The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LS483460	Corynebacterium minutissimum strain NCTC10288 genome assembly, chromosome: 1	2695970	115550	151874	2695970	transposase	Staphylococcus_phage(11.11%)	32	NA	NA
SQH98209.1|115550_117035_-|transposase	transposase for insertion sequence element	transposase	W5R8L2	Staphylococcus_phage	32.6	1.4e-32
SQH98210.1|117129_118722_-	Nicotinamide nucleotide repair protein	NA	NA	NA	NA	NA
SQH98211.1|118733_119549_-	DNA-formamidopyrimidine glycosylase	NA	G3MA33	Bacillus_virus	24.4	7.0e-10
SQH98213.1|119626_121123_+	Uncharacterized protein conserved in bacteria	NA	NA	NA	NA	NA
SQH98214.1|121354_121504_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQH98215.1|121800_122730_+	putative rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
SQH98216.1|122732_123209_-	putative integral membrane protein	NA	NA	NA	NA	NA
SQH98218.1|123231_124212_-	universal stress protein	NA	NA	NA	NA	NA
SQH98219.1|124295_124775_-	transcriptional regulator, MarR family	NA	NA	NA	NA	NA
SQH98220.1|124993_125377_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQH98221.1|125453_127688_+	penicillin-binding protein 1	NA	NA	NA	NA	NA
SQH98222.1|127703_129107_+	hypothetical membrane protein	NA	NA	NA	NA	NA
SQH98223.1|129103_129295_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQH98224.1|129424_129724_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
SQH98225.1|129787_130369_+	single-stranded DNA-binding protein	NA	A0A2H4YHU9	Gordonia_phage	70.7	9.0e-44
SQH98227.1|130415_130868_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
SQH98229.1|131493_132939_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	40.2	1.1e-85
SQH98231.1|132955_133459_-	hypothetical membrane protein	NA	NA	NA	NA	NA
SQH98234.1|133448_134783_-	metabolite transport protein	NA	NA	NA	NA	NA
SQH98236.1|134794_137014_-	cation-transporting P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.6	2.3e-95
SQH98238.1|137019_137220_-	putative copper chaperone	NA	NA	NA	NA	NA
SQH98240.1|137364_137739_+	thioredoxin	NA	F2WLG3	Lausannevirus	37.8	7.1e-10
SQH98244.1|137890_138727_+	phage shock protein A	NA	NA	NA	NA	NA
SQH98246.1|138807_140034_-	NYN domain	NA	NA	NA	NA	NA
SQH98248.1|140260_140635_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
SQH98250.1|140631_141432_+	ABC transport system, ATP-binding protein	NA	NA	NA	NA	NA
SQH98252.1|141431_142418_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQH98254.1|148641_149187_-|transposase	transposase	transposase	U5P429	Shigella_phage	35.3	5.0e-20
SQH98256.1|149233_149485_-|transposase	transposase	transposase	NA	NA	NA	NA
SQH98258.1|149535_149835_-|transposase	transposase	transposase	NA	NA	NA	NA
SQH98259.1|150763_151561_-|transposase	transposase for insertion sequence	transposase	Q6H9S3	Enterobacteria_phage	45.7	3.7e-48
SQH98261.1|151544_151874_-|transposase	transposase-like protein	transposase	A0A2P1JR43	Mycobacterium_phage	41.2	9.1e-09
>prophage 2
LS483460	Corynebacterium minutissimum strain NCTC10288 genome assembly, chromosome: 1	2695970	600732	612764	2695970	protease	Agrobacterium_phage(25.0%)	12	NA	NA
SQH98921.1|600732_601758_-	ribonucleotide-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	67.4	4.2e-121
SQH98923.1|601810_604006_-	ribonucleoside-diphosphate reductase alpha chain	NA	V9VI16	Lactococcus_phage	48.7	3.1e-193
SQH98925.1|604056_604494_-	NrdI protein involved in ribonucleotide reduction	NA	R4JF54	Bacillus_phage	31.7	5.4e-09
SQH98926.1|604639_605320_-	manganese-dependent transcriptional regulator	NA	NA	NA	NA	NA
SQH98928.1|605458_606058_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	3.9e-42
SQH98930.1|606079_606703_+|protease	ATP-dependent Clp protease proteolytic subunit 2	protease	A0A223W000	Agrobacterium_phage	44.5	4.2e-39
SQH98932.1|607226_608522_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.8	2.0e-131
SQH98934.1|608612_609548_+	transcriptional regulator deoR family	NA	NA	NA	NA	NA
SQH98935.1|609599_610820_-	nucleoside transporter	NA	B2YG43	Musca_hytrovirus	24.5	2.5e-19
SQH98936.1|610838_611273_-	Cytidine deaminase	NA	NA	NA	NA	NA
SQH98938.1|611321_611435_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQH98940.1|611477_612764_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	46.7	3.0e-92
>prophage 3
LS483460	Corynebacterium minutissimum strain NCTC10288 genome assembly, chromosome: 1	2695970	689383	742418	2695970	transposase,integrase,tRNA,protease	Escherichia_phage(25.0%)	51	717148:717174	743576:743602
SQH99081.1|689383_689959_+|protease	metalloprotease	protease	NA	NA	NA	NA
SQH99082.1|690009_690858_+	pyridoxamine kinase	NA	NA	NA	NA	NA
SQH99084.1|691536_692544_+	GTP-binding protein Era	NA	NA	NA	NA	NA
SQH99086.1|692544_693261_+	DNA repair protein RecO	NA	NA	NA	NA	NA
SQH99088.1|693271_694024_+	UDP pyrophosphate synthase	NA	NA	NA	NA	NA
SQH99090.1|694044_694239_-	transcriptional regulator	NA	A0A2H4J5G9	uncultured_Caudovirales_phage	44.8	4.2e-06
SQH99092.1|694242_694695_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQH99094.1|694898_695318_-	transcriptional regulator, FUR family	NA	NA	NA	NA	NA
SQH99095.1|695354_695663_-	cadmium efflux system accessory protein	NA	NA	NA	NA	NA
SQH99097.1|695831_697211_+|tRNA	glycyl-tRNA synthetase	tRNA	A0A2I2L3K8	Orpheovirus	30.5	2.4e-47
SQH99099.1|697210_697729_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQH99101.1|697728_698142_+	Uncharacterised protein	NA	NA	NA	NA	NA
SQH99104.1|698851_700930_-	chromosome segregation ATPase	NA	NA	NA	NA	NA
SQH99106.1|700970_701555_+	putative secreted protein	NA	NA	NA	NA	NA
SQH99108.1|701566_702841_+	deoxyguanosinetriphosphate triphosphohydrolase-like protein	NA	NA	NA	NA	NA
SQH99110.1|702837_703071_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQH99112.1|703101_703605_-	guanyl-specific ribonuclease	NA	NA	NA	NA	NA
SQH99113.1|703715_705644_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	32.6	2.1e-52
SQH99115.1|705694_705979_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQH99118.1|706400_707675_+	phosphatase	NA	NA	NA	NA	NA
SQH99120.1|707717_708875_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A1V0SAG5	Catovirus	25.7	1.6e-23
SQH99122.1|708946_709621_+	Domain of uncharacterised function (DUF1707)	NA	NA	NA	NA	NA
SQH99125.1|709779_713727_-	Glycosyl transferases group 1	NA	NA	NA	NA	NA
SQH99128.1|713726_714284_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQH99130.1|714276_715890_-	polypeptide N-acetylgalactosaminyltransferase	NA	NA	NA	NA	NA
SQH99133.1|715900_716338_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQH99134.1|716570_717116_+	Uncharacterised protein	NA	NA	NA	NA	NA
717148:717174	attL	TTGCTCCTCCAACTGGGCTCGAACCAG	NA	NA	NA	NA
SQH99136.1|717299_718454_+|integrase	integrase	integrase	NA	NA	NA	NA
SQH99140.1|718589_718766_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQH99142.1|719057_719549_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	31.4	3.4e-12
SQH99143.1|720131_721691_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	50.7	7.6e-114
SQH99144.1|721860_722265_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
SQH99146.1|723168_723465_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQH99148.1|724213_725170_-	cytochrome c biogenesis protein transmembrane region	NA	NA	NA	NA	NA
SQH99150.1|725166_725730_-	redoxin domain protein	NA	NA	NA	NA	NA
SQH99153.1|725876_727301_-	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.2	2.2e-43
SQH99155.1|727409_727799_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
SQH99157.1|728319_728799_+|transposase	transposase for insertion sequence	transposase	A0A077SL39	Escherichia_phage	58.0	2.1e-46
SQH99160.1|728828_729566_+	succinyl-CoA:Coenzyme A transferase	NA	NA	NA	NA	NA
SQH99162.1|729570_731202_-	ABC transport system, ATPase and permease component	NA	A0A076FI99	Aureococcus_anophage	27.0	4.7e-05
SQH99165.1|731188_732814_-	ATP-binding/permease protein cydD	NA	G9BWD6	Planktothrix_phage	26.9	2.2e-07
SQH99167.1|732831_733842_-	cytochrome d ubiquinol oxidase subunit 2	NA	NA	NA	NA	NA
SQH99170.1|733841_735431_-	Cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
SQH99172.1|735739_736000_-	transcriptional regulator	NA	NA	NA	NA	NA
SQH99174.1|735999_737616_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
SQH99176.1|738043_738352_-	phosphoribosylformylglycinamidine synthase 2	NA	NA	NA	NA	NA
SQH99178.1|738686_739061_+|transposase	transposase for insertion sequence	transposase	A0A077SL39	Escherichia_phage	55.8	1.4e-29
SQH99181.1|739179_740544_-	major facilitator superfamily permease	NA	NA	NA	NA	NA
SQH99183.1|740540_740843_-	Uncharacterised protein	NA	NA	NA	NA	NA
SQH99185.1|740872_741679_+	Helix-turn-helix domain	NA	NA	NA	NA	NA
SQH99187.1|741938_742418_+|transposase	transposase for insertion sequence	transposase	A0A077SL39	Escherichia_phage	58.6	1.2e-46
743576:743602	attR	TTGCTCCTCCAACTGGGCTCGAACCAG	NA	NA	NA	NA
