptor	NA	NA	NA	NA	NA
VDL05262.1|2155288_2156512_-	drug resistance translocase	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
VDL05264.1|2156634_2157546_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL05266.1|2157675_2158869_-	iron-sulfur protein	NA	NA	NA	NA	NA
VDL05267.1|2158883_2159684_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05269.1|2159680_2161537_-	alcaligin biosynthesis protein	NA	NA	NA	NA	NA
VDL05271.1|2161533_2162139_-	alcaligin biosynthesis protein	NA	NA	NA	NA	NA
VDL05273.1|2162157_2163543_-	alcaligin biosynthesis enzyme	NA	NA	NA	NA	NA
VDL05275.1|2164081_2165494_+	membrane efflux protein	NA	NA	NA	NA	NA
VDL05277.1|2165582_2166365_+	oxidoreductase	NA	NA	NA	NA	NA
VDL05279.1|2166463_2166985_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05281.1|2166971_2167160_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05283.1|2167113_2167413_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2182777	2232927	4108173	protease,transposase	Staphylococcus_phage(22.22%)	53	NA	NA
VDL05326.1|2182777_2184265_+|protease	serine protease	protease	W5SAB9	Pithovirus	31.5	1.2e-07
VDL05328.1|2184395_2186189_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	8.4e-24
VDL05330.1|2186211_2187096_+	signal peptidase I	NA	NA	NA	NA	NA
VDL05332.1|2187101_2187863_+	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.0	3.1e-20
VDL05334.1|2187859_2188750_+	GTP-binding protein Era	NA	NA	NA	NA	NA
VDL05336.1|2188784_2189330_+	DNA repair protein RecO	NA	NA	NA	NA	NA
VDL05338.1|2189349_2190270_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL05340.1|2190266_2191214_-	cysteine synthase B	NA	NA	NA	NA	NA
VDL05342.1|2191259_2192213_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05344.1|2192305_2192419_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05346.1|2192422_2193292_-	N-alpha-acetyl-L-2,4-diaminobutyric acid deacetylase	NA	NA	NA	NA	NA
VDL05348.1|2193408_2194341_-	exported protein	NA	NA	NA	NA	NA
VDL05350.1|2194522_2195233_-	integral membrane protein	NA	NA	NA	NA	NA
VDL05352.1|2195331_2195658_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05354.1|2195688_2196144_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
VDL05356.1|2196161_2196914_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	39.6	4.3e-38
VDL05358.1|2197713_2198826_+	integral membrane protein	NA	NA	NA	NA	NA
VDL05360.1|2198822_2199743_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL05362.1|2199882_2201100_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL05364.1|2201212_2202679_+	oxidoreductase	NA	NA	NA	NA	NA
VDL05366.1|2202778_2203615_+	LysR family transcription regulator	NA	NA	NA	NA	NA
VDL05368.1|2203611_2203731_+	LysR family transcription regulator	NA	NA	NA	NA	NA
VDL05370.1|2203727_2204168_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05372.1|2204154_2204679_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05374.1|2204987_2205329_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05376.1|2205433_2206093_-	lipoprotein	NA	A0A0A8WF62	Clostridium_phage	36.8	3.7e-17
VDL05377.1|2206672_2208217_+	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	32.1	7.4e-61
VDL05378.1|2208213_2208621_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05379.1|2209212_2209956_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05381.1|2210167_2212147_+	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	43.9	6.1e-84
VDL05382.1|2212292_2213183_+	integral membrane protein	NA	NA	NA	NA	NA
VDL05383.1|2213204_2213846_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
VDL05384.1|2213821_2214223_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
VDL05386.1|2214236_2214599_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05387.1|2214595_2215705_-	cytochrome p450 oxidoreductase	NA	NA	NA	NA	NA
VDL05388.1|2215740_2216625_-	Protein YeeZ	NA	NA	NA	NA	NA
VDL05389.1|2216722_2218369_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
VDL05391.1|2218478_2218928_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05392.1|2219031_2219460_+	3-oxoadipate CoA-transferase subunit A	NA	NA	NA	NA	NA
VDL05393.1|2219399_2219729_+	3-oxoadipate CoA-transferase subunit A	NA	NA	NA	NA	NA
VDL05395.1|2220053_2220395_+	coenzyme A transferase subunit	NA	NA	NA	NA	NA
VDL05397.1|2220618_2221503_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL05400.1|2221499_2222480_+	L-asparaginase	NA	NA	NA	NA	NA
VDL05402.1|2222524_2224426_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	6.0e-20
VDL05404.1|2224496_2226050_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL05406.1|2226111_2227032_+	binding-protein-dependent transport permease	NA	NA	NA	NA	NA
VDL05408.1|2227039_2227939_+	binding-protein-dependent transport permease	NA	NA	NA	NA	NA
VDL05410.1|2228034_2229105_+	D-aminopeptidase	NA	NA	NA	NA	NA
VDL05412.1|2229375_2229936_+	D-aminopeptidase	NA	NA	NA	NA	NA
VDL05414.1|2229944_2231744_+	aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	50.6	4.6e-171
VDL05416.1|2231976_2232498_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05418.1|2232484_2232814_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05420.1|2232753_2232927_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2265289	2314364	4108173	transposase	Mycoplasma_phage(20.0%)	51	NA	NA
VDL05487.1|2265289_2265601_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05489.1|2265542_2266244_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05490.1|2266342_2267620_-	inner membrane protein	NA	NA	NA	NA	NA
VDL05492.1|2267660_2268161_-	inner membrane transport protein	NA	NA	NA	NA	NA
VDL05494.1|2268246_2269221_-	C4-dicarboxylate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL05496.1|2269335_2269830_+	inner membrane transport permease	NA	NA	NA	NA	NA
VDL05498.1|2269841_2271878_+	inner membrane transport permease	NA	NA	NA	NA	NA
VDL05500.1|2271877_2272303_+	globin-like protein	NA	NA	NA	NA	NA
VDL05502.1|2272292_2273027_+	3-deoxy-D-manno-octulosonic-acid kinase	NA	NA	NA	NA	NA
VDL05504.1|2273158_2274262_+	putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL05506.1|2274268_2275396_+	polyamine transport ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	38.0	3.9e-27
VDL05508.1|2275392_2276307_+	inner membrane permease polyamine transport protein	NA	NA	NA	NA	NA
VDL05510.1|2276303_2277113_+	inner membrane permease polyamine transport protein	NA	NA	NA	NA	NA
VDL05512.1|2277109_2277466_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05514.1|2277574_2278186_+	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
VDL05516.1|2278193_2278853_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05518.1|2279044_2280376_+	lipoprotein	NA	NA	NA	NA	NA
VDL05520.1|2280474_2282133_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL05522.1|2282186_2282867_+	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
VDL05524.1|2283021_2283801_+	transporter	NA	NA	NA	NA	NA
VDL05526.1|2283814_2285695_-	phospholipase	NA	NA	NA	NA	NA
VDL05528.1|2285748_2286021_-	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
VDL05530.1|2286100_2287504_-	N-acetylglutamate synthase	NA	NA	NA	NA	NA
VDL05532.1|2287636_2289058_+	ATP-dependent helicase	NA	M1PGM1	Moumouvirus	32.6	2.6e-44
VDL05534.1|2289090_2291520_+	ATP-dependent helicase	NA	NA	NA	NA	NA
VDL05536.1|2291651_2292551_-	dioxygenase	NA	S4VR59	Pandoravirus	37.7	1.1e-35
VDL05538.1|2292688_2296180_+	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	37.6	1.7e-185
VDL05540.1|2296179_2297283_+	transferase	NA	NA	NA	NA	NA
VDL05542.1|2297275_2298127_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
VDL05544.1|2298123_2298876_+	transferase	NA	NA	NA	NA	NA
VDL05546.1|2298872_2299985_+	transferase	NA	NA	NA	NA	NA
VDL05548.1|2299963_2300836_-	outer membrane protein	NA	NA	NA	NA	NA
VDL05550.1|2300832_2301579_-	outer membrane protein	NA	NA	NA	NA	NA
VDL05552.1|2301806_2302280_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05554.1|2302266_2302707_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05556.1|2302988_2303714_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
VDL05558.1|2303688_2304066_+	transferase	NA	NA	NA	NA	NA
VDL05560.1|2304005_2304842_+	transferase	NA	NA	NA	NA	NA
VDL05562.1|2304966_2305161_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05564.1|2305243_2306008_-	membrane protein	NA	NA	NA	NA	NA
VDL05566.1|2306020_2306368_-	heptosyltransferase II	NA	NA	NA	NA	NA
VDL05567.1|2306364_2306985_-	heptosyltransferase II	NA	NA	NA	NA	NA
VDL05570.1|2307096_2308872_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.5	4.0e-50
VDL05572.1|2308844_2310077_-	inner membrane efflux protein	NA	NA	NA	NA	NA
VDL05574.1|2310046_2310343_-	inner membrane efflux protein	NA	NA	NA	NA	NA
VDL05576.1|2310426_2310972_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL05579.1|2311070_2311871_+	dehydratase	NA	NA	NA	NA	NA
VDL05581.1|2311904_2312252_-	ribonuclease	NA	NA	NA	NA	NA
VDL05583.1|2312248_2313367_-	ribonuclease	NA	NA	NA	NA	NA
VDL05586.1|2313410_2313851_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05588.1|2313878_2314364_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2340935	2375970	4108173	protease,transposase	Planktothrix_phage(20.0%)	38	NA	NA
VDL05630.1|2340935_2341562_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05632.1|2341534_2341888_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05634.1|2341884_2343516_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.7e-21
VDL05636.1|2343526_2344366_-	integral membrane transport protein	NA	NA	NA	NA	NA
VDL05638.1|2344362_2345370_-	integral membrane transport protein	NA	NA	NA	NA	NA
VDL05640.1|2345485_2347060_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL05642.1|2347483_2349028_+	transcriptional regulator	NA	A0A1X9I5H2	Streptococcus_phage	25.4	3.1e-14
VDL05644.1|2349132_2349462_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
VDL05646.1|2349461_2350199_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
VDL05648.1|2350217_2351804_-	multidrug resistance protein	NA	NA	NA	NA	NA
VDL05649.1|2351800_2352931_-	multidrug resistance protein	NA	NA	NA	NA	NA
VDL05652.1|2353154_2354438_-	outer membrane efflux protein	NA	NA	NA	NA	NA
VDL05654.1|2354561_2355050_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
VDL05656.1|2355109_2355790_-	integral membrane protein	NA	NA	NA	NA	NA
VDL05658.1|2355783_2355966_-	integral membrane protein	NA	NA	NA	NA	NA
VDL05660.1|2356028_2356979_+	integral membrane protein	NA	NA	NA	NA	NA
VDL05661.1|2357041_2358031_+	quinone oxidoreductase	NA	NA	NA	NA	NA
VDL05663.1|2358105_2358987_-|protease	protease HtpX	protease	NA	NA	NA	NA
VDL05664.1|2359262_2359991_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05666.1|2360043_2360895_+	sulfurtransferase	NA	NA	NA	NA	NA
VDL05668.1|2360911_2361481_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05670.1|2361511_2362375_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL05672.1|2362534_2363611_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	1.2e-28
VDL05674.1|2363597_2365160_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL05676.1|2365156_2365375_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL05678.1|2365400_2366222_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
VDL05680.1|2366250_2367273_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL05682.1|2367337_2367721_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
VDL05684.1|2367802_2368327_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05686.1|2368323_2368644_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05688.1|2368640_2368757_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05690.1|2368753_2370076_-	regulatory lipoprotein	NA	NA	NA	NA	NA
VDL05692.1|2370180_2370498_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05694.1|2370631_2371945_+	xanthine/uracil family permease	NA	Q9KX94	Enterobacteria_phage	67.1	2.1e-149
VDL05696.1|2371975_2373607_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	8.8e-12
VDL05698.1|2374236_2374713_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
VDL05700.1|2375014_2375446_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05702.1|2375442_2375970_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2415082	2472369	4108173	tRNA,transposase	Klosneuvirus(12.5%)	60	NA	NA
VDL05794.1|2415082_2415250_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05796.1|2415195_2415525_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05798.1|2415511_2416042_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL05801.1|2416140_2418741_-	inner membrane protein	NA	NA	NA	NA	NA
VDL05803.1|2418847_2419852_-	cell surface protein	NA	NA	NA	NA	NA
VDL05805.1|2419960_2421301_-	aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	22.8	8.8e-18
VDL05807.1|2421341_2422343_-	SIS family regulator	NA	NA	NA	NA	NA
VDL05809.1|2422566_2423112_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
VDL05811.1|2423108_2423669_+	L-2,4-diaminobutyric acid acetyltransferase	NA	NA	NA	NA	NA
VDL05813.1|2423767_2424289_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05815.1|2424275_2424716_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05816.1|2424756_2425341_+	IMPACT family member YigZ	NA	A0A1X9I5T8	Streptococcus_phage	35.8	4.7e-16
VDL05818.1|2425358_2425742_-	thioredoxin 2	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
VDL05820.1|2425877_2426441_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05822.1|2427100_2428393_-	permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
VDL05824.1|2428527_2429568_+|tRNA	tRNA N6-adenosine threonylcarbamoyltransferase	tRNA	A0A0R6PI74	Moraxella_phage	51.3	6.1e-91
VDL05826.1|2429665_2430337_-|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL05828.1|2430353_2430602_-|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL05830.1|2430956_2431592_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
VDL05832.1|2431729_2432488_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
VDL05834.1|2432472_2433252_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
VDL05836.1|2433269_2434154_+	peptidase	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
VDL05838.1|2434150_2434930_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05840.1|2435034_2435634_+	exported protein	NA	NA	NA	NA	NA
VDL05842.1|2435922_2436675_+	exported protein	NA	NA	NA	NA	NA
VDL05844.1|2436793_2438194_+	23S rRNA (uracil(1939)-C(5))-methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
VDL05846.1|2438217_2438616_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
VDL05848.1|2438791_2438992_+	exported protein	NA	NA	NA	NA	NA
VDL05850.1|2439130_2439859_+	glutaredoxin	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
VDL05852.1|2439992_2441741_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
VDL05854.1|2441768_2441987_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05856.1|2443278_2444481_+	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VDL05857.1|2444420_2445233_+	peptidyl-prolyl cis-trans isomerase D	NA	NA	NA	NA	NA
VDL05859.1|2445214_2445763_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
VDL05861.1|2445875_2446559_+	lipoprotein releasing system ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.3e-22
VDL05863.1|2446657_2447284_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05865.1|2447435_2447609_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05867.1|2447757_2448096_-	exported protein	NA	NA	NA	NA	NA
VDL05869.1|2448153_2448315_-	membrane protein	NA	NA	NA	NA	NA
VDL05871.1|2448346_2448547_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05873.1|2448812_2451386_-	cyanophycin synthetase	NA	NA	NA	NA	NA
VDL05875.1|2451456_2454006_-	cyanophycin synthetase	NA	NA	NA	NA	NA
VDL05876.1|2454270_2454486_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05878.1|2454787_2456560_+	cyclolysin secretion/procession ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.4	5.7e-57
VDL05880.1|2456556_2457045_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05882.1|2457136_2458267_-	hypothetical protein	NA	NA	NA	NA	NA
VDL05883.1|2458272_2459163_+	exported protein	NA	NA	NA	NA	NA
VDL05884.1|2460105_2460432_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
VDL05886.1|2460560_2461001_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05887.1|2461619_2462060_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05889.1|2462056_2462530_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
VDL05891.1|2462691_2463630_+	membrane protein	NA	NA	NA	NA	NA
VDL05893.1|2463675_2464839_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase	NA	Q9HH70	Methanothermobacter_phage	32.0	4.5e-34
VDL05895.1|2464943_2465450_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
VDL05897.1|2465452_2466517_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	23.2	2.5e-07
VDL05899.1|2466525_2468313_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	28.4	2.0e-49
VDL05901.1|2468302_2469268_-	bifunctional riboflavin kinase/FMN adenylyltransferase	NA	NA	NA	NA	NA
VDL05903.1|2469327_2471322_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	33.3	4.4e-21
VDL05905.1|2471420_2471942_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05907.1|2471928_2472369_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2492458	2526657	4108173	protease,transposase	Agrobacterium_phage(14.29%)	40	NA	NA
VDL05942.1|2492458_2493112_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
VDL05944.1|2493216_2494521_+|protease	ATP-dependent Clp protease ATP-binding protein	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
VDL05946.1|2494708_2497162_+|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
VDL05948.1|2497285_2497897_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL05950.1|2498464_2499688_+	racemase	NA	NA	NA	NA	NA
VDL05952.1|2499753_2500725_+	exported protein	NA	NA	NA	NA	NA
VDL05954.1|2500791_2501193_+	MaoC family protein	NA	NA	NA	NA	NA
VDL05956.1|2501212_2502010_+	enoyl-CoA hydratase/isomerase	NA	NA	NA	NA	NA
VDL05958.1|2502006_2502438_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05960.1|2502434_2503592_+	thiolase	NA	NA	NA	NA	NA
VDL05962.1|2503613_2504390_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
VDL05964.1|2504392_2505571_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL05966.1|2505563_2506136_+	hypothetical protein	NA	NA	NA	NA	NA
VDL05968.1|2506144_2506558_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL05970.1|2506554_2507271_+	3-oxoadipate CoA-transferase subunit A	NA	NA	NA	NA	NA
VDL05972.1|2507263_2507905_+	3-oxoadipate CoA-transferase subunit B	NA	NA	NA	NA	NA
VDL05974.1|2507939_2508671_+	exported protein	NA	NA	NA	NA	NA
VDL05976.1|2508688_2508901_+	exported protein	NA	NA	NA	NA	NA
VDL05978.1|2509471_2510098_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05980.1|2510122_2510425_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL05982.1|2510825_2511755_+	tracheal colonization factor	NA	NA	NA	NA	NA
VDL05984.1|2511983_2512634_-	LexA repressor	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.3e-10
VDL05986.1|2512762_2513674_-	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
VDL05988.1|2513667_2513967_-	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
VDL05990.1|2514044_2516081_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
VDL05992.1|2516333_2516825_+	low molecular weight protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
VDL05994.1|2517040_2517553_+	DNA-binding protein	NA	NA	NA	NA	NA
VDL05996.1|2517570_2518782_+	cysteine desulfurase	NA	NA	NA	NA	NA
VDL05998.1|2518819_2519230_+	[Fe-S] cluster scaffold protein	NA	A0A218MKD1	uncultured_virus	79.0	7.5e-53
VDL06000.1|2519231_2519555_+	[Fe-S] cluster formation/repair protein	NA	A0A2H4N7N5	Lake_Baikal_phage	52.8	6.8e-25
VDL06002.1|2519557_2520070_+	co-chaperone HscB	NA	NA	NA	NA	NA
VDL06004.1|2520199_2522041_+	chaperone protein HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.6	3.9e-101
VDL06006.1|2522069_2522411_+	ferredoxin, 2Fe-2S	NA	NA	NA	NA	NA
VDL06008.1|2522410_2522605_+	Protein IscX	NA	NA	NA	NA	NA
VDL06010.1|2522729_2523623_+	Methylglyoxal synthase	NA	NA	NA	NA	NA
VDL06012.1|2523619_2524060_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06014.1|2524046_2524571_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06016.1|2524695_2525505_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
VDL06018.1|2525705_2526230_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06020.1|2526216_2526657_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2554437	2595128	4108173	tRNA,transposase	Klosneuvirus(25.0%)	42	NA	NA
VDL06075.1|2554437_2557062_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
VDL06077.1|2557048_2557303_+	Sulfur carrier protein TusA	NA	NA	NA	NA	NA
VDL06079.1|2557369_2557951_-	exported protein	NA	NA	NA	NA	NA
VDL06081.1|2558254_2558515_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
VDL06083.1|2558679_2559303_+	ribosome maturation factor	NA	NA	NA	NA	NA
VDL06085.1|2559302_2560076_+|tRNA	tRNA (guanine-N(1)-)-methyltransferase	tRNA	NA	NA	NA	NA
VDL06087.1|2560072_2561281_-	class-V aminotransferase	NA	NA	NA	NA	NA
VDL06089.1|2561306_2561780_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06091.1|2561853_2562204_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06093.1|2562176_2562806_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06095.1|2562904_2563255_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06097.1|2563227_2563857_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06099.1|2563955_2565305_-	two component sensor kinase	NA	NA	NA	NA	NA
VDL06101.1|2565301_2565562_-	two-component system response regulator	NA	NA	NA	NA	NA
VDL06103.1|2566070_2566826_+	outer membrane (scaffolding) protein	NA	NA	NA	NA	NA
VDL06105.1|2566918_2569801_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
VDL06107.1|2570122_2570548_+	nucleoside diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
VDL06109.1|2570575_2571724_+	dual-specificity RNA methyltransferase RlmN	NA	NA	NA	NA	NA
VDL06112.1|2571720_2572227_+	membrane protein	NA	NA	NA	NA	NA
VDL06114.1|2572257_2573529_+	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
VDL06116.1|2573578_2574874_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
VDL06118.1|2574875_2575514_+	membrane protein	NA	NA	NA	NA	NA
VDL06120.1|2575519_2576677_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
VDL06122.1|2576703_2578059_+	GTPase Der	NA	NA	NA	NA	NA
VDL06124.1|2578062_2579133_+	histidinol-phosphate aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
VDL06126.1|2579271_2579508_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
VDL06128.1|2579664_2580702_+	GTPase HflX	NA	NA	NA	NA	NA
VDL06131.1|2580882_2581971_+	membrane protein	NA	NA	NA	NA	NA
VDL06133.1|2581989_2582889_+	inner membrane-anchored protein HflC	NA	NA	NA	NA	NA
VDL06135.1|2583072_2584230_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
VDL06137.1|2584306_2585602_+	adenylosuccinate synthetase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
VDL06139.1|2585715_2586255_+	transferase	NA	NA	NA	NA	NA
VDL06141.1|2586532_2586745_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
VDL06143.1|2586791_2588795_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.6	3.9e-62
VDL06145.1|2589561_2591763_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.1e-36
VDL06147.1|2592170_2592470_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06149.1|2592498_2592597_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06151.1|2592760_2593168_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	59.0	3.7e-36
VDL06153.1|2593127_2593568_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06155.1|2593554_2593911_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06157.1|2594178_2594529_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06159.1|2594501_2595128_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2605976	2639029	4108173	transposase	Klosneuvirus(33.33%)	41	NA	NA
VDL06192.1|2605976_2606324_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06194.1|2606310_2606847_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06196.1|2606843_2607368_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06198.1|2607354_2607630_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06200.1|2607622_2607796_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06202.1|2607792_2609067_-	adenosylmethionine-8-amino-7-oxononanoate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
VDL06204.1|2609170_2610364_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
VDL06206.1|2611015_2612452_+	biotin synthesis protein	NA	NA	NA	NA	NA
VDL06208.1|2612439_2612799_+	integral membrane protein	NA	NA	NA	NA	NA
VDL06210.1|2612884_2613535_+	Inner membrane protein YohK	NA	NA	NA	NA	NA
VDL06212.1|2613945_2614293_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06214.1|2614279_2614726_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06215.1|2615335_2615776_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06217.1|2615875_2616502_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06219.1|2616823_2618476_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
VDL06221.1|2618424_2618688_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
VDL06223.1|2618944_2620465_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
VDL06225.1|2620551_2621202_-	Putative NAD(P)H-dependent FMN-containing oxidoreductase YwqN	NA	NA	NA	NA	NA
VDL06227.1|2621333_2621792_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06229.1|2621797_2622154_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06231.1|2622150_2623446_+	exported protein	NA	NA	NA	NA	NA
VDL06233.1|2623467_2624352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06235.1|2624851_2625325_+	oxidoreductase	NA	NA	NA	NA	NA
VDL06237.1|2625314_2625671_-	putative protein YbaA	NA	NA	NA	NA	NA
VDL06239.1|2625812_2626775_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
VDL06242.1|2626904_2627084_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06243.1|2627226_2627706_+	exported protein	NA	NA	NA	NA	NA
VDL06245.1|2627716_2628553_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
VDL06247.1|2628665_2629037_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06249.1|2629033_2629585_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06251.1|2629600_2631292_-	sulfate transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	5.0e-42
VDL06253.1|2631340_2632021_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06255.1|2632271_2632694_-	exported protein	NA	NA	NA	NA	NA
VDL06257.1|2632905_2633835_+	membrane protein	NA	NA	NA	NA	NA
VDL06260.1|2633847_2634441_-	lipoprotein	NA	NA	NA	NA	NA
VDL06262.1|2634568_2636386_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
VDL06263.1|2636469_2636643_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06266.1|2636794_2637427_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06267.1|2637525_2637933_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06269.1|2638254_2638602_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06271.1|2638588_2639029_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 31
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2652320	2689708	4108173	transposase	Erysipelothrix_phage(100.0%)	43	NA	NA
VDL06302.1|2652320_2652614_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL06304.1|2652586_2653255_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL06306.1|2653396_2654749_-	glutathione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	2.9e-45
VDL06308.1|2654923_2655220_+	membrane protein	NA	NA	NA	NA	NA
VDL06310.1|2655318_2655945_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06312.1|2655917_2656370_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06314.1|2656356_2657304_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06315.1|2657789_2657966_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06317.1|2658650_2659622_+	exported protein	NA	NA	NA	NA	NA
VDL06319.1|2659625_2660480_+	Peptidoglycan deacetylase	NA	NA	NA	NA	NA
VDL06321.1|2660498_2661320_+	hydrolase	NA	NA	NA	NA	NA
VDL06323.1|2661351_2662146_+	amidase	NA	NA	NA	NA	NA
VDL06325.1|2662224_2662800_+	amidase	NA	NA	NA	NA	NA
VDL06327.1|2662757_2663591_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
VDL06329.1|2663876_2664146_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06331.1|2664200_2665382_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06333.1|2665423_2666206_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
VDL06335.1|2666275_2666722_-	membrane protein	NA	NA	NA	NA	NA
VDL06337.1|2666718_2667945_-	membrane protein	NA	NA	NA	NA	NA
VDL06339.1|2667937_2668342_-	Group 3 truncated hemoglobin ctb	NA	NA	NA	NA	NA
VDL06342.1|2668501_2668801_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06344.1|2668797_2669238_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06345.1|2669224_2669749_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06346.1|2669970_2670321_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06347.1|2670293_2670923_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06348.1|2671021_2671987_-	exported protein	NA	NA	NA	NA	NA
VDL06349.1|2672124_2672931_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06351.1|2673554_2675378_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06352.1|2675736_2677107_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06354.1|2677117_2677819_+	thiolase	NA	NA	NA	NA	NA
VDL06356.1|2677908_2678313_+	thiolase	NA	NA	NA	NA	NA
VDL06358.1|2678385_2679705_+	acyl-CoA ligase	NA	NA	NA	NA	NA
VDL06360.1|2679701_2680577_+	esterase	NA	NA	NA	NA	NA
VDL06362.1|2680607_2681756_-	fatty-acyl-CoA racemase	NA	NA	NA	NA	NA
VDL06364.1|2681773_2682088_-	ferredoxin	NA	NA	NA	NA	NA
VDL06366.1|2682084_2682831_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
VDL06368.1|2682830_2683643_-	enoyl-CoA hydratase/isomerase-like protein	NA	NA	NA	NA	NA
VDL06371.1|2683653_2684181_-	dioxygenase component	NA	NA	NA	NA	NA
VDL06374.1|2684186_2685443_-	dioxygenase hydroxylase component	NA	NA	NA	NA	NA
VDL06376.1|2685801_2686941_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL06378.1|2687018_2687774_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL06380.1|2687893_2688679_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
VDL06382.1|2688760_2689708_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 32
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2724495	2758338	4108173	tRNA,transposase	uncultured_Caudovirales_phage(33.33%)	32	NA	NA
VDL06473.1|2724495_2724927_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06475.1|2724923_2725154_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06477.1|2725525_2726800_-	Cyclopropane mycolic acid synthase 1	NA	NA	NA	NA	NA
VDL06479.1|2726986_2728159_+	transmembrane transport protein	NA	NA	NA	NA	NA
VDL06481.1|2728527_2728764_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
VDL06483.1|2728827_2728995_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
VDL06485.1|2729108_2730914_-	sulfate transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	2.2e-19
VDL06487.1|2731167_2731608_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06489.1|2731594_2731996_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06491.1|2732219_2733176_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06493.1|2733452_2733890_+	DNA-binding protein Bph2	NA	NA	NA	NA	NA
VDL06495.1|2734012_2734525_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06497.1|2734521_2735724_+	transmembrane transport protein	NA	NA	NA	NA	NA
VDL06499.1|2735801_2738459_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.0	3.3e-173
VDL06501.1|2738474_2739134_+	LPS-assembly lipoprotein LptE	NA	NA	NA	NA	NA
VDL06503.1|2739136_2740192_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
VDL06505.1|2740313_2741573_+	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	45.7	1.1e-91
VDL06507.1|2741569_2741965_+	membrane protein	NA	NA	NA	NA	NA
VDL06509.1|2741987_2743382_-	amidase	NA	NA	NA	NA	NA
VDL06511.1|2743563_2744511_+	hydroxlacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL06513.1|2744507_2744780_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06515.1|2745009_2745288_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06517.1|2751843_2752092_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06519.1|2752180_2753143_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06521.1|2753348_2753702_+	Pantothenate precursors transporter PanS	NA	NA	NA	NA	NA
VDL06523.1|2753698_2754325_+	Pantothenate precursors transporter PanS	NA	NA	NA	NA	NA
VDL06525.1|2754374_2755082_-	acyl-CoA transferase	NA	NA	NA	NA	NA
VDL06527.1|2755132_2755891_-	acyl-CoA transferase	NA	NA	NA	NA	NA
VDL06530.1|2756116_2757028_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06533.1|2757172_2757403_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06535.1|2757389_2757911_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06537.1|2757897_2758338_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 33
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2826316	2877520	4108173	transposase,tRNA,integrase	Bacillus_virus(33.33%)	59	2824600:2824616	2844112:2844128
2824600:2824616	attL	TCGGCGAACAGCGCCGT	NA	NA	NA	NA
VDL06669.1|2826316_2827588_-|integrase	integrase	integrase	NA	NA	NA	NA
VDL06671.1|2827954_2828413_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06673.1|2828784_2829021_-	membrane protein	NA	NA	NA	NA	NA
VDL06675.1|2829229_2831215_+	hemin storage protein	NA	NA	NA	NA	NA
VDL06677.1|2831220_2831469_+	hemin storage protein	NA	NA	NA	NA	NA
VDL06679.1|2831465_2832077_+	hemin storage protein	NA	NA	NA	NA	NA
VDL06681.1|2832097_2833327_+	hemin storage protein	NA	NA	NA	NA	NA
VDL06683.1|2833330_2834590_+	N-glycosyltransferase	NA	NA	NA	NA	NA
VDL06685.1|2834570_2835209_+	membrane protein	NA	NA	NA	NA	NA
VDL06687.1|2835213_2836326_-	N-ethylmaleimide reductase	NA	NA	NA	NA	NA
VDL06689.1|2836378_2836678_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06690.1|2836885_2837335_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06692.1|2837341_2837677_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06694.1|2837690_2838167_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06695.1|2838170_2838563_+	endoribonuclease	NA	NA	NA	NA	NA
VDL06697.1|2838631_2839588_+	exported protein	NA	NA	NA	NA	NA
VDL06699.1|2839588_2841709_+	pimeloyl-CoA synthetase	NA	NA	NA	NA	NA
VDL06701.1|2841717_2842422_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL06703.1|2842580_2843780_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
VDL06705.1|2844014_2845106_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	9.3e-26
2844112:2844128	attR	TCGGCGAACAGCGCCGT	NA	NA	NA	NA
VDL06707.1|2845102_2845375_-	ABC transporter permease	NA	NA	NA	NA	NA
VDL06709.1|2845903_2846731_-	ABC transporter permease	NA	NA	NA	NA	NA
VDL06711.1|2846733_2847033_-	N-substituted formamide deformylase	NA	NA	NA	NA	NA
VDL06713.1|2847026_2848358_-	N-substituted formamide deformylase	NA	NA	NA	NA	NA
VDL06715.1|2848368_2849493_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
VDL06717.1|2849604_2850558_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06719.1|2850562_2851174_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06721.1|2851288_2851648_-	short chain dehydrogenase	NA	NA	NA	NA	NA
VDL06723.1|2851644_2852055_-	short chain dehydrogenase	NA	NA	NA	NA	NA
VDL06725.1|2852069_2852873_-	L-aspartate dehydrogenase	NA	NA	NA	NA	NA
VDL06726.1|2852869_2853592_-	hydrolase	NA	NA	NA	NA	NA
VDL06728.1|2853674_2854658_-	exported protein	NA	NA	NA	NA	NA
VDL06730.1|2854686_2855955_-	membrane protein	NA	NA	NA	NA	NA
VDL06732.1|2855957_2856482_-	membrane protein	NA	NA	NA	NA	NA
VDL06734.1|2856478_2857420_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL06736.1|2857429_2857744_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06738.1|2857785_2858286_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06740.1|2858717_2858966_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL06742.1|2859020_2859650_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL06744.1|2860043_2861309_-	aspartate kinase	NA	NA	NA	NA	NA
VDL06746.1|2861299_2862442_-|tRNA	tRNA(Ile)-lysidine synthase	tRNA	NA	NA	NA	NA
VDL06748.1|2862502_2862934_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06750.1|2862930_2863458_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06752.1|2863556_2864522_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
VDL06754.1|2864558_2864759_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
VDL06756.1|2864755_2865061_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
VDL06758.1|2865081_2865201_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
VDL06760.1|2865220_2866681_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	27.9	2.5e-34
VDL06762.1|2866920_2867604_+	exported protein	NA	NA	NA	NA	NA
VDL06764.1|2867603_2868242_+	peptidyl-prolyl cis-trans isomerase B	NA	NA	NA	NA	NA
VDL06766.1|2868234_2869011_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
VDL06768.1|2869218_2870082_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
VDL06770.1|2870106_2871693_-	membrane protein	NA	A0A0R6PEZ3	Moraxella_phage	42.0	1.9e-35
VDL06772.1|2871819_2872602_-	inositol monophosphatase	NA	NA	NA	NA	NA
VDL06774.1|2872944_2873658_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06775.1|2873704_2874697_-	exported protein	NA	NA	NA	NA	NA
VDL06777.1|2874858_2875617_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL06779.1|2875630_2876464_-	membrane protein	NA	NA	NA	NA	NA
VDL06781.1|2876569_2877520_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 34
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2918468	2942139	4108173	tRNA,transposase	Yellowstone_lake_phycodnavirus(33.33%)	29	NA	NA
VDL06845.1|2918468_2918921_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06847.1|2919150_2919651_+	hypothetical protein	NA	NA	NA	NA	NA
VDL06849.1|2919637_2919898_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06851.1|2920145_2920586_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06853.1|2920702_2920873_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06855.1|2920857_2921424_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06857.1|2921596_2922583_+	exported protein	NA	NA	NA	NA	NA
VDL06858.1|2922583_2923066_+	membrane protein	NA	NA	NA	NA	NA
VDL06860.1|2923069_2924353_+	membrane protein	NA	NA	NA	NA	NA
VDL06861.1|2924349_2925288_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
VDL06863.1|2925284_2926994_+	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	27.3	5.9e-35
VDL06865.1|2927003_2928251_+	N-carbamoyl-L-amino acid amidohydrolase	NA	NA	NA	NA	NA
VDL06867.1|2928299_2929919_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
VDL06869.1|2929860_2931150_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
VDL06871.1|2931342_2932086_-	arginase	NA	NA	NA	NA	NA
VDL06873.1|2932287_2933061_-	glutamine transport ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.1e-31
VDL06875.1|2933057_2933327_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
VDL06877.1|2933330_2933726_-	binding-protein-dependent transport system inner membrane protein	NA	NA	NA	NA	NA
VDL06879.1|2933722_2934466_-	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL06881.1|2934540_2935281_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL06883.1|2935477_2936314_-	exported protein	NA	NA	NA	NA	NA
VDL06885.1|2936364_2937135_-	deoxyribonuclease	NA	NA	NA	NA	NA
VDL06887.1|2937184_2938237_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
VDL06889.1|2938233_2938860_-	thymidylate kinase	NA	A0A1L2BX49	Bacteriophage	35.1	1.6e-22
VDL06891.1|2938856_2939891_-	exported protein	NA	NA	NA	NA	NA
VDL06893.1|2940068_2941085_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
VDL06895.1|2941183_2941708_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06897.1|2941694_2941886_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06900.1|2941965_2942139_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 35
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	2948610	2980986	4108173	tRNA,transposase	uncultured_Caudovirales_phage(40.0%)	39	NA	NA
VDL06913.1|2948610_2948961_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06915.1|2948933_2949563_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06917.1|2949644_2950511_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06919.1|2950547_2951321_-	ABC transporter permease	NA	NA	NA	NA	NA
VDL06921.1|2951317_2952316_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL06923.1|2952400_2953177_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	1.2e-30
VDL06925.1|2953332_2954937_-	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	28.9	1.2e-53
VDL06927.1|2955317_2956442_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL06928.1|2956568_2957192_+	membrane protein	NA	NA	NA	NA	NA
VDL06930.1|2959138_2959933_+	hydratase/isomerase	NA	NA	NA	NA	NA
VDL06932.1|2959945_2960947_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
VDL06934.1|2960943_2961435_-|tRNA	tRNA-specific adenosine deaminase	tRNA	S4VYT2	Pandoravirus	38.4	3.3e-07
VDL06936.1|2961442_2962291_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06938.1|2962388_2962898_-	exported protein	NA	NA	NA	NA	NA
VDL06940.1|2962974_2963328_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06942.1|2963297_2963924_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06944.1|2964079_2964406_-	monovalent cation/H+ antiporter subunit G	NA	NA	NA	NA	NA
VDL06946.1|2964402_2964684_-	monovalent cation/H+ antiporter subunit F	NA	NA	NA	NA	NA
VDL06948.1|2964683_2965160_-	monovalent cation/H+ antiporter subunit E	NA	NA	NA	NA	NA
VDL06950.1|2965159_2965804_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
VDL06952.1|2965854_2966787_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
VDL06954.1|2966783_2967128_-	monovalent cation/H+ antiporter subunit C	NA	NA	NA	NA	NA
VDL06956.1|2967127_2970061_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
VDL06958.1|2970482_2970830_+	exported protein	NA	NA	NA	NA	NA
VDL06960.1|2970781_2971228_+	exported protein	NA	NA	NA	NA	NA
VDL06962.1|2971218_2971569_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06964.1|2971541_2972171_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL06966.1|2972269_2972566_-	membrane protein	NA	NA	NA	NA	NA
VDL06968.1|2972687_2973590_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL06970.1|2973594_2974308_-	short chain dehydrogenase	NA	NA	NA	NA	NA
VDL06972.1|2974321_2975293_-	exported protein	NA	NA	NA	NA	NA
VDL06974.1|2975866_2976793_-	N-acyl-D-glutamate deacylase	NA	NA	NA	NA	NA
VDL06976.1|2977041_2977392_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL06978.1|2977395_2978583_+	membrane protein	NA	NA	NA	NA	NA
VDL06980.1|2978756_2979029_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.1	1.9e-28
VDL06982.1|2979006_2979744_+	NADPH-dependent FMN reductase	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
VDL06984.1|2979740_2979929_-	hypothetical protein	NA	NA	NA	NA	NA
VDL06986.1|2980037_2980559_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL06988.1|2980545_2980986_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 36
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3002295	3026815	4108173	transposase	Tetraselmis_virus(33.33%)	26	NA	NA
VDL07033.1|3002295_3002736_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07035.1|3002715_3003210_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07037.1|3003288_3004914_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
VDL07039.1|3004963_3005998_-	nonspecific acid phosphatase	NA	NA	NA	NA	NA
VDL07040.1|3006000_3007188_-	exported protein	NA	NA	NA	NA	NA
VDL07042.1|3007344_3008859_-	exported protein	NA	NA	NA	NA	NA
VDL07044.1|3008849_3010337_-	exported protein	NA	NA	NA	NA	NA
VDL07046.1|3010333_3011275_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07048.1|3011283_3012252_-	regulatory protein	NA	NA	NA	NA	NA
VDL07051.1|3012305_3012758_-	Serine/threonine-protein kinase pkn1	NA	NA	NA	NA	NA
VDL07053.1|3013789_3014758_+	exported protein	NA	NA	NA	NA	NA
VDL07054.1|3014935_3015925_+	exported protein	NA	NA	NA	NA	NA
VDL07057.1|3015971_3016730_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
VDL07059.1|3016919_3017657_+	membrane protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
VDL07061.1|3017755_3018382_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07063.1|3018354_3018705_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07065.1|3018889_3019672_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
VDL07067.1|3019665_3020367_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
VDL07069.1|3020606_3021209_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VDL07071.1|3021184_3021574_-	Ferredoxin--NAD(P)(+) reductase fdr	NA	NA	NA	NA	NA
VDL07073.1|3022534_3023056_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07075.1|3023042_3023483_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07077.1|3023479_3025036_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
VDL07079.1|3025028_3025802_-	oxidoreductase	NA	NA	NA	NA	NA
VDL07081.1|3025860_3026301_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07083.1|3026329_3026815_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 37
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3062762	3111855	4108173	transposase	Ectocarpus_siliculosus_virus(12.5%)	53	NA	NA
VDL07149.1|3062762_3063245_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07151.1|3063272_3063713_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07153.1|3063732_3064638_-	Putative quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
VDL07155.1|3064715_3065414_-	Quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
VDL07157.1|3065557_3066517_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL07159.1|3066526_3068014_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
VDL07160.1|3068013_3069081_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.1e-05
VDL07162.1|3069144_3070557_-	glutamine synthetase	NA	NA	NA	NA	NA
VDL07164.1|3070742_3071858_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
VDL07166.1|3071985_3072426_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07167.1|3072412_3072934_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07169.1|3073032_3073674_-	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
VDL07171.1|3073800_3075603_+	putative signaling protein	NA	NA	NA	NA	NA
VDL07173.1|3075480_3077172_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.1	1.0e-10
VDL07175.1|3077254_3078160_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL07177.1|3078341_3079718_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
VDL07179.1|3079884_3080625_-	ribonuclease PH	NA	NA	NA	NA	NA
VDL07181.1|3080761_3081688_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07183.1|3081959_3082115_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07185.1|3082127_3082256_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07187.1|3082252_3082537_+	DNA-binding protein	NA	NA	NA	NA	NA
VDL07189.1|3082595_3084086_-	AMP nucleosidase	NA	NA	NA	NA	NA
VDL07191.1|3084330_3084930_+	exported protein	NA	A0A0A8WF62	Clostridium_phage	41.6	1.4e-20
VDL07193.1|3084934_3085705_-	oxidoreductase	NA	NA	NA	NA	NA
VDL07195.1|3085942_3086656_+	cytochrome C	NA	NA	NA	NA	NA
VDL07197.1|3086917_3087568_+	cytochrome C	NA	NA	NA	NA	NA
VDL07199.1|3087703_3088336_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.9	2.4e-13
VDL07201.1|3088377_3088581_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
VDL07203.1|3088605_3090885_+	guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.1	5.9e-06
VDL07205.1|3090897_3091626_-	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	3.3e-35
VDL07207.1|3091622_3092282_-	glutamine ABC transporter permease	NA	NA	NA	NA	NA
VDL07209.1|3092349_3093102_-	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL07211.1|3093283_3094237_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07213.1|3094645_3095044_+	Stage IV sporulation protein FB	NA	NA	NA	NA	NA
VDL07215.1|3095129_3096035_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
VDL07217.1|3096052_3097174_+	lipoprotein	NA	NA	NA	NA	NA
VDL07219.1|3097262_3097877_-	serotype 3 fimbrial subunit	NA	NA	NA	NA	NA
VDL07220.1|3098041_3098266_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07222.1|3098534_3099722_-	50S ribosomal protein L16 3-hydroxylase	NA	NA	NA	NA	NA
VDL07224.1|3099718_3102316_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
VDL07226.1|3102617_3102785_+	Dodecin	NA	NA	NA	NA	NA
VDL07228.1|3103240_3103795_-	chromate reductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
VDL07230.1|3104065_3104623_+	membrane protein	NA	NA	NA	NA	NA
VDL07233.1|3104734_3106039_+	exported protein	NA	NA	NA	NA	NA
VDL07235.1|3106134_3107379_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07237.1|3107345_3107546_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07239.1|3107651_3108653_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07241.1|3108633_3109755_+	exported protein	NA	NA	NA	NA	NA
VDL07243.1|3109853_3110114_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07244.1|3110142_3110376_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07246.1|3110362_3110803_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07248.1|3110906_3111533_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07250.1|3111681_3111855_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 38
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3114922	3159131	4108173	tRNA,transposase	Streptococcus_virus(10.0%)	47	NA	NA
VDL07259.1|3114922_3115096_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07261.1|3115244_3115874_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07263.1|3115972_3116581_-	recombination protein RecR	NA	NA	NA	NA	NA
VDL07265.1|3116631_3116958_-	nucleoid-associated protein	NA	NA	NA	NA	NA
VDL07267.1|3117004_3119230_-	DNA polymerase III subunits gamma and tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.2e-43
VDL07269.1|3119891_3123296_-	nuclease/helicase	NA	NA	NA	NA	NA
VDL07271.1|3123308_3125969_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07273.1|3125990_3126137_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07275.1|3126172_3127375_-	membrane protein	NA	NA	NA	NA	NA
VDL07277.1|3128061_3129174_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
VDL07279.1|3129180_3129531_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07281.1|3129503_3130133_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07283.1|3130231_3130600_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07285.1|3130704_3131283_-	Protein/nucleic acid deglycase 2	NA	NA	NA	NA	NA
VDL07287.1|3131400_3131607_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
VDL07289.1|3131901_3132834_-	tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.5	2.3e-25
VDL07291.1|3132871_3133759_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	3.4e-18
VDL07293.1|3134002_3135610_+	thiamine pyrophosphate protein	NA	E5ERI2	Ostreococcus_lucimarinus_virus	24.5	1.2e-24
VDL07295.1|3135688_3136882_+	glutaryl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL07297.1|3137019_3137463_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07299.1|3137595_3139155_-	thiamine pyrophosphate protein	NA	NA	NA	NA	NA
VDL07301.1|3139283_3139964_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	2.8e-28
VDL07303.1|3140057_3140750_-	binding-protein-dependent transport system inner membrane protein	NA	NA	NA	NA	NA
VDL07305.1|3140772_3141564_-	amino acid-binding periplasmic protein	NA	NA	NA	NA	NA
VDL07307.1|3141590_3142496_-	arginase	NA	NA	NA	NA	NA
VDL07309.1|3142688_3142973_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL07311.1|3143110_3143347_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07313.1|3143617_3144640_-	extracellular solute-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	40.7	1.6e-67
VDL07315.1|3144776_3145814_-	Threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	37.8	3.6e-35
VDL07318.1|3145833_3146475_-	phosphoribosylaminoimidazole carboxylase ATPase subunit	NA	NA	NA	NA	NA
VDL07320.1|3147027_3147543_-	N5-carboxyaminoimidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.6	7.0e-16
VDL07322.1|3147692_3148172_-	membrane protein	NA	NA	NA	NA	NA
VDL07324.1|3148179_3148344_-	membrane protein	NA	NA	NA	NA	NA
VDL07326.1|3148435_3148837_-	DNA-binding protein	NA	NA	NA	NA	NA
VDL07328.1|3148839_3149013_-	mRNA interferase toxin MqsR	NA	NA	NA	NA	NA
VDL07330.1|3149145_3150027_-	phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.1	1.8e-51
VDL07332.1|3150251_3150698_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07334.1|3150782_3151847_-	fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
VDL07336.1|3151983_3152565_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07338.1|3152799_3153930_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
VDL07340.1|3154107_3155334_+	formamidase	NA	A0A1V0S8X7	Catovirus	58.8	5.2e-134
VDL07342.1|3155392_3155908_+	transporter protein	NA	NA	NA	NA	NA
VDL07344.1|3155930_3156257_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07346.1|3156290_3157481_+	formate dehydrogenase	NA	NA	NA	NA	NA
VDL07348.1|3157554_3157959_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07350.1|3158175_3158526_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07352.1|3158498_3159131_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 39
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3169810	3215331	4108173	tRNA,transposase	Tupanvirus(25.0%)	52	NA	NA
VDL07377.1|3169810_3171760_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	4.1e-125
VDL07379.1|3172147_3172924_+	two-component response regulator	NA	NA	NA	NA	NA
VDL07381.1|3172929_3173322_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07383.1|3173318_3173447_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07385.1|3174034_3174268_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07387.1|3174254_3174581_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07389.1|3174577_3174694_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07391.1|3174690_3175329_-	membrane protein	NA	A0A127AWB9	Bacillus_phage	37.3	2.0e-20
VDL07393.1|3175819_3176077_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07395.1|3176143_3176776_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07397.1|3176918_3178556_+	Inner membrane protein YccS	NA	NA	NA	NA	NA
VDL07399.1|3178461_3178980_-	membrane transport protein	NA	NA	NA	NA	NA
VDL07401.1|3178925_3179801_-	membrane transport protein	NA	NA	NA	NA	NA
VDL07403.1|3179812_3180586_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07405.1|3180612_3181566_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07407.1|3182045_3182702_-	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
VDL07409.1|3182716_3183199_-	membrane protein	NA	NA	NA	NA	NA
VDL07411.1|3183186_3183558_-	membrane protein	NA	NA	NA	NA	NA
VDL07413.1|3183672_3184383_-	membrane protein	NA	NA	NA	NA	NA
VDL07415.1|3184535_3184817_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07417.1|3185228_3185636_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL07419.1|3186466_3187279_-|tRNA	tRNA pseudouridine synthase A	tRNA	NA	NA	NA	NA
VDL07421.1|3187282_3188866_-	membrane protein	NA	NA	NA	NA	NA
VDL07423.1|3189036_3190113_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VDL07425.1|3190353_3191430_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
VDL07427.1|3191511_3192162_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
VDL07429.1|3192176_3193580_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
VDL07431.1|3193863_3194682_-	exported protein	NA	NA	NA	NA	NA
VDL07433.1|3194678_3195383_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.6e-13
VDL07435.1|3195379_3195502_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07437.1|3196282_3197398_+	molybdenum-binding protein	NA	NA	NA	NA	NA
VDL07439.1|3197431_3197806_-	exported protein	NA	NA	NA	NA	NA
VDL07441.1|3197828_3198986_-	formate dehydrogenase subunit C	NA	NA	NA	NA	NA
VDL07443.1|3198998_3199232_-	lipoprotein	NA	NA	NA	NA	NA
VDL07444.1|3199228_3199621_-	Formate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
VDL07446.1|3199866_3202836_-	formate dehydrogenase large subunit	NA	NA	NA	NA	NA
VDL07448.1|3202850_3203060_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07450.1|3203211_3203841_-	Chaperone protein TorD	NA	NA	NA	NA	NA
VDL07452.1|3203837_3205895_-	iron-sulfur binding protein	NA	NA	NA	NA	NA
VDL07454.1|3205951_3206632_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07456.1|3206628_3207189_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07458.1|3207195_3208293_-	iron sulfur binding protein	NA	NA	NA	NA	NA
VDL07460.1|3208445_3209039_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
VDL07463.1|3209035_3210016_+	molybdopterin biosynthesis protein	NA	NA	NA	NA	NA
VDL07465.1|3210015_3210327_+	molybdopterin biosynthesis protein	NA	NA	NA	NA	NA
VDL07467.1|3210340_3210883_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
VDL07469.1|3210892_3211729_-	lipoprotein	NA	NA	NA	NA	NA
VDL07471.1|3211762_3212824_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.8	2.9e-80
VDL07473.1|3212865_3213891_-	two-component histidine kinase	NA	NA	NA	NA	NA
VDL07475.1|3213933_3214242_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07477.1|3214377_3214818_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07479.1|3214845_3215331_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 40
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3226603	3238857	4108173	transposase	Staphylococcus_phage(50.0%)	16	NA	NA
VDL07499.1|3226603_3227440_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07501.1|3227379_3227553_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07503.1|3227649_3228276_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07505.1|3228248_3228599_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07507.1|3228608_3229298_-	membrane protein	NA	NA	NA	NA	NA
VDL07509.1|3229357_3229795_-	Putative esterase	NA	NA	NA	NA	NA
VDL07511.1|3229840_3230734_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
VDL07513.1|3230781_3231954_-	enoly-CoA hydratase	NA	NA	NA	NA	NA
VDL07515.1|3231950_3233105_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL07517.1|3233301_3233652_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07519.1|3233641_3234076_-	Persistence and stress-resistance toxin PasT	NA	NA	NA	NA	NA
VDL07521.1|3234092_3235046_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07523.1|3235193_3235661_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	45.1	6.2e-27
VDL07525.1|3235641_3236799_-	membrane protein	NA	A0A127AWB9	Bacillus_phage	36.2	2.3e-14
VDL07527.1|3236864_3237791_-	membrane protein	NA	NA	NA	NA	NA
VDL07529.1|3238416_3238857_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 41
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3281131	3316640	4108173	transposase	Sulfitobacter_phage(50.0%)	39	NA	NA
VDL07617.1|3281131_3281920_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07619.1|3282101_3282314_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07621.1|3282479_3283028_+	flagellar protein FliL	NA	NA	NA	NA	NA
VDL07623.1|3283030_3284041_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
VDL07625.1|3284033_3284534_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
VDL07627.1|3284544_3284886_+	flagellar protein FliO	NA	NA	NA	NA	NA
VDL07629.1|3284897_3285689_+	flagellar biosynthesis protein FliP	NA	NA	NA	NA	NA
VDL07631.1|3285705_3285975_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
VDL07633.1|3285997_3286786_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
VDL07635.1|3287478_3287772_-|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL07637.1|3289747_3290119_-	methyl-accepting chemotaxis protein II	NA	NA	NA	NA	NA
VDL07639.1|3290112_3291231_-	methyl-accepting chemotaxis protein II	NA	NA	NA	NA	NA
VDL07641.1|3291487_3292126_-	methyl-accepting chemotaxis protein I	NA	NA	NA	NA	NA
VDL07643.1|3292271_3293357_-	methyl-accepting chemotaxis protein I	NA	NA	NA	NA	NA
VDL07645.1|3293384_3293534_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
VDL07647.1|3293571_3294918_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
VDL07649.1|3294951_3296598_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
VDL07651.1|3296667_3297129_-	flagellar rod assembly protein FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.9	5.5e-12
VDL07653.1|3297708_3298842_-	flagellar basal body P-ring protein	NA	NA	NA	NA	NA
VDL07655.1|3298844_3299534_-	flagellar basal body L-ring protein	NA	NA	NA	NA	NA
VDL07657.1|3299533_3300319_-	flagellar basal body rod protein FlgG	NA	NA	NA	NA	NA
VDL07659.1|3300362_3301127_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
VDL07661.1|3301165_3302587_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
VDL07663.1|3302652_3303357_-	flagellar basal body rod modification protein	NA	NA	NA	NA	NA
VDL07665.1|3303404_3303824_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
VDL07667.1|3303836_3304244_-	flagellar basal-body rod protein FlgB	NA	NA	NA	NA	NA
VDL07669.1|3304427_3305138_+	flagellar basal body P-ring biosynthesis protein FlgA	NA	NA	NA	NA	NA
VDL07671.1|3305264_3305555_+	negative regulator of flagellin synthesis	NA	NA	NA	NA	NA
VDL07673.1|3305419_3308443_-	signal recognition particle protein	NA	NA	NA	NA	NA
VDL07675.1|3308439_3309216_-	type III secretion pore protein	NA	NA	NA	NA	NA
VDL07677.1|3309243_3310557_-	type III secretion pore protein	NA	NA	NA	NA	NA
VDL07679.1|3310560_3311715_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
VDL07681.1|3312107_3312401_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL07682.1|3312373_3313123_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL07684.1|3313289_3314078_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL07686.1|3314146_3314827_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
VDL07688.1|3314823_3315594_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
VDL07690.1|3315690_3316317_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07692.1|3316289_3316640_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 42
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3342641	3394050	4108173	transposase	Feldmannia_species_virus(33.33%)	54	NA	NA
VDL07743.1|3342641_3343595_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07745.1|3343612_3344449_+	Inner membrane protein YbhN	NA	NA	NA	NA	NA
VDL07747.1|3344502_3345648_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07749.1|3345634_3346390_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07751.1|3346506_3346686_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07753.1|3346751_3347102_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07755.1|3347074_3347704_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07757.1|3347826_3348969_+	Alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase	NA	NA	NA	NA	NA
VDL07759.1|3349059_3350439_+	Alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase 2	NA	NA	NA	NA	NA
VDL07762.1|3350506_3353848_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
VDL07764.1|3353844_3356040_+	1,4-alpha-glucan branching protein	NA	NA	NA	NA	NA
VDL07766.1|3356044_3358165_+	glycosyl hydrolase	NA	NA	NA	NA	NA
VDL07769.1|3358161_3359916_+	alpha amylase	NA	NA	NA	NA	NA
VDL07771.1|3359976_3360360_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07773.1|3360344_3361286_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
VDL07775.1|3363816_3364902_-	two-component sensor kinase	NA	B5LWN8	Feldmannia_species_virus	26.7	6.9e-05
VDL07777.1|3364868_3366788_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07779.1|3366888_3367743_-	pyridoxine kinase	NA	NA	NA	NA	NA
VDL07781.1|3367739_3368555_-	Pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
VDL07783.1|3368614_3369946_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDL07785.1|3369984_3370491_+	membrane protein	NA	NA	NA	NA	NA
VDL07787.1|3370730_3371084_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07789.1|3371155_3371581_+	universal stress family protein	NA	NA	NA	NA	NA
VDL07791.1|3371613_3372501_+	exported protein	NA	NA	NA	NA	NA
VDL07793.1|3372503_3372827_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07795.1|3372823_3373162_-	Protease PrtS	NA	NA	NA	NA	NA
VDL07797.1|3373247_3373973_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07799.1|3374063_3374468_+	membrane protein	NA	NA	NA	NA	NA
VDL07801.1|3374649_3375081_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07803.1|3375313_3375721_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07805.1|3375819_3376446_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07807.1|3376418_3376868_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07808.1|3376864_3377491_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07809.1|3377515_3377815_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL07811.1|3377907_3378447_+	bacterioferritin comigratory protein	NA	NA	NA	NA	NA
VDL07812.1|3378553_3378898_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.0e-31
VDL07814.1|3378955_3380404_-	racemase	NA	NA	NA	NA	NA
VDL07816.1|3380591_3380927_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07818.1|3381117_3383733_+	exported protein	NA	NA	NA	NA	NA
VDL07820.1|3383815_3384316_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	4.7e-25
VDL07822.1|3384425_3385127_+	glutathione transferase	NA	NA	NA	NA	NA
VDL07823.1|3385138_3385603_+	acetyltransferase	NA	NA	NA	NA	NA
VDL07825.1|3385617_3385893_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07827.1|3385889_3386666_+	lipoate-protein ligase A	NA	NA	NA	NA	NA
VDL07829.1|3386694_3387522_+	lipoprotein	NA	NA	NA	NA	NA
VDL07831.1|3387647_3388118_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07833.1|3388244_3389138_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
VDL07835.1|3389185_3390367_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
VDL07837.1|3390379_3391195_-	exported protein	NA	NA	NA	NA	NA
VDL07839.1|3391328_3391856_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07841.1|3391852_3392350_-	hypothetical protein	NA	NA	NA	NA	NA
VDL07843.1|3392497_3392875_+	membrane protein	NA	NA	NA	NA	NA
VDL07845.1|3392832_3393117_+	hypothetical protein	NA	NA	NA	NA	NA
VDL07847.1|3393096_3394050_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 43
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3466836	3634140	4108173	tRNA,integrase,transposase,protease	Planktothrix_phage(21.05%)	165	3565581:3565600	3620363:3620382
VDL07986.1|3466836_3467277_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07988.1|3467263_3467791_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL07990.1|3467896_3468589_+	membrane protein	NA	NA	NA	NA	NA
VDL07992.1|3468602_3469319_-	short chain dehydrogenase	NA	NA	NA	NA	NA
VDL07994.1|3469470_3470598_-	alanine racemase	NA	NA	NA	NA	NA
VDL07996.1|3470726_3471557_+	phytoene synthase	NA	NA	NA	NA	NA
VDL07998.1|3471558_3472422_+	phytoene synthase	NA	NA	NA	NA	NA
VDL08000.1|3472804_3473752_+	exported protein	NA	NA	NA	NA	NA
VDL08002.1|3473774_3474161_-	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.1	1.8e-16
VDL08004.1|3474170_3474731_-	membrane protein	NA	NA	NA	NA	NA
VDL08007.1|3474819_3475605_-	ABC transporter permease	NA	NA	NA	NA	NA
VDL08008.1|3475601_3476657_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	1.9e-23
VDL08010.1|3476695_3477325_+	membrane protein	NA	NA	NA	NA	NA
VDL08012.1|3477347_3477863_+	exported protein	NA	NA	NA	NA	NA
VDL08014.1|3477891_3478692_+	exported protein	NA	NA	NA	NA	NA
VDL08016.1|3478778_3479711_+	thiamine biosynthesis lipoprotein	NA	NA	NA	NA	NA
VDL08018.1|3479710_3481090_+	oxidoreductase	NA	NA	NA	NA	NA
VDL08020.1|3481105_3482062_-	exported protein	NA	NA	NA	NA	NA
VDL08022.1|3482112_3483555_-	N-acyl-D-glutamate deacylase	NA	NA	NA	NA	NA
VDL08024.1|3484270_3484621_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08026.1|3484628_3485081_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08028.1|3485148_3485979_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08030.1|3485988_3487197_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08032.1|3487354_3488050_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08034.1|3488146_3489544_-	tracheal colonization factor	NA	NA	NA	NA	NA
VDL08036.1|3490473_3491868_-	tracheal colonization factor	NA	NA	NA	NA	NA
VDL08037.1|3491960_3492914_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08039.1|3493670_3496268_-	chaperone protein ClpB	NA	A0A223W0B1	Agrobacterium_phage	33.8	5.0e-126
VDL08041.1|3496605_3497334_+	transcriptional regulatory protein	NA	NA	NA	NA	NA
VDL08043.1|3497354_3497591_+	exported protein	NA	NA	NA	NA	NA
VDL08045.1|3497587_3498484_+	exported protein	NA	NA	NA	NA	NA
VDL08047.1|3498517_3498859_-	ferredoxin	NA	NA	NA	NA	NA
VDL08049.1|3498855_3499458_-	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
VDL08051.1|3499522_3499741_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08053.1|3499765_3500092_-	exported protein	NA	NA	NA	NA	NA
VDL08055.1|3500236_3500791_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
VDL08057.1|3500807_3501143_-	RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
VDL08059.1|3501135_3501582_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08061.1|3501809_3502238_+	lipoprotein	NA	NA	NA	NA	NA
VDL08063.1|3502245_3502464_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08065.1|3502475_3503360_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08067.1|3503995_3504676_+	4-hydroxy-4-methyl-2-oxoglutarate aldolase/4-carboxy-4-hydroxy-2-oxoadipate aldolase	NA	NA	NA	NA	NA
VDL08069.1|3504672_3505875_+	aspartate aminotransferase	NA	NA	NA	NA	NA
VDL08071.1|3506037_3506754_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL08073.1|3506857_3507547_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
VDL08075.1|3507539_3508229_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
VDL08077.1|3508248_3508986_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	5.9e-32
VDL08079.1|3509098_3510034_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08081.1|3510094_3510259_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08083.1|3510379_3511243_+	membrane protein	NA	NA	NA	NA	NA
VDL08085.1|3511308_3511659_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08087.1|3511631_3512261_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08089.1|3512362_3512803_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08091.1|3512830_3513316_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08093.1|3513518_3514508_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
VDL08095.1|3514591_3514945_+	exported protein	NA	NA	NA	NA	NA
VDL08097.1|3515022_3515454_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08099.1|3515705_3516839_+	membrane protein	NA	A0A0R6PEZ3	Moraxella_phage	41.2	1.4e-35
VDL08101.1|3516873_3517290_+	membrane protein	NA	NA	NA	NA	NA
VDL08103.1|3517304_3517883_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08105.1|3517907_3518861_-	exported protein	NA	NA	NA	NA	NA
VDL08107.1|3518900_3519818_-	oxidoreductase	NA	NA	NA	NA	NA
VDL08109.1|3519960_3520866_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08111.1|3520873_3521566_-	adolase	NA	NA	NA	NA	NA
VDL08113.1|3521949_3522891_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
VDL08115.1|3522966_3523089_-	membrane protein	NA	NA	NA	NA	NA
VDL08117.1|3523117_3524815_-	sodium/solute symporter	NA	NA	NA	NA	NA
VDL08119.1|3525249_3526671_-	membrane protein	NA	NA	NA	NA	NA
VDL08121.1|3526823_3527603_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
VDL08123.1|3527727_3528606_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08125.1|3528711_3529884_+	racemase	NA	Q6A202	Oenococcus_phage	30.4	2.6e-29
VDL08127.1|3530373_3530844_+	lipoprotein	NA	NA	NA	NA	NA
VDL08129.1|3530836_3531646_+	2-pyrone-4,6-dicarboxylic acid hydrolase	NA	NA	NA	NA	NA
VDL08131.1|3531797_3532208_+	dioxygenase	NA	NA	NA	NA	NA
VDL08133.1|3532204_3532645_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08135.1|3532631_3533159_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08137.1|3533257_3534139_-	oxidoreductase	NA	NA	NA	NA	NA
VDL08139.1|3534216_3535596_-	regulatory protein	NA	NA	NA	NA	NA
VDL08141.1|3535634_3536480_-	membrane protein	NA	NA	NA	NA	NA
VDL08143.1|3536495_3536837_-	exported protein	NA	NA	NA	NA	NA
VDL08145.1|3536843_3537380_-	exported protein	NA	NA	NA	NA	NA
VDL08147.1|3537551_3538127_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08149.1|3538227_3538965_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
VDL08151.1|3539032_3540670_-	poly-beta-hydroxybutyrate polymerase	NA	NA	NA	NA	NA
VDL08153.1|3540777_3541533_-	Polyphenol oxidase	NA	NA	NA	NA	NA
VDL08155.1|3541520_3542483_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
VDL08156.1|3542536_3543385_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
VDL08158.1|3543446_3545522_-	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
VDL08159.1|3545686_3546601_+	transcription accessory protein	NA	NA	NA	NA	NA
VDL08161.1|3546618_3548061_+	transcription accessory protein	NA	NA	NA	NA	NA
VDL08162.1|3548141_3549497_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
VDL08164.1|3549608_3550217_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08166.1|3550572_3550980_+	taurine catabolism dioxygenase	NA	NA	NA	NA	NA
VDL08168.1|3550976_3551699_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
VDL08170.1|3551753_3552737_+	exported protein	NA	NA	NA	NA	NA
VDL08172.1|3552866_3553349_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08174.1|3553373_3553814_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08176.1|3553810_3554713_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08177.1|3554800_3555559_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
VDL08179.1|3555571_3556663_-	Cell division protein ZapE	NA	NA	NA	NA	NA
VDL08181.1|3556760_3558188_-	2-oxoglutarate dehydrogenase complex subunit dihydrolipoamide dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
VDL08183.1|3558417_3559632_-	2-oxoglutarate dehydrogenase complex subunit dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
VDL08185.1|3559677_3562548_-	2-oxoglutarate dehydrogenase complex subunit E1	NA	NA	NA	NA	NA
VDL08187.1|3562872_3563082_-	membrane protein	NA	NA	NA	NA	NA
VDL08189.1|3563060_3564923_-	membrane protein	NA	NA	NA	NA	NA
VDL08190.1|3564958_3565447_-	AsnC family transcription regulator	NA	NA	NA	NA	NA
3565581:3565600	attL	CGCCCAGGCCGGCGCCACGC	NA	NA	NA	NA
VDL08192.1|3565696_3568267_+	pyruvate dehydrogenase subunit E1	NA	NA	NA	NA	NA
VDL08194.1|3568421_3570704_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
VDL08196.1|3570881_3571505_+	serotype 2 fimbrial subunit	NA	NA	NA	NA	NA
VDL08198.1|3571603_3572230_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08200.1|3572202_3572553_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08202.1|3572599_3573154_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
VDL08204.1|3573221_3574067_-	3',5'-nucleoside bisphosphate phosphatase	NA	NA	NA	NA	NA
VDL08206.1|3574136_3574700_-	hydrolase	NA	NA	NA	NA	NA
VDL08208.1|3575105_3576125_-|integrase	integrase	integrase	NA	NA	NA	NA
VDL08210.1|3576064_3576907_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08212.1|3576999_3578613_-	ComE operon protein 3	NA	NA	NA	NA	NA
VDL08214.1|3578806_3582508_-	outer membrane ligand binding protein	NA	NA	NA	NA	NA
VDL08216.1|3583465_3585442_-|protease	serine protease	protease	NA	NA	NA	NA
VDL08218.1|3585429_3586695_-|protease	serine protease	protease	NA	NA	NA	NA
VDL08220.1|3586976_3587804_-	deoxyribonuclease	NA	NA	NA	NA	NA
VDL08222.1|3587837_3588533_-	lipoprotein releasing system ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	7.0e-35
VDL08224.1|3588525_3589806_-	lipoprotein releasing system transmembrane protein	NA	NA	NA	NA	NA
VDL08226.1|3590060_3590792_+	exported protein	NA	NA	NA	NA	NA
VDL08228.1|3591222_3592476_+	single-stranded-DNA-specific exonuclease	NA	A7KV88	Bacillus_phage	27.8	8.2e-34
VDL08230.1|3592801_3593683_+	peptide chain release factor 2	NA	NA	NA	NA	NA
VDL08232.1|3593712_3594468_+	short chain dehydrogenase	NA	NA	NA	NA	NA
VDL08234.1|3594474_3595935_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	32.0	1.5e-50
VDL08238.1|3596036_3596339_+	membrane protein	NA	NA	NA	NA	NA
VDL08240.1|3596335_3596968_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08242.1|3597046_3598912_-	long-chain fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
VDL08244.1|3598908_3599655_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.4	4.6e-08
VDL08246.1|3599732_3600848_-	amino acids binding protein	NA	NA	NA	NA	NA
VDL08248.1|3600904_3601063_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08250.1|3601339_3601501_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08252.1|3601752_3602631_-	high-affinity branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
VDL08254.1|3602630_3603455_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
VDL08256.1|3603622_3604066_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08258.1|3604052_3604577_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08259.1|3604789_3607639_+	two-component histidine kinase	NA	NA	NA	NA	NA
VDL08261.1|3607620_3608349_-	two-component response regulator	NA	NA	NA	NA	NA
VDL08263.1|3608489_3609953_-	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	32.5	1.7e-43
VDL08265.1|3609949_3610321_-	membrane protein	NA	NA	NA	NA	NA
VDL08267.1|3610338_3611652_+	membrane protein	NA	NA	NA	NA	NA
VDL08269.1|3611688_3612147_+	Inosine-5'-monophosphate dehydrogenase	NA	NA	NA	NA	NA
VDL08271.1|3612259_3613207_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08273.1|3613203_3614181_-|tRNA	tRNA-dihydrouridine synthase A	tRNA	NA	NA	NA	NA
VDL08275.1|3614356_3615343_+	homoserine kinase	NA	NA	NA	NA	NA
VDL08277.1|3615386_3616187_+	membrane protein	NA	NA	NA	NA	NA
VDL08279.1|3616408_3616819_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08281.1|3616989_3617568_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08283.1|3618089_3618692_-	RNA-binding protein YhbY	NA	NA	NA	NA	NA
VDL08285.1|3618710_3619343_+	rRNA large subunit methyltransferase E	NA	NA	NA	NA	NA
VDL08287.1|3619580_3621467_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
3620363:3620382	attR	GCGTGGCGCCGGCCTGGGCG	NA	NA	NA	NA
VDL08290.1|3621485_3622328_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
VDL08292.1|3622324_3623836_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
VDL08294.1|3623901_3624696_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08296.1|3624697_3624808_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08298.1|3624926_3626420_-	exopolyphosphatase	NA	NA	NA	NA	NA
VDL08300.1|3626655_3628737_+	polyphosphate kinase	NA	NA	NA	NA	NA
VDL08302.1|3628931_3629972_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
VDL08304.1|3630106_3631123_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
VDL08306.1|3631144_3632002_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
VDL08308.1|3632045_3632822_+	phosphate transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
VDL08310.1|3633189_3634140_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 44
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3649615	3692154	4108173	tRNA,integrase,transposase	uncultured_Mediterranean_phage(37.5%)	48	3646144:3646160	3694784:3694800
3646144:3646160	attL	GGACTGGGCCGGCCTGG	NA	NA	NA	NA
VDL08341.1|3649615_3650152_-|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL08343.1|3650960_3651602_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
VDL08345.1|3651692_3653129_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
VDL08347.1|3653316_3654360_+|tRNA	S-adenosylmethionine--tRNA ribosyltransferase-isomerase	tRNA	NA	NA	NA	NA
VDL08349.1|3654356_3655493_+|tRNA	queuine tRNA-ribosyltransferase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
VDL08351.1|3655637_3655982_+	secreted protein	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
VDL08353.1|3656048_3657929_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
VDL08355.1|3657978_3658914_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
VDL08357.1|3659333_3660191_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL08359.1|3660322_3660646_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08361.1|3660635_3661049_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08363.1|3661205_3662633_+|tRNA	tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase	tRNA	NA	NA	NA	NA
VDL08365.1|3662629_3663652_+	PhoH-like protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
VDL08367.1|3663641_3664115_+	endoribonuclease	NA	NA	NA	NA	NA
VDL08369.1|3664255_3665143_+	magnesium and cobalt efflux protein	NA	NA	NA	NA	NA
VDL08371.1|3665139_3666783_+	Apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
VDL08373.1|3666779_3667829_-	aldo/keto reductase	NA	NA	NA	NA	NA
VDL08375.1|3668925_3669555_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL08377.1|3669731_3670364_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
VDL08379.1|3670372_3670762_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
VDL08381.1|3670814_3671867_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
VDL08383.1|3671863_3672220_-	Chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
VDL08385.1|3672158_3672722_-	Chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
VDL08387.1|3672730_3674440_-	methyl-accepting chemotaxis protein I	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.7	3.7e-13
VDL08389.1|3674513_3675014_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
VDL08391.1|3675028_3677086_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
VDL08393.1|3677112_3677406_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
VDL08395.1|3677507_3678455_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
VDL08397.1|3678467_3679343_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
VDL08398.1|3679336_3680026_-	transcriptional activator FlhC	NA	NA	NA	NA	NA
VDL08400.1|3680060_3680384_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
VDL08402.1|3680819_3681557_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
VDL08404.1|3681855_3682518_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08406.1|3682547_3682808_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08408.1|3683051_3683237_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
VDL08409.1|3683387_3683669_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08411.1|3683685_3684546_-	peptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
VDL08413.1|3684542_3684878_-	exported protein	NA	NA	NA	NA	NA
VDL08415.1|3684931_3685582_-	molybdenum cofactor biosynthesis protein MogA	NA	NA	NA	NA	NA
VDL08417.1|3685766_3686945_+	phosphate transporter	NA	NA	NA	NA	NA
VDL08419.1|3686951_3687242_+	phosphate transporter	NA	NA	NA	NA	NA
VDL08421.1|3687262_3688207_-	inner membrane protein	NA	NA	NA	NA	NA
VDL08423.1|3688252_3688570_-	Chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
VDL08425.1|3688572_3689511_-	curved DNA-binding protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
VDL08427.1|3689688_3690174_+	acetyltransferase	NA	NA	NA	NA	NA
VDL08429.1|3690192_3690741_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08431.1|3690772_3690925_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08433.1|3691017_3692154_+|integrase	integrase	integrase	NA	NA	NA	NA
3694784:3694800	attR	GGACTGGGCCGGCCTGG	NA	NA	NA	NA
>prophage 45
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3703758	3752111	4108173	transposase	Erysipelothrix_phage(20.0%)	50	NA	NA
VDL08455.1|3703758_3704385_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08457.1|3704357_3704546_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08459.1|3704502_3704712_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08461.1|3704754_3705930_+	flagellin	NA	NA	NA	NA	NA
VDL08463.1|3706150_3707941_-	dihydrolipoamide dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	2.4e-39
VDL08465.1|3707953_3709615_-	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
VDL08467.1|3709627_3712333_-	pyruvate dehydrogenase component E1	NA	NA	NA	NA	NA
VDL08469.1|3712625_3714380_+	tw-component sensor kinase	NA	NA	NA	NA	NA
VDL08471.1|3714376_3715003_+	two-component response regulator	NA	NA	NA	NA	NA
VDL08473.1|3714999_3715851_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.1e-33
VDL08475.1|3715925_3716204_+	oligopeptidase A	NA	NA	NA	NA	NA
VDL08477.1|3716188_3718039_+	oligopeptidase A	NA	NA	NA	NA	NA
VDL08479.1|3718190_3718841_+	exported protein	NA	NA	NA	NA	NA
VDL08481.1|3718986_3719238_+	membrane protein	NA	NA	NA	NA	NA
VDL08483.1|3719307_3720690_-	outer membrane lipoprotein	NA	NA	NA	NA	NA
VDL08485.1|3720686_3723866_-	acriflavine resistance protein B	NA	NA	NA	NA	NA
VDL08487.1|3723823_3724423_-	efflux system inner membrane protein	NA	NA	NA	NA	NA
VDL08489.1|3724655_3725591_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08491.1|3725642_3726374_-	RNA pseudouridylate synthase	NA	NA	NA	NA	NA
VDL08493.1|3726433_3727006_+	chorismate pyruvate-lyase	NA	NA	NA	NA	NA
VDL08495.1|3727078_3727894_+	membrane protein	NA	NA	NA	NA	NA
VDL08497.1|3728053_3728257_+	membrane protein	NA	NA	NA	NA	NA
VDL08499.1|3728600_3728891_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL08501.1|3728863_3729529_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL08503.1|3729666_3730716_-	oxidoreductase	NA	NA	NA	NA	NA
VDL08505.1|3730820_3731342_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08507.1|3731328_3731769_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08509.1|3731864_3732530_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
VDL08511.1|3732799_3733180_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
VDL08513.1|3733524_3733632_+	membrane protein	NA	NA	NA	NA	NA
VDL08515.1|3733628_3734357_+	membrane protein	NA	NA	NA	NA	NA
VDL08517.1|3734364_3734745_-	membrane protein	NA	NA	NA	NA	NA
VDL08519.1|3734898_3736173_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08521.1|3736361_3737138_-	Bifunctional enzyme CysN/CysC	NA	NA	NA	NA	NA
VDL08523.1|3737660_3739370_-	sulfate adenylyltransferase subunit 2	NA	NA	NA	NA	NA
VDL08525.1|3739366_3740431_-	sulfate/thiosulfate transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	3.8e-24
VDL08527.1|3740455_3741238_-	molybdenum ABC transporter permease ModB	NA	NA	NA	NA	NA
VDL08529.1|3741352_3742024_-	molybdenum ABC transporter permease ModB	NA	NA	NA	NA	NA
VDL08531.1|3742048_3742252_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08533.1|3742267_3743302_-	sulfate-binding protein	NA	NA	NA	NA	NA
VDL08536.1|3743384_3743927_-	antioxidant protein	NA	NA	NA	NA	NA
VDL08538.1|3744215_3746042_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL08540.1|3746283_3747213_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
VDL08542.1|3747212_3747962_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
VDL08544.1|3748033_3748561_-	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	38.2	1.1e-27
VDL08546.1|3748542_3748911_-	histone deacetylase family protein	NA	NA	NA	NA	NA
VDL08548.1|3748966_3750031_+	membrane-bound lytic murein transglycosylase B	NA	NA	NA	NA	NA
VDL08550.1|3750169_3751081_-	cysteine synthase B	NA	A0A1X9I5K7	Streptococcus_phage	38.8	8.0e-47
VDL08552.1|3751161_3751512_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08554.1|3751484_3752111_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 46
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3771533	3793896	4108173	transposase	Staphylococcus_phage(33.33%)	27	NA	NA
VDL08589.1|3771533_3771884_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08591.1|3771856_3772195_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08593.1|3772616_3773009_+	phage-like protein	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
VDL08595.1|3773285_3774197_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.4e-05
VDL08597.1|3774321_3775296_+	exported protein	NA	NA	NA	NA	NA
VDL08599.1|3775292_3775409_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08602.1|3775405_3776245_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08603.1|3776343_3777429_-	DNA polymerase IV	NA	NA	NA	NA	NA
VDL08606.1|3777492_3778392_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08608.1|3778551_3780465_+	peptidase	NA	NA	NA	NA	NA
VDL08610.1|3780600_3783213_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
VDL08612.1|3783214_3783949_-	serine/threonine protein phosphatase 1	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.2	1.9e-62
VDL08614.1|3784112_3785294_+	membrane protein	NA	NA	NA	NA	NA
VDL08616.1|3785290_3785503_+	membrane protein	NA	NA	NA	NA	NA
VDL08618.1|3785499_3786480_-	oxidoreductase	NA	NA	NA	NA	NA
VDL08620.1|3786525_3787143_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.4	9.9e-49
VDL08622.1|3787154_3787352_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	59.3	1.6e-08
VDL08624.1|3787629_3789315_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	7.6e-43
VDL08626.1|3789338_3789755_+	ferredoxin	NA	NA	NA	NA	NA
VDL08628.1|3789751_3790192_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08630.1|3790178_3790703_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08632.1|3790815_3791067_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08634.1|3791260_3791476_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08636.1|3791572_3792691_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
VDL08638.1|3792809_3793022_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08640.1|3793181_3793391_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08642.1|3793455_3793896_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 47
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3815160	3874700	4108173	holin,transposase	Ostreococcus_lucimarinus_virus(25.0%)	59	NA	NA
VDL08689.1|3815160_3815601_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08691.1|3815587_3815821_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08693.1|3816194_3816806_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08695.1|3817276_3818992_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
VDL08697.1|3819002_3819494_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
VDL08699.1|3819566_3820583_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
VDL08701.1|3820750_3821530_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
VDL08703.1|3821548_3822076_-	lipoprotein	NA	NA	NA	NA	NA
VDL08705.1|3822369_3822639_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
VDL08707.1|3822729_3824889_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
VDL08709.1|3825009_3825729_+	lipoprotein	NA	NA	NA	NA	NA
VDL08711.1|3825725_3826166_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08713.1|3826152_3826383_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08715.1|3826813_3828031_+	threonine dehydratase	NA	NA	NA	NA	NA
VDL08717.1|3828024_3828636_-	hypothetical protein	NA	K4HZX4	Acidithiobacillus_phage	32.5	3.3e-12
VDL08719.1|3829269_3830247_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
VDL08721.1|3830390_3831158_+	triosephosphate isomerase	NA	NA	NA	NA	NA
VDL08723.1|3832390_3834622_+|holin	high-affinity choline transport protein	holin	NA	NA	NA	NA
VDL08725.1|3834644_3835445_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL08727.1|3835726_3836959_+	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
VDL08729.1|3837069_3838059_+	exported protein	NA	NA	NA	NA	NA
VDL08731.1|3838089_3839478_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08733.1|3839525_3839900_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08734.1|3839890_3841018_+	argininosuccinate lyase	NA	NA	NA	NA	NA
VDL08736.1|3841076_3841808_+	exported protein	NA	NA	NA	NA	NA
VDL08738.1|3841815_3842061_+	exported protein	NA	NA	NA	NA	NA
VDL08740.1|3842345_3842636_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL08742.1|3842608_3843406_+|transposase	transposase for IS1663	transposase	NA	NA	NA	NA
VDL08744.1|3843474_3844299_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
VDL08746.1|3844376_3845252_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08748.1|3845470_3846622_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
VDL08750.1|3846625_3846979_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08752.1|3846972_3847656_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08753.1|3847784_3848756_+	exported protein	NA	NA	NA	NA	NA
VDL08755.1|3848780_3850865_+	Thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
VDL08757.1|3850931_3851924_-	exported protein	NA	NA	NA	NA	NA
VDL08759.1|3852032_3853367_-	Gamma-glutamylputrescine oxidoreductase	NA	NA	NA	NA	NA
VDL08761.1|3853392_3855405_-	hydantoin utilization protein B	NA	NA	NA	NA	NA
VDL08763.1|3855401_3857450_-	hydantoin utilization protein A	NA	NA	NA	NA	NA
VDL08765.1|3857553_3858201_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL08767.1|3858383_3858836_+	azurin	NA	NA	NA	NA	NA
VDL08769.1|3858879_3859551_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08771.1|3859565_3861059_-	multidrug efflux system outer membrane protein	NA	NA	NA	NA	NA
VDL08773.1|3861055_3863224_-	multidrug efflux system membrane protein	NA	S5VTK5	Leptospira_phage	19.8	1.4e-28
VDL08776.1|3863349_3863706_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08778.1|3863844_3863937_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08780.1|3864182_3865289_-	HlyD family secretion protein	NA	NA	NA	NA	NA
VDL08782.1|3865412_3866081_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL08783.1|3866812_3867253_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08785.1|3867335_3869294_+|holin	high-affinity choline transport protein	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
VDL08787.1|3869321_3870023_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08789.1|3870169_3870985_+	Putative lipid kinase BmrU	NA	NA	NA	NA	NA
VDL08791.1|3870981_3871797_+	DNA repair exonuclease	NA	NA	NA	NA	NA
VDL08793.1|3871813_3872617_+	membrane protein	NA	NA	NA	NA	NA
VDL08795.1|3872600_3873035_-	exported protein	NA	NA	NA	NA	NA
VDL08797.1|3873031_3873466_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08799.1|3873467_3874022_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08801.1|3874039_3874480_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08803.1|3874466_3874700_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 48
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3908116	3952628	4108173	integrase,transposase	Klosneuvirus(20.0%)	39	3938284:3938302	3960275:3960293
VDL08859.1|3908116_3908605_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08861.1|3908790_3909315_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08863.1|3909393_3909744_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08865.1|3909740_3910760_-	fructose-1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.7	1.5e-49
VDL08867.1|3910769_3913478_-	aminopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	24.0	2.8e-15
VDL08869.1|3913625_3914282_+	exported protein	NA	NA	NA	NA	NA
VDL08871.1|3914902_3915334_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08873.1|3915677_3916412_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
VDL08875.1|3916571_3918266_+	acetolactate synthase large subunit	NA	NA	NA	NA	NA
VDL08877.1|3918327_3919227_+	dioxygenase	NA	NA	NA	NA	NA
VDL08879.1|3919294_3920392_+	exported protein	NA	NA	NA	NA	NA
VDL08881.1|3920410_3921274_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	9.6e-34
VDL08883.1|3921285_3922068_+	membrane protein	NA	NA	NA	NA	NA
VDL08885.1|3921902_3922592_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08887.1|3922701_3923181_+	hypothetical protein	NA	NA	NA	NA	NA
VDL08889.1|3923177_3924710_+	acetyl-CoA synthetase	NA	NA	NA	NA	NA
VDL08891.1|3924750_3925758_+	Zinc-binding dehydrogenase	NA	NA	NA	NA	NA
VDL08894.1|3925914_3926625_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08896.1|3926640_3927579_-	autotransporter	NA	NA	NA	NA	NA
VDL08898.1|3927979_3928666_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08900.1|3928798_3930544_+	acetolactate synthase large subunit	NA	NA	NA	NA	NA
VDL08902.1|3930540_3931293_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
VDL08904.1|3931337_3932294_+	exported protein	NA	NA	NA	NA	NA
VDL08905.1|3932382_3932949_+	membrane protein	NA	NA	NA	NA	NA
VDL08907.1|3932765_3933818_-	aminotransferase	NA	NA	NA	NA	NA
VDL08909.1|3933847_3934105_-	glutamate/aspartate transport ATP-binding protein	NA	NA	NA	NA	NA
VDL08911.1|3934062_3934575_-	glutamate/aspartate transport ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	4.2e-13
VDL08913.1|3934606_3935290_-	glutamate/aspartate transport system permease	NA	NA	NA	NA	NA
VDL08915.1|3936127_3937042_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
VDL08917.1|3937106_3938012_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
VDL08919.1|3938105_3939530_-	cyclolysin secretion protein CyaE	NA	NA	NA	NA	NA
3938284:3938302	attL	CGGCGCAGGTCCGACTCGT	NA	NA	NA	NA
VDL08921.1|3939531_3940854_-	cyclolysin secretion protein CyaD	NA	NA	NA	NA	NA
VDL08923.1|3940850_3942989_-	cyclolysin secretion/procession ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	2.7e-45
VDL08925.1|3943066_3948004_-	bifunctional hemolysin-adenylate cyclase	NA	NA	NA	NA	NA
VDL08927.1|3948664_3949222_+	cyclolysin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
VDL08929.1|3949237_3950467_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VDL08931.1|3950433_3950718_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
VDL08933.1|3950772_3952026_-|integrase	integrase	integrase	NA	NA	NA	NA
VDL08936.1|3951998_3952628_-|transposase	transposase	transposase	NA	NA	NA	NA
3960275:3960293	attR	CGGCGCAGGTCCGACTCGT	NA	NA	NA	NA
>prophage 49
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	3966918	4009834	4108173	transposase	Planktothrix_phage(50.0%)	42	NA	NA
VDL08966.1|3966918_3967359_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08968.1|3967345_3967870_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08970.1|3967971_3968400_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL08972.1|3968472_3970668_+	DNA methylase	NA	NA	NA	NA	NA
VDL08974.1|3970889_3971516_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08976.1|3971488_3971731_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08978.1|3971727_3971844_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL08980.1|3971803_3972328_-	heme uptake regulator	NA	NA	NA	NA	NA
VDL08982.1|3972458_3973430_+	inner membrane sensor for iron transport	NA	NA	NA	NA	NA
VDL08984.1|3973588_3975994_+	ferric siderophore receptor	NA	NA	NA	NA	NA
VDL08986.1|3976009_3976600_-	exported protein	NA	NA	NA	NA	NA
VDL08988.1|3976843_3977284_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08990.1|3977270_3977795_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL08992.1|3977952_3979218_-	exported protein	NA	NA	NA	NA	NA
VDL08994.1|3979251_3980349_-	carboxynorspermidine/carboxyspermidine decarboxylase	NA	NA	NA	NA	NA
VDL08996.1|3980489_3980684_-	hypothetical protein	NA	NA	NA	NA	NA
VDL08998.1|3981003_3981528_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL09000.1|3981514_3981955_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL09002.1|3981955_3982525_+	transcriptional regulator	NA	NA	NA	NA	NA
VDL09004.1|3982592_3983408_-	transcriptional regulator	NA	NA	NA	NA	NA
VDL09006.1|3983574_3985194_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
VDL09008.1|3985272_3986214_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL09010.1|3986422_3986689_-	hypothetical protein	NA	NA	NA	NA	NA
VDL09012.1|3986847_3987099_+	ABC transporter permease	NA	NA	NA	NA	NA
VDL09014.1|3987102_3988755_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	6.0e-16
VDL09016.1|3988793_3990191_+	amidase	NA	NA	NA	NA	NA
VDL09018.1|3990232_3991612_+	aminotransferase	NA	NA	NA	NA	NA
VDL09020.1|3991651_3991870_-	hypothetical protein	NA	NA	NA	NA	NA
VDL09022.1|3992210_3993083_+	carboxyvinyl-carboxyphosphonate phosphorylmutase	NA	NA	NA	NA	NA
VDL09024.1|3994299_3994902_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
VDL09026.1|3994961_3995303_+	pterin-4-alpha-carbinolamine dehydratase	NA	NA	NA	NA	NA
VDL09028.1|3995287_3995917_-	inner membrane protein	NA	NA	NA	NA	NA
VDL09030.1|3996132_3996825_-	nucleotidyl transferase	NA	NA	NA	NA	NA
VDL09032.1|3996824_3997928_-	N-acetylmuramate/N-acetylglucosamine kinase	NA	NA	NA	NA	NA
VDL09034.1|3998043_4000410_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
VDL09036.1|4000615_4001965_+	chaperone SurA	NA	NA	NA	NA	NA
VDL09038.1|4001989_4002787_+	rRNA small subunit methyltransferase A	NA	NA	NA	NA	NA
VDL09040.1|4002818_4003964_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
VDL09042.1|4004068_4005511_+	pyruvate kinase	NA	NA	NA	NA	NA
VDL09044.1|4005513_4006743_-	Spore maturation protein B	NA	NA	NA	NA	NA
VDL09046.1|4006885_4008901_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
VDL09048.1|4008880_4009834_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 50
LR130529	Bordetella pertussis isolate FR5810 genome assembly, chromosome: I	4108173	4019126	4051813	4108173	terminase,tRNA,tail,transposase	uncultured_Caudovirales_phage(18.18%)	48	NA	NA
VDL09073.1|4019126_4019423_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
VDL09075.1|4019388_4020858_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
VDL09077.1|4020923_4021496_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
VDL09079.1|4021476_4022163_+	two component response regulator	NA	NA	NA	NA	NA
VDL09081.1|4022518_4023190_+	Putative SOS response-associated peptidase YedK	NA	Q5QF62	Pseudomonas_virus	39.9	4.7e-36
VDL09083.1|4023518_4023740_+	hypothetical protein	NA	NA	NA	NA	NA
VDL09085.1|4023739_4024021_+	hypothetical protein	NA	NA	NA	NA	NA
VDL09087.1|4024064_4024310_-	hypothetical protein	NA	C7BGE0	Burkholderia_phage	49.3	5.9e-05
VDL09089.1|4024532_4024961_-	phage lysozyme	NA	NA	NA	NA	NA
VDL09091.1|4025308_4026121_-	hypothetical protein	NA	NA	NA	NA	NA
VDL09093.1|4026120_4026384_-	hypothetical protein	NA	A0A1B0V3F2	Roseobacter_phage	41.8	7.2e-09
VDL09095.1|4026424_4026538_-	hypothetical protein	NA	NA	NA	NA	NA
VDL09097.1|4026602_4026980_-	hypothetical protein	NA	NA	NA	NA	NA
VDL09099.1|4027023_4030698_-	hypothetical protein	NA	A0A0B5A1N2	Achromobacter_phage	40.7	1.3e-207
VDL09101.1|4030971_4031361_-	hypothetical protein	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
VDL09103.1|4031357_4031885_-	hypothetical protein	NA	A5A3Q9	Burkholderia_phage	46.6	7.2e-40
VDL09105.1|4032328_4032865_-|tail	phage tail protein	tail	A5H1M1	Xanthomonas_virus	26.0	2.4e-06
VDL09107.1|4032861_4034940_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	39.6	2.3e-105
VDL09109.1|4034965_4035244_-	hypothetical protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.5e-14
VDL09111.1|4035273_4035603_-	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
VDL09113.1|4035612_4035954_-	hypothetical protein	NA	A0A1S5R1H0	Pseudomonas_phage	35.2	1.2e-08
VDL09115.1|4036703_4036850_+	hypothetical protein	NA	NA	NA	NA	NA
VDL09117.1|4036893_4037316_-	hypothetical protein	NA	NA	NA	NA	NA
VDL09119.1|4037312_4037711_-	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
VDL09121.1|4037707_4038103_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
VDL09123.1|4038102_4038303_-	hypothetical protein	NA	NA	NA	NA	NA
VDL09125.1|4038304_4038787_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
VDL09127.1|4038848_4039100_-	hypothetical protein	NA	NA	NA	NA	NA
VDL09129.1|4039109_4039673_-	hypothetical protein	NA	R9TJ64	Synechococcus_phage	70.4	2.0e-64
VDL09131.1|4039774_4040299_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL09133.1|4040285_4040726_+|transposase	transposase	transposase	NA	NA	NA	NA
VDL09135.1|4040705_4041128_-	hypothetical protein	NA	A0A0S2SYD2	Pseudomonas_phage	72.8	1.0e-52
VDL09137.1|4041154_4041757_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
VDL09139.1|4041879_4042122_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
VDL09141.1|4042127_4043240_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	49.7	2.1e-102
VDL09143.1|4043211_4044630_-	hypothetical protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
VDL09145.1|4044632_4045910_-|terminase	phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
VDL09147.1|4045896_4046346_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	61.5	5.2e-39
VDL09149.1|4047035_4047374_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL09151.1|4047346_4047976_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL09154.1|4048095_4048215_+	hypothetical protein	NA	NA	NA	NA	NA
VDL09156.1|4048508_4048928_+	phage-related membrane protein	NA	NA	NA	NA	NA
VDL09158.1|4048914_4049166_-	hypothetical protein	NA	NA	NA	NA	NA
VDL09160.1|4049237_4049564_+	hypothetical protein	NA	NA	NA	NA	NA
VDL09162.1|4049719_4050331_+	phage repressor protein	NA	NA	NA	NA	NA
VDL09164.1|4050402_4050609_+	hypothetical protein	NA	NA	NA	NA	NA
VDL09166.1|4050860_4051031_-|transposase	transposase	transposase	NA	NA	NA	NA
VDL09167.1|4051114_4051813_-|transposase	transposase	transposase	NA	NA	NA	NA
