The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP037427	Myroides odoratimimus strain G13 chromosome, complete genome	3894807	37017	62483	3894807	integrase,transposase	Leptospira_phage(40.0%)	26	39831:39845	64068:64082
QBK74887.1|37017_38013_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
QBK74888.1|38413_39481_-	2,3-butanediol dehydrogenase	NA	NA	NA	NA	NA
39831:39845	attL	GCGGAGAAAGAGGGA	NA	NA	NA	NA
QBK74889.1|39993_41265_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	26.3	1.5e-14
QBK74890.1|41261_42161_+	hypothetical protein	NA	NA	NA	NA	NA
QBK74891.1|42336_42636_+	DUF3853 family protein	NA	NA	NA	NA	NA
QBK74892.1|42732_43968_+	hypothetical protein	NA	NA	NA	NA	NA
QBK74893.1|44187_45141_+	hypothetical protein	NA	A0A2R3UAP7	Myoviridae_environmental_samples	39.1	6.1e-05
QBK74894.1|45236_45536_+	mobilization protein	NA	NA	NA	NA	NA
QBK74895.1|45538_46453_+	mobilization protein	NA	NA	NA	NA	NA
QBK74896.1|46456_46930_+	hypothetical protein	NA	NA	NA	NA	NA
QBK74897.1|47222_48389_-	hypothetical protein	NA	NA	NA	NA	NA
QBK74898.1|48732_49635_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	31.3	1.4e-35
QBK74899.1|49613_50585_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
QBK74900.1|50623_51352_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	28.6	3.9e-20
QBK74901.1|51370_52924_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
QBK74902.1|53567_54515_-	WYL domain-containing protein	NA	NA	NA	NA	NA
QBK74903.1|54514_54760_-	hypothetical protein	NA	NA	NA	NA	NA
QBK74904.1|54770_55226_-	hypothetical protein	NA	NA	NA	NA	NA
QBK74905.1|55235_56156_-	WG repeat-containing protein	NA	NA	NA	NA	NA
QBK74906.1|56169_57282_-	hypothetical protein	NA	NA	NA	NA	NA
QBK74907.1|57314_57740_-	hypothetical protein	NA	NA	NA	NA	NA
QBK74908.1|57746_57944_-	peptidase	NA	NA	NA	NA	NA
QBK74909.1|57945_58152_-	hypothetical protein	NA	NA	NA	NA	NA
QBK74910.1|59022_60318_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
QBK74911.1|60504_61407_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	30.0	2.0e-34
QBK74912.1|61385_62483_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
64068:64082	attR	GCGGAGAAAGAGGGA	NA	NA	NA	NA
>prophage 2
CP037427	Myroides odoratimimus strain G13 chromosome, complete genome	3894807	346698	375161	3894807	integrase,tRNA,transposase	Catovirus(20.0%)	25	357099:357158	371320:372302
QBK75137.1|346698_347415_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
QBK75138.1|347449_348085_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
QBK75139.1|348156_350790_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.3	5.7e-154
QBK75140.1|351020_351410_+	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
QBK75141.1|351483_352221_-	histidinol phosphatase	NA	NA	NA	NA	NA
QBK75142.1|352249_353371_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
QBK75143.1|353928_354669_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
QBK75144.1|354986_355376_-	hypothetical protein	NA	NA	NA	NA	NA
QBK75145.1|356225_357041_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
357099:357158	attL	TTCTGATTATCCGTTTATGCACCTGTTATATTCGCAATTACTAGTCTGTCAAAGAGTTTG	NA	NA	NA	NA
QBK75146.1|357112_358021_-|transposase	IS1595-like element ISBbi1 family transposase	transposase	NA	NA	NA	NA
QBK75147.1|358040_358640_-	hypothetical protein	NA	NA	NA	NA	NA
QBK75148.1|358838_359819_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.0	2.6e-35
QBK75149.1|359952_361119_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
QBK75150.1|361442_362345_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	30.0	2.0e-34
QBK75151.1|362323_363421_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
QBK75152.1|363790_365017_+	EreD family erythromycin esterase	NA	NA	NA	NA	NA
QBK75153.1|365276_366077_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(F)	NA	E4ZFQ0	Streptococcus_phage	27.7	7.9e-14
QBK75154.1|366882_368178_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
QBK75155.1|368350_369574_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	7.3e-19
QBK75156.1|369566_370487_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
QBK75157.1|370718_371264_-	hypothetical protein	NA	NA	NA	NA	NA
QBK75158.1|371333_372242_-|transposase	IS1595-like element ISBbi1 family transposase	transposase	NA	NA	NA	NA
QBK75159.1|372215_372407_+	hypothetical protein	NA	NA	NA	NA	NA
371320:372302	attR	TTCTGATTATCCGTTTATGCACCTGTTATATTCGCAATTACTAGTCTGTCAAAGAGTTTGTCTCCAAAATACCGTCTGTTTAATTTGTAAATAAACTCGTTGAGATACAACTGTAAGTATTTCCTTTTGATTTTATGGTAGTTGCCCAGCAATGTCCGTTTTGCATTACTGATTGCGATATGCACCCATTTGAGTGTTTCCTTGGTGGTTTTGGCGTCTGATTTCTCGGTGACGTGCAATTCCACCAGATCGGAGATGTCAACGTAAGAAGTGCTTTTGTCCGAAAATACGATGGCATCATCCTCCATGCAGTCCCTGACCACGCCGTTGATTCCTTCACTTTGATGGCTATCCAGTACCCTGGCCTTGAAATAACGCACATGCTTCTCCTTTTTGCCCGTTTCGATATCTTCCAACGGGGTGCTTTCGGCCATCACCGCAACGTTCTGCTTTCCCTCGGCTCCCCGGCCACGTGTACCCTTGCCTCGCTCGATTTCCTTACTGGCCACCGAAAAGTAACCCTCATCCAGTTCTATCATCCCTTCCAGTGTATACCTTGCATCCCGGTTGCCCATCGCCCTGCGGAGTTTGTGTACCATCGCCCATACCGGTTCGTAACGCTTCAATCCTAATTGCTTCTGGAGTTCGTTGGTGGAGAATCCCTTTTTTGTGCAACTCATCAGGAACATCGTTTTGTACCACACCAGAAACGGCAGCTTGGAGCTCTCCATGTTCGTACCGCTGCGCAACGAGGTGCGGAAACGGCAACCTTTGCATTCATAACTCCATTTACCCTGTAACCAATAATGGGAAGTGCCCCCGCATCGCTTGCAGACAACCCCTTCCTTATCACGCTGCTCCTTGAAATGCAAACGACAATCTTCCTCCGAACCGAAATGAGCCGTAAAACTGAATATGTTCATAATCCCTGCTTTTTGAGCGCTAATATACTAAAAATATTAGGTGTGTTTGCGGAGAATCAG	NA	NA	NA	NA
QBK78069.1|372315_373350_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
QBK75160.1|374111_375161_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP037427	Myroides odoratimimus strain G13 chromosome, complete genome	3894807	947399	957141	3894807		Bacillus_phage(16.67%)	9	NA	NA
QBK75622.1|947399_950546_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	24.4	7.9e-09
QBK75623.1|950657_951263_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	58.0	5.9e-62
QBK75624.1|951427_952858_-	pyruvate kinase	NA	NA	NA	NA	NA
QBK75625.1|952862_953351_-	IPExxxVDY family protein	NA	NA	NA	NA	NA
QBK75626.1|953448_954195_-	ribonuclease III	NA	M1HR51	Paramecium_bursaria_Chlorella_virus	32.9	3.8e-18
QBK75627.1|954210_955533_-	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
QBK75628.1|955665_955902_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	38.1	1.8e-06
QBK75629.1|956098_956659_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.1	2.8e-18
QBK75630.1|956667_957141_+	ribonuclease HI	NA	A0A2I7QI15	Vibrio_phage	45.0	3.1e-26
>prophage 4
CP037427	Myroides odoratimimus strain G13 chromosome, complete genome	3894807	1762192	1814294	3894807	holin,protease,transposase	Agrobacterium_phage(14.29%)	44	NA	NA
QBK76290.1|1762192_1762549_+|holin	phage holin family protein	holin	NA	NA	NA	NA
QBK76291.1|1762646_1763969_+	trigger factor	NA	NA	NA	NA	NA
QBK76292.1|1764062_1764722_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	48.7	6.0e-44
QBK76293.1|1764725_1765967_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	50.4	4.7e-114
QBK76294.1|1765999_1766338_-	hypothetical protein	NA	NA	NA	NA	NA
QBK76295.1|1766485_1767157_-	response regulator transcription factor	NA	NA	NA	NA	NA
QBK76296.1|1767149_1768895_-	tetratricopeptide repeat-containing sensor histidine kinase	NA	NA	NA	NA	NA
QBK76297.1|1769242_1769578_-	hypothetical protein	NA	NA	NA	NA	NA
QBK76298.1|1769839_1770772_+	hypothetical protein	NA	NA	NA	NA	NA
QBK76299.1|1771262_1772051_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QBK76300.1|1772181_1773519_+	TolC family protein	NA	NA	NA	NA	NA
QBK76301.1|1773518_1774592_+	HlyD family secretion protein	NA	NA	NA	NA	NA
QBK76302.1|1774581_1776177_+	beta-carotene 15,15'-monooxygenase	NA	NA	NA	NA	NA
QBK76303.1|1777174_1777528_+|transposase	transposase	transposase	NA	NA	NA	NA
QBK76304.1|1778547_1778901_+|transposase	transposase	transposase	NA	NA	NA	NA
QBK76305.1|1778887_1779874_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
QBK76306.1|1780232_1780604_-	hypothetical protein	NA	NA	NA	NA	NA
QBK76307.1|1781081_1783679_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	29.0	9.6e-45
QBK76308.1|1783750_1784269_-	FUSC family protein	NA	NA	NA	NA	NA
QBK76309.1|1784432_1784720_-	hypothetical protein	NA	NA	NA	NA	NA
QBK76310.1|1785004_1785529_+	TrmH family RNA methyltransferase	NA	NA	NA	NA	NA
QBK76311.1|1785925_1786867_+	DUF3806 domain-containing protein	NA	NA	NA	NA	NA
QBK76312.1|1786971_1788024_+	class A beta-lactamase-related serine hydrolase	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	26.2	1.9e-20
QBK76313.1|1788130_1788976_+	DUF3806 domain-containing protein	NA	NA	NA	NA	NA
QBK76314.1|1789097_1789628_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
QBK76315.1|1789797_1790520_+	DUF3667 domain-containing protein	NA	NA	NA	NA	NA
QBK76316.1|1790565_1791126_-	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
QBK76317.1|1791115_1792264_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	Q06VC9	Trichoplusia_ni_ascovirus	26.0	2.3e-06
QBK76318.1|1792390_1794157_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.0	3.4e-17
QBK76319.1|1794292_1796923_+	AsmA family protein	NA	NA	NA	NA	NA
QBK76320.1|1796975_1797773_-	DUF2797 domain-containing protein	NA	NA	NA	NA	NA
QBK76321.1|1797884_1799408_+	GH3 auxin-responsive promoter family protein	NA	NA	NA	NA	NA
QBK76322.1|1799615_1799846_-	hypothetical protein	NA	NA	NA	NA	NA
QBK76323.1|1799965_1802119_-	S46 family peptidase	NA	NA	NA	NA	NA
QBK76324.1|1802806_1804102_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
QBK76325.1|1804212_1805343_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.3	3.5e-36
QBK76326.1|1805404_1806625_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
QBK76327.1|1806668_1807541_-	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
QBK76328.1|1807655_1809761_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
QBK76329.1|1809997_1810189_-	hypothetical protein	NA	NA	NA	NA	NA
QBK76330.1|1810190_1810748_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
QBK76331.1|1810766_1812032_-	hypothetical protein	NA	NA	NA	NA	NA
QBK76332.1|1812009_1812759_-	type III pantothenate kinase	NA	NA	NA	NA	NA
QBK76333.1|1813307_1814294_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
>prophage 5
CP037427	Myroides odoratimimus strain G13 chromosome, complete genome	3894807	2207139	2259556	3894807	integrase,transposase	Tetraselmis_virus(21.43%)	42	2208913:2208929	2254532:2254548
QBK76669.1|2207139_2208687_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	34.8	1.2e-82
QBK76670.1|2208712_2209465_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	25.8	5.5e-17
2208913:2208929	attL	TTATATACAAGATATTA	NA	NA	NA	NA
QBK76671.1|2209818_2211591_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
QBK76672.1|2211595_2214076_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
QBK76673.1|2214072_2217123_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	27.9	2.5e-60
QBK76674.1|2217125_2217818_+	M48 family peptidase	NA	NA	NA	NA	NA
QBK76675.1|2218157_2218424_-	DNA-binding protein	NA	NA	NA	NA	NA
QBK76676.1|2218535_2219798_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	40.5	6.5e-31
QBK76677.1|2220342_2221284_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.3	9.7e-64
QBK76678.1|2221404_2222367_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-22
QBK76679.1|2222454_2224875_-	S9 family peptidase	NA	NA	NA	NA	NA
QBK76680.1|2225018_2226026_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
QBK76681.1|2226064_2226733_+	fatty acid hydroxylase	NA	NA	NA	NA	NA
QBK76682.1|2226777_2227821_-	endonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	31.2	3.8e-16
QBK76683.1|2227911_2228265_+|transposase	transposase	transposase	NA	NA	NA	NA
QBK76684.1|2228251_2229238_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
QBK76685.1|2229792_2230443_+	DedA family protein	NA	NA	NA	NA	NA
QBK76686.1|2230712_2231753_-	endonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	27.3	1.3e-08
QBK76687.1|2232066_2233020_-	endonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	30.0	4.5e-16
QBK76688.1|2233096_2234308_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
QBK76689.1|2234397_2234829_-	hypothetical protein	NA	NA	NA	NA	NA
QBK76690.1|2234833_2235247_-	hypothetical protein	NA	NA	NA	NA	NA
QBK76691.1|2235290_2235833_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
QBK76692.1|2235933_2236590_+	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	28.5	9.6e-10
QBK76693.1|2236729_2237245_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
QBK76694.1|2237660_2239253_-	peptide chain release factor 3	NA	A0A2K5B2A5	Erysipelothrix_phage	28.3	5.0e-36
QBK76695.1|2239644_2240514_+	hypothetical protein	NA	NA	NA	NA	NA
QBK76696.1|2240500_2241874_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
QBK76697.1|2242282_2245045_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
QBK76698.1|2245137_2245602_-	osmotically inducible protein OsmC	NA	NA	NA	NA	NA
QBK76699.1|2245883_2248145_+	aconitate hydratase	NA	NA	NA	NA	NA
QBK76700.1|2248500_2249496_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
QBK76701.1|2249711_2250224_-	hypothetical protein	NA	NA	NA	NA	NA
QBK76702.1|2250357_2251677_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	39.2	1.4e-68
QBK76703.1|2251850_2252420_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
QBK76704.1|2252493_2253942_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
QBK76705.1|2254055_2255456_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	6.6e-24
2254532:2254548	attR	TAATATCTTGTATATAA	NA	NA	NA	NA
QBK76706.1|2255590_2256373_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
QBK76707.1|2256378_2256903_+	N-acetyltransferase	NA	NA	NA	NA	NA
QBK76708.1|2256911_2257949_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
QBK76709.1|2258120_2258654_+	hypothetical protein	NA	NA	NA	NA	NA
QBK76710.1|2258677_2259556_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.8	1.6e-20
>prophage 6
CP037427	Myroides odoratimimus strain G13 chromosome, complete genome	3894807	3027551	3093973	3894807	integrase,transposase	Bacillus_phage(28.57%)	55	3079073:3079090	3107810:3107827
QBK77324.1|3027551_3027866_+|transposase	transposase	transposase	NA	NA	NA	NA
QBK77325.1|3027859_3028753_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
QBK77326.1|3028854_3029937_-	imelysin	NA	NA	NA	NA	NA
QBK77327.1|3029959_3031294_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
QBK77328.1|3031609_3032629_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
QBK77329.1|3032711_3033527_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QBK77330.1|3033619_3034282_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
QBK77331.1|3034522_3036862_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77332.1|3037185_3037494_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
QBK77333.1|3037852_3038731_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	28.5	1.6e-15
QBK77334.1|3038844_3040248_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	2.8e-46
QBK77335.1|3040393_3040969_+	hypothetical protein	NA	NA	NA	NA	NA
QBK77336.1|3041090_3041492_+	hypothetical protein	NA	NA	NA	NA	NA
QBK77337.1|3041491_3042043_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
QBK77338.1|3042155_3042950_+	aminotransferase class I and II	NA	NA	NA	NA	NA
QBK77339.1|3042936_3043311_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
QBK77340.1|3043312_3045094_+	ATPase	NA	NA	NA	NA	NA
QBK77341.1|3045102_3045786_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
QBK77342.1|3045803_3046631_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
QBK77343.1|3046633_3047488_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QBK77344.1|3047477_3048521_-	nitronate monooxygenase	NA	NA	NA	NA	NA
QBK78129.1|3048532_3049678_-	class A beta-lactamase-related serine hydrolase	NA	G1FGA1	Mycobacterium_phage	24.8	1.1e-05
QBK77345.1|3049777_3050893_-	aminopeptidase	NA	NA	NA	NA	NA
QBK77346.1|3050964_3051804_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
QBK77347.1|3052556_3052859_+	hypothetical protein	NA	NA	NA	NA	NA
QBK77348.1|3052984_3053896_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
QBK77349.1|3053907_3054594_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
QBK77350.1|3054596_3055640_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
QBK77351.1|3055699_3056569_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QBK77352.1|3056807_3057674_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
QBK77353.1|3057710_3058619_-	phospholipase	NA	NA	NA	NA	NA
QBK77354.1|3058630_3061273_-	DNA gyrase/topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	30.8	3.8e-41
QBK77355.1|3061277_3063128_-	type IIA DNA topoisomerase subunit B	NA	A0A172JHT4	Bacillus_phage	31.4	2.1e-70
QBK77356.1|3063204_3064125_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
QBK77357.1|3064353_3065448_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
QBK77358.1|3065723_3066020_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77359.1|3066114_3067089_-	deoxyhypusine synthase	NA	NA	NA	NA	NA
QBK77360.1|3067128_3068526_-	arginine decarboxylase	NA	NA	NA	NA	NA
QBK77361.1|3068900_3069968_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
QBK77362.1|3070333_3070564_+	hypothetical protein	NA	NA	NA	NA	NA
QBK77363.1|3070553_3070880_+	hypothetical protein	NA	NA	NA	NA	NA
QBK77364.1|3070893_3071304_-	arginase	NA	NA	NA	NA	NA
QBK77365.1|3072194_3074153_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
QBK77366.1|3074182_3075115_-	type IX secretion system membrane protein PorP/SprF	NA	NA	NA	NA	NA
QBK77367.1|3075123_3076416_-	gliding motility-associated C-terminal domain-containing protein	NA	NA	NA	NA	NA
QBK77368.1|3076432_3079021_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77369.1|3078980_3079487_-	hypothetical protein	NA	NA	NA	NA	NA
3079073:3079090	attL	ACTCTTTATCTAATTCTC	NA	NA	NA	NA
QBK77370.1|3079489_3087037_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77371.1|3086988_3087279_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
QBK77372.1|3087278_3087617_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
QBK77373.1|3087666_3089241_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.5	1.1e-67
QBK77374.1|3089743_3090319_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77375.1|3091022_3091376_+|transposase	transposase	transposase	NA	NA	NA	NA
QBK77376.1|3091362_3092349_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
QBK77377.1|3092650_3093973_+|integrase	integrase	integrase	S0A3I4	Cellulophaga_phage	29.5	2.5e-33
3107810:3107827	attR	ACTCTTTATCTAATTCTC	NA	NA	NA	NA
>prophage 7
CP037427	Myroides odoratimimus strain G13 chromosome, complete genome	3894807	3126911	3180679	3894807	protease,transposase	Norovirus(25.0%)	47	NA	NA
QBK77405.1|3126911_3127742_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
QBK77406.1|3127831_3128086_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77407.1|3128146_3128956_-	PorT family protein	NA	NA	NA	NA	NA
QBK77408.1|3128994_3133434_-	BspA family leucine-rich repeat surface protein	NA	NA	NA	NA	NA
QBK77409.1|3133750_3135424_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
QBK77410.1|3135558_3135858_+	transcriptional regulator	NA	NA	NA	NA	NA
QBK77411.1|3135935_3136901_+	LLM class oxidoreductase	NA	NA	NA	NA	NA
QBK77412.1|3137577_3138765_+	calcium:proton antiporter	NA	NA	NA	NA	NA
QBK77413.1|3139085_3139835_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77414.1|3139789_3140671_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
QBK77415.1|3140664_3142401_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
QBK77416.1|3142410_3145668_-	TonB-dependent receptor	NA	Q2PGD7	Norovirus	25.3	1.4e-08
QBK77417.1|3146374_3147217_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBK77418.1|3147218_3148109_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
QBK77419.1|3148098_3148956_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
QBK77420.1|3148945_3149692_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	1.3e-18
QBK77421.1|3150047_3150596_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QBK77422.1|3150712_3150934_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77423.1|3151218_3151839_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77424.1|3152073_3152757_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBK77425.1|3152746_3153436_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77426.1|3153618_3154173_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	46.3	6.4e-39
QBK77427.1|3154390_3155389_+	OmpA family protein	NA	NA	NA	NA	NA
QBK77428.1|3155557_3156322_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77429.1|3156677_3157496_-	GLPGLI family protein	NA	NA	NA	NA	NA
QBK77430.1|3157712_3158501_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
QBK78131.1|3158519_3159050_-	flavodoxin family protein	NA	NA	NA	NA	NA
QBK77431.1|3159152_3159527_+	transcriptional regulator	NA	NA	NA	NA	NA
QBK77432.1|3159532_3159781_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77433.1|3159963_3160986_-	c-type cytochrome	NA	NA	NA	NA	NA
QBK77434.1|3161065_3161932_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77435.1|3161957_3163946_-	TonB-dependent receptor	NA	NA	NA	NA	NA
QBK77436.1|3163951_3164848_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77437.1|3165274_3165604_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77438.1|3166088_3166616_+	hypothetical protein	NA	NA	NA	NA	NA
QBK77439.1|3166704_3168504_-	WG repeat-containing protein	NA	NA	NA	NA	NA
QBK77440.1|3168500_3169718_-	hypothetical protein	NA	NA	NA	NA	NA
QBK77441.1|3169971_3170988_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBK77442.1|3171704_3172019_+|transposase	transposase	transposase	NA	NA	NA	NA
QBK77443.1|3172219_3172780_+|transposase	transposase	transposase	NA	NA	NA	NA
QBK77444.1|3172743_3174318_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.5	1.1e-67
QBK77445.1|3174367_3174706_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
QBK77446.1|3174705_3174996_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
QBK77447.1|3177700_3178417_+	hypothetical protein	NA	NA	NA	NA	NA
QBK77448.1|3178575_3179343_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
QBK77449.1|3180053_3180341_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
QBK77450.1|3180340_3180679_+|transposase	transposase	transposase	NA	NA	NA	NA
