The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
LT962481	Pseudomonas syringae pv. syringae isolate CFBP2118 genome assembly, chromosome: 1	6031285	305771	348158	6031285	transposase	Bacillus_phage(75.0%)	44	NA	NA
SOP95010.1|305771_306578_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	57.4	4.7e-83
SOP95012.1|306607_307123_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	32.0	5.2e-11
SOP95014.1|307326_307959_-	copper-binding protein	NA	NA	NA	NA	NA
SOP95016.1|308028_308520_-	cysteine synthase	NA	NA	NA	NA	NA
SOP95018.1|308768_309419_+	hypothetical protein	NA	NA	NA	NA	NA
SOP95020.1|309539_311072_-	sulfate transporter	NA	NA	NA	NA	NA
SOP95022.1|311176_311917_-	Carbonic anhydrase 1	NA	NA	NA	NA	NA
SOP95025.1|312124_313183_-	radical SAM protein	NA	NA	NA	NA	NA
SOP95026.1|313305_313974_-	Enhancing lycopene biosynthesis protein 2	NA	NA	NA	NA	NA
SOP95028.1|314160_314823_-	membrane protein	NA	NA	NA	NA	NA
SOP95031.1|315054_316065_+	Delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
SOP95033.1|316081_318292_+	Polyphosphate kinase	NA	NA	NA	NA	NA
SOP95036.1|318278_319781_-	Exopolyphosphatase	NA	NA	NA	NA	NA
SOP95038.1|320453_321188_-	Glutamate transport ATP-binding protein GluA	NA	G9BWD6	Planktothrix_phage	39.2	3.4e-32
SOP95040.1|321174_321822_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
SOP95042.1|321821_322487_-	polar amino acid ABC transporter permease	NA	NA	NA	NA	NA
SOP95044.1|322518_323304_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
SOP95046.1|323554_324259_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
SOP95047.1|324380_324731_+	Thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.2	2.7e-19
SOP95050.1|324962_326222_+	Transcription termination factor Rho	NA	NA	NA	NA	NA
SOP95052.1|326349_327816_+	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
SOP95057.1|327815_328784_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
SOP95059.1|328992_329661_+	calcium transporter ChaC	NA	NA	NA	NA	NA
SOP95061.1|329661_331011_-	Glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
SOP95063.1|331285_331951_+	cell envelope biogenesis protein TonB	NA	NA	NA	NA	NA
SOP95065.1|331947_332481_+	energry transducer TonB	NA	NA	NA	NA	NA
SOP95067.1|333031_333847_-	Hypothetical protein	NA	NA	NA	NA	NA
SOP95075.1|333891_334164_-	Pyocin immunity protein	NA	NA	NA	NA	NA
SOP95077.1|334160_336125_-	S-type pyocin	NA	NA	NA	NA	NA
SOP95079.1|336223_337201_-	NADPH:quinone oxidoreductase	NA	NA	NA	NA	NA
SOP95082.1|337331_337739_+	flagellar basal body protein FliL	NA	NA	NA	NA	NA
SOP95084.1|337745_338195_-	hypothetical protein	NA	NA	NA	NA	NA
SOP95086.1|338388_338541_+	putative membrane protein	NA	NA	NA	NA	NA
SOP95088.1|338586_339198_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
SOP95091.1|339501_339831_-	cell division protein ZapA	NA	NA	NA	NA	NA
SOP95094.1|339827_340037_-	hypothetical protein	NA	NA	NA	NA	NA
SOP95096.1|340187_340742_+	UPF0149 protein	NA	NA	NA	NA	NA
SOP95098.1|340817_342152_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
SOP95100.1|342148_343336_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
SOP95102.1|343426_344617_+	2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
SOP95110.1|345022_345829_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	57.4	4.7e-83
SOP95112.1|345858_346374_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	32.0	5.2e-11
SOP95114.1|346782_347322_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	34.8	2.0e-13
SOP95118.1|347321_348158_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	53.2	4.7e-78
>prophage 2
LT962481	Pseudomonas syringae pv. syringae isolate CFBP2118 genome assembly, chromosome: 1	6031285	559604	623421	6031285	tRNA,tail,plate,integrase	Pseudomonas_phage(48.48%)	65	547410:547425	607990:608005
547410:547425	attL	GCCGGTCATGGCTGAT	NA	NA	NA	NA
SOP95489.1|559604_560066_-|integrase	integrase	integrase	W6MYA3	Pseudomonas_phage	43.0	1.4e-15
SOP95491.1|560279_560549_-|integrase	integrase	integrase	NA	NA	NA	NA
SOP95493.1|560901_563388_-	diguanylate phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	36.2	8.4e-14
SOP95495.1|563656_565507_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.7	2.0e-36
SOP95497.1|565574_567530_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	1.8e-72
SOP95499.1|568008_568224_-	hypothetical protein	NA	NA	NA	NA	NA
SOP95501.1|568422_569448_+|tRNA	tRNA N6-adenosine threonylcarbamoyltransferase	tRNA	A0A0R6PI74	Moraxella_phage	56.1	3.6e-104
SOP95503.1|569471_570041_-	Glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
SOP95505.1|570115_570469_+	dihydroneopterin triphosphate 2'-epimerase	NA	NA	NA	NA	NA
SOP95507.1|570459_570984_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridinepyrophosphokinase	NA	NA	NA	NA	NA
SOP95509.1|571082_572309_-	Multifunctional CCA protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.8	3.9e-81
SOP95511.1|572406_573969_-	hypothetical protein	NA	NA	NA	NA	NA
SOP95513.1|573965_575237_-	UPF0229 protein	NA	A0A140HLI1	Bacillus_phage	40.4	4.9e-10
SOP95515.1|575357_577280_-	hypothetical protein	NA	NA	NA	NA	NA
SOP95517.1|577564_577885_-	Thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
SOP95519.1|577908_578784_-	Bis(5'-nucleosyl)-tetraphosphatase, symmetrical	NA	A0A291L9W7	Bordetella_phage	43.8	1.3e-06
SOP95521.1|578783_579164_-	Protein ApaG	NA	NA	NA	NA	NA
SOP95523.1|579280_580087_-	Ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
SOP95526.1|580083_581073_-	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
SOP95528.1|581069_582398_-	Chaperone SurA	NA	NA	NA	NA	NA
SOP95530.1|582372_585153_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
SOP95532.1|585282_586305_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
SOP95534.1|586402_587074_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
SOP95536.1|587074_587842_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
SOP95538.1|587863_588868_-	hypothetical protein	NA	NA	NA	NA	NA
SOP95539.1|588982_590995_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
SOP95541.1|590991_591621_+	transcriptional regulator	NA	NA	NA	NA	NA
SOP95543.1|592147_593272_+	Spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	31.4	2.3e-27
SOP95545.1|593354_594389_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
SOP95547.1|594466_595714_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
SOP95549.1|595725_596547_+	polyamine ABC transporter permease	NA	NA	NA	NA	NA
SOP95551.1|596762_597437_+	Ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
SOP95553.1|597433_598252_+	Phosphoglycolate phosphatase	NA	NA	NA	NA	NA
SOP95557.1|598322_599804_+	Anthranilate synthase component 1	NA	NA	NA	NA	NA
SOP95559.1|599813_600209_+	hypothetical protein	NA	NA	NA	NA	NA
SOP95560.1|600035_601958_-	Esterase EstA	NA	NA	NA	NA	NA
SOP95562.1|602063_602330_-	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	51.2	2.1e-16
SOP95564.1|602427_602676_-	hypothetical protein	NA	NA	NA	NA	NA
SOP95566.1|602830_603478_-	repressor	NA	A0A0M4QWY1	Salmonella_phage	47.6	3.8e-51
SOP95568.1|603631_604075_+	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	45.8	3.5e-24
SOP95570.1|604347_604533_+	hypothetical protein	NA	B5TK59	Pseudomonas_phage	89.5	1.3e-12
SOP95573.1|604544_605717_+	glycoside hydrolase	NA	NA	NA	NA	NA
SOP95575.1|605839_606229_+	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	76.4	2.3e-43
SOP95577.1|606209_606548_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	59.2	1.2e-19
SOP95579.1|606593_607184_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	52.0	7.0e-52
SOP95580.1|607180_607369_+	hypothetical protein	NA	B5TK66	Pseudomonas_phage	73.5	1.8e-14
SOP95582.1|607387_608884_+|tail	tail sheath protein	tail	B5TK67	Pseudomonas_phage	80.3	3.2e-234
607990:608005	attR	ATCAGCCATGACCGGC	NA	NA	NA	NA
SOP95585.1|608944_609292_+|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	70.4	8.6e-42
SOP95586.1|609288_609585_+	ArsR family transcriptional regulator	NA	B5TK69	Pseudomonas_phage	76.0	4.3e-34
SOP95588.1|609595_609691_-	hypothetical protein	NA	NA	NA	NA	NA
SOP95590.1|609715_611875_+|tail	tail tape measure protein	tail	U5P420	Shigella_phage	40.4	2.6e-72
SOP95592.1|611871_613284_+	2-hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	46.2	1.8e-109
SOP95594.1|613287_614415_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	59.9	2.3e-112
SOP95596.1|614411_614924_+	phage assembly protein	NA	B5TK73	Pseudomonas_phage	73.8	1.4e-64
SOP95597.1|614920_615319_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	62.9	3.4e-42
SOP95600.1|615308_616349_+|plate	baseplate J protein	plate	B5TK75	Pseudomonas_phage	70.1	5.4e-132
SOP95602.1|616336_616936_+|tail	phage tail protein	tail	B5TK76	Pseudomonas_phage	71.9	7.0e-84
SOP95604.1|616946_618806_+|tail	tail fiber protein	tail	A0A077K818	Ralstonia_phage	53.7	1.6e-38
SOP95606.1|618805_619324_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
SOP95608.1|619452_619998_+	Glycoside hydrolase, family 19	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	73.3	2.0e-69
SOP95611.1|619994_620507_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	48.4	4.7e-28
SOP95613.1|620724_620826_-	hypothetical protein	NA	NA	NA	NA	NA
SOP95615.1|620917_621517_+	Anthranilate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	3.0e-74
SOP95618.1|621526_622588_+	Anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.7	1.2e-110
SOP95619.1|622584_623421_+	Indole-3-glycerol phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	55.8	4.4e-68
>prophage 3
LT962481	Pseudomonas syringae pv. syringae isolate CFBP2118 genome assembly, chromosome: 1	6031285	1124679	1132604	6031285	transposase	Bacillus_phage(33.33%)	10	NA	NA
SOP96471.1|1124679_1125486_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	57.4	2.8e-83
SOP96473.1|1125515_1126031_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	32.0	5.2e-11
SOP96475.1|1126934_1127396_+	hypothetical protein	NA	Q56AR5	Bacillus_thuringiensis_phage	43.3	5.0e-05
SOP96477.1|1127397_1128009_+	Superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	67.8	2.3e-74
SOP96479.1|1128195_1128468_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
SOP96481.1|1128483_1129341_-	UPF0042 nucleotide-binding protein	NA	A0A0R8VB27	Thermobifida_phage	30.2	1.5e-07
SOP96483.1|1129343_1129808_-	Nitrogen regulatory protein	NA	NA	NA	NA	NA
SOP96486.1|1129818_1130127_-	ribosome hibernation promoting factor HPF	NA	NA	NA	NA	NA
SOP96488.1|1130202_1131672_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
SOP96490.1|1131878_1132604_-	Lipopolysaccharide export system ATP-binding protein LptB	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.7e-23
>prophage 4
LT962481	Pseudomonas syringae pv. syringae isolate CFBP2118 genome assembly, chromosome: 1	6031285	1646257	1649926	6031285	transposase	Bacillus_phage(33.33%)	6	NA	NA
SOP97406.1|1646257_1647073_+	Short chain dehydrogenase/reductase (SDR) family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.3	3.0e-05
SOP97408.1|1647338_1647878_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	34.8	2.0e-13
SOP97410.1|1647877_1648714_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	52.8	8.9e-77
SOP97412.1|1648944_1649277_+	UPF0060 membrane protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	82.6	5.5e-46
SOP97415.1|1649447_1649642_+	hypothetical protein	NA	A0A2I7RT00	Vibrio_phage	59.6	2.0e-11
SOP97417.1|1649698_1649926_-	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	88.0	1.2e-31
>prophage 5
LT962481	Pseudomonas syringae pv. syringae isolate CFBP2118 genome assembly, chromosome: 1	6031285	2319186	2326928	6031285	tRNA	uncultured_Caudovirales_phage(71.43%)	9	NA	NA
SOP98548.1|2319186_2320467_+|tRNA	Serine-tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	4.1e-97
SOP98550.1|2320467_2321862_+	Siroheme synthase	NA	NA	NA	NA	NA
SOP98553.1|2321912_2322911_-	Glutathionyl-hydroquinone reductase YqjG	NA	NA	NA	NA	NA
SOP98555.1|2323006_2324008_-	hypothetical protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.2	8.8e-164
SOP98557.1|2324004_2324340_-	DsrC-like protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	77.5	2.6e-43
SOP98559.1|2324336_2324636_-	DsrH like protein	NA	A0A2H4JG28	uncultured_Caudovirales_phage	61.6	5.5e-29
SOP98561.1|2324635_2324998_-	sulfur relay protein TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	60.0	4.8e-35
SOP98563.1|2324999_2325392_-	tusD-like sulfurtransferase	NA	A0A2H4JA39	uncultured_Caudovirales_phage	83.1	3.7e-57
SOP98565.1|2325626_2326928_+	Citrate-proton symporter	NA	Q6JIH2	Burkholderia_virus	36.0	4.1e-60
>prophage 6
LT962481	Pseudomonas syringae pv. syringae isolate CFBP2118 genome assembly, chromosome: 1	6031285	2720943	2729760	6031285		uncultured_Caudovirales_phage(50.0%)	14	NA	NA
SOP99263.1|2720943_2722116_-	Methyl-accepting chemotaxis protein NahY	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.2	5.1e-54
SOP99265.1|2722372_2723356_+	Transposase InsH for insertion sequence element IS5H	NA	Q38213	Escherichia_phage	55.0	1.6e-93
SOP99267.1|2723491_2723833_-	chemotaxis protein	NA	NA	NA	NA	NA
SOP99270.1|2723949_2724132_+	hypothetical protein	NA	NA	NA	NA	NA
SOP99272.1|2724205_2724706_-	hypothetical protein	NA	NA	NA	NA	NA
SOP99274.1|2724996_2726304_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	75.8	3.5e-120
SOP99276.1|2726322_2726625_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	92.0	2.7e-39
SOP99278.1|2726656_2726827_-	hypothetical protein	NA	A0A059VK11	Pseudomonas_phage	90.6	2.1e-09
SOP99280.1|2726857_2727355_+	putative secreted protein	NA	NA	NA	NA	NA
SOP99282.1|2727391_2727595_-	hypothetical protein	NA	NA	NA	NA	NA
SOP99284.1|2727795_2727969_-	hypothetical protein	NA	NA	NA	NA	NA
SOP99286.1|2728073_2728292_+	hypothetical protein	NA	NA	NA	NA	NA
SOP99288.1|2728448_2728841_+	putative membrane protein	NA	NA	NA	NA	NA
SOP99290.1|2728947_2729760_-	hypothetical protein	NA	K7ZMK3	Xanthomonas_citri_phage	39.5	1.9e-44
>prophage 7
LT962481	Pseudomonas syringae pv. syringae isolate CFBP2118 genome assembly, chromosome: 1	6031285	4122878	4211144	6031285	tRNA,protease,transposase	Bacillus_virus(13.33%)	57	NA	NA
SOQ01508.1|4122878_4125275_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	51.9	2.1e-219
SOQ01510.1|4125482_4126766_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.3	4.3e-139
SOQ01512.1|4126872_4127514_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	59.1	4.2e-58
SOQ01514.1|4127605_4128916_-	Trigger factor	NA	NA	NA	NA	NA
SOQ01516.1|4129910_4130402_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ01518.1|4131232_4132087_+	Bifunctional protein FolD 1	NA	A0A249XZQ2	Enterococcus_phage	34.5	7.8e-28
SOQ01520.1|4132151_4133957_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
SOQ01522.1|4134041_4134314_-	membrane protein	NA	NA	NA	NA	NA
SOQ01524.1|4134326_4135127_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
SOQ01526.1|4135137_4136004_-	ABC transporter permease	NA	NA	NA	NA	NA
SOQ01528.1|4135996_4137112_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.1	4.7e-17
SOQ01530.1|4137111_4138206_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	26.6	4.7e-09
SOQ01532.1|4138505_4140362_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
SOQ01534.1|4140471_4141854_-|tRNA	Cysteine-tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	30.7	1.1e-42
SOQ01537.1|4141878_4143573_-|tRNA	Glutamine-tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	62.3	1.4e-206
SOQ01539.1|4143780_4144284_+	Peptidyl-prolyl cis-trans isomerase cyp18	NA	A0A076FI46	Aureococcus_anophage	31.5	3.7e-09
SOQ01541.1|4144280_4145027_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
SOQ01543.1|4145254_4145794_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	34.8	2.0e-13
SOQ01545.1|4145793_4146630_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	52.8	1.1e-77
SOQ01547.1|4146794_4148333_-	Multidrug export protein EmrB	NA	NA	NA	NA	NA
SOQ01549.1|4148396_4149605_-	Multidrug export protein EmrA	NA	NA	NA	NA	NA
SOQ01551.1|4149677_4150166_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
SOQ01553.1|4150316_4150928_-|tRNA	tRNA-hydroxylase	tRNA	NA	NA	NA	NA
SOQ01555.1|4151012_4151483_-	Fe-S protein	NA	NA	NA	NA	NA
SOQ01557.1|4151870_4154486_+	Aconitate hydratase 2	NA	NA	NA	NA	NA
SOQ01559.1|4154765_4155338_+	putative manganese efflux pump MntP	NA	NA	NA	NA	NA
SOQ01561.1|4155424_4160281_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
SOQ01563.1|4160648_4161008_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ01565.1|4161055_4161802_+	2-pyrone-4,6-dicarboxylate hydrolase	NA	NA	NA	NA	NA
SOQ01568.1|4162011_4162971_+	ATPase AAA	NA	NA	NA	NA	NA
SOQ01570.1|4162975_4163920_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ01572.1|4163916_4164411_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ01574.1|4164403_4165462_+	von Willebrand factor, type A	NA	NA	NA	NA	NA
SOQ01576.1|4165458_4167177_+	membrane protein	NA	NA	NA	NA	NA
SOQ01578.1|4167173_4168832_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ01580.1|4168874_4170119_+	exonuclease SbcD	NA	NA	NA	NA	NA
SOQ01582.1|4170115_4173760_+	chromosome segregation protein SMC	NA	A0A1D7SBA6	Synechococcus_phage	28.1	9.5e-06
SOQ01583.1|4174199_4174382_-	hypothetical protein	NA	NA	NA	NA	NA
SOQ01585.1|4174557_4175730_-	3-carboxymuconate cyclase	NA	NA	NA	NA	NA
SOQ01587.1|4175808_4176096_-	hypothetical protein	NA	NA	NA	NA	NA
SOQ01589.1|4176231_4177224_-	sugar transporter	NA	NA	NA	NA	NA
SOQ01591.1|4177259_4178573_-	putative tartrate transporter	NA	NA	NA	NA	NA
SOQ01594.1|4178787_4180530_+	L-arabonate dehydratase	NA	NA	NA	NA	NA
SOQ01596.1|4180688_4181339_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
SOQ01598.1|4181358_4182594_-	MFS transporter	NA	NA	NA	NA	NA
SOQ01600.1|4182666_4195233_-	thioester reductase	NA	D0R7J2	Paenibacillus_phage	34.7	2.0e-55
SOQ01603.1|4195343_4199312_-	thioester reductase	NA	A0A2K9KZV5	Tupanvirus	27.1	2.9e-56
SOQ01604.1|4199533_4200586_+	fatty acid desaturase	NA	NA	NA	NA	NA
SOQ01606.1|4200737_4201451_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
SOQ01609.1|4201887_4204278_-	RND transporter	NA	NA	NA	NA	NA
SOQ01611.1|4204305_4205352_-	hypothetical protein	NA	NA	NA	NA	NA
SOQ01613.1|4205585_4206941_-	hypothetical protein	NA	NA	NA	NA	NA
SOQ01615.1|4207457_4208615_-	putative acid-amine ligase YjfC	NA	A0A219Y9C1	Aeromonas_phage	37.8	3.5e-63
SOQ01617.1|4208626_4209373_-	hypothetical protein	NA	NA	NA	NA	NA
SOQ01619.1|4209400_4209826_-	putative membrane protein	NA	NA	NA	NA	NA
SOQ01621.1|4209839_4210505_-	hypothetical protein	NA	NA	NA	NA	NA
SOQ01623.1|4210589_4211144_-|protease	protease	protease	NA	NA	NA	NA
>prophage 8
LT962481	Pseudomonas syringae pv. syringae isolate CFBP2118 genome assembly, chromosome: 1	6031285	5472929	5485713	6031285	transposase	Bacillus_phage(66.67%)	8	NA	NA
SOQ03889.1|5472929_5474393_+	UPF0061 protein	NA	A0A075BSJ0	Microcystis_phage	36.8	1.3e-62
SOQ03891.1|5474551_5475358_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	58.6	9.5e-84
SOQ03893.1|5475387_5475903_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	32.0	5.2e-11
SOQ03895.1|5476211_5476682_-	chemotaxis protein	NA	NA	NA	NA	NA
SOQ03897.1|5476674_5482653_-	sensor histidine kinase	NA	W8CYM9	Bacillus_phage	33.9	5.0e-12
SOQ03899.1|5482700_5484743_-	Protein PilJ	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.8	2.8e-15
SOQ03901.1|5484793_5485333_-	Protein PilI	NA	NA	NA	NA	NA
SOQ03903.1|5485347_5485713_-	Protein PilH	NA	W8CYM9	Bacillus_phage	37.6	8.8e-13
>prophage 9
LT962481	Pseudomonas syringae pv. syringae isolate CFBP2118 genome assembly, chromosome: 1	6031285	5735903	5784439	6031285	tRNA,protease,transposase,integrase	Bacillus_phage(22.22%)	47	5773783:5773827	5778770:5778814
SOQ04364.1|5735903_5736359_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
SOQ04366.1|5736472_5737891_+|transposase	transposase	transposase	NA	NA	NA	NA
SOQ04368.1|5738019_5738508_-	Protein-export protein SecB	NA	NA	NA	NA	NA
SOQ04371.1|5738548_5738800_-	glutaredoxin	NA	V9QKN6	Rhizobium_phage	39.7	1.8e-12
SOQ04372.1|5738802_5739216_-	sulfurtransferase	NA	NA	NA	NA	NA
SOQ04374.1|5739372_5740905_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
SOQ04377.1|5740949_5742383_+	peptidase M23	NA	NA	NA	NA	NA
SOQ04379.1|5742416_5743754_+|protease	Carboxy-terminal-processing protease	protease	A0A0R6PIZ1	Moraxella_phage	29.8	1.0e-26
SOQ04381.1|5743757_5744540_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ04383.1|5744574_5744664_-	hypothetical protein	NA	NA	NA	NA	NA
SOQ04385.1|5744950_5746615_+	peptidase M60	NA	NA	NA	NA	NA
SOQ04387.1|5746812_5748315_+	trypsin	NA	NA	NA	NA	NA
SOQ04390.1|5748319_5749075_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
SOQ04392.1|5749260_5750094_-	Imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
SOQ04394.1|5750050_5750788_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
SOQ04396.1|5750894_5751173_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase	NA	NA	NA	NA	NA
SOQ04398.1|5751159_5751798_-	Imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
SOQ04400.1|5751797_5752391_-	Imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
SOQ04402.1|5752484_5753684_-	Aromatic-amino-acid aminotransferase	NA	NA	NA	NA	NA
SOQ04404.1|5753900_5755562_-	MFS transporter	NA	NA	NA	NA	NA
SOQ04406.1|5756060_5758286_+	cell envelope biogenesis protein AsmA	NA	NA	NA	NA	NA
SOQ04408.1|5758379_5759447_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
SOQ04411.1|5759443_5759716_+	putative Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
SOQ04413.1|5760541_5760928_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ04415.1|5760920_5761823_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ04417.1|5762089_5762368_+	putative secreted protein	NA	NA	NA	NA	NA
SOQ04419.1|5762680_5764027_+	Biofilm dispersion protein BdlA	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	4.2e-20
SOQ04421.1|5764170_5764656_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ04423.1|5764713_5766105_-	GABA permease	NA	NA	NA	NA	NA
SOQ04426.1|5766629_5767403_+	Arginine/ornithine transport ATP-binding protein AotP	NA	G3M9Y6	Bacillus_virus	31.1	3.9e-18
SOQ04428.1|5767416_5768181_+	amino acid ABC transporter	NA	NA	NA	NA	NA
SOQ04430.1|5768247_5768943_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
SOQ04432.1|5768939_5769629_+	Octopine transport system permease protein OccM	NA	NA	NA	NA	NA
SOQ04434.1|5769630_5770902_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
SOQ04436.1|5771198_5771525_-	hypothetical protein	NA	NA	NA	NA	NA
SOQ04438.1|5771967_5772993_-	molecular chaperone DnaJ	NA	F2Y2Y5	Organic_Lake_phycodnavirus	45.9	1.1e-07
5773783:5773827	attL	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGCCGGCACCA	NA	NA	NA	NA
SOQ04440.1|5775120_5775255_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ04442.1|5775730_5775823_-	hypothetical protein	NA	NA	NA	NA	NA
SOQ04444.1|5776359_5777187_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	41.8	8.6e-56
SOQ04446.1|5777420_5778224_+|protease	Cysteine protease avirulence protein AvrPphB	protease	NA	NA	NA	NA
SOQ04448.1|5778945_5779161_+	hypothetical protein	NA	NA	NA	NA	NA
5778770:5778814	attR	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGCCGGCACCA	NA	NA	NA	NA
SOQ04451.1|5779569_5780553_+	Transposase InsH for insertion sequence element IS5H	NA	Q38213	Escherichia_phage	55.0	1.6e-93
SOQ04453.1|5781242_5781923_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ04455.1|5781932_5782661_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ04457.1|5782989_5783103_+	hypothetical protein	NA	NA	NA	NA	NA
SOQ04459.1|5783063_5783603_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	34.8	4.5e-13
SOQ04461.1|5783602_5784439_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	53.2	4.7e-78
