The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	23302	70827	4805371	transposase	Escherichia_phage(33.33%)	38	NA	NA
QBJ57427.1|23302_24511_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.8	1.6e-207
QBJ57428.1|24759_25209_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ57429.1|25317_25665_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
QBJ57430.1|25654_26017_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
QBJ57431.1|26013_26511_+	radical SAM protein	NA	NA	NA	NA	NA
QBJ57432.1|26518_27703_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
QBJ57433.1|27982_28072_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
QBJ57434.1|28636_28735_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
QBJ57435.1|28840_30529_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	4.6e-56
QBJ57436.1|30532_30823_+	acetolactate synthase 1 small subunit	NA	NA	NA	NA	NA
QBJ57437.1|30897_31488_+	transcriptional regulator UhpA	NA	NA	NA	NA	NA
QBJ57438.1|31487_32990_+	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
QBJ61231.1|32999_34319_+	MFS transporter family glucose-6-phosphate receptor UhpC	NA	NA	NA	NA	NA
QBJ57439.1|34456_35848_+	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
QBJ57440.1|35892_37659_-	adenine deaminase	NA	NA	NA	NA	NA
QBJ57441.1|37755_37944_+	sulfate permease	NA	NA	NA	NA	NA
QBJ57442.1|39620_40073_+	DUF1198 domain-containing protein	NA	NA	NA	NA	NA
QBJ57443.1|41504_41798_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ57444.1|42019_42787_+	lipoprotein NlpA	NA	NA	NA	NA	NA
QBJ57445.1|43549_43756_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	91.2	9.3e-28
QBJ57446.1|43771_44170_-	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	97.6	9.1e-64
QBJ57447.1|44255_44531_-	hypothetical protein	NA	A0A0N7C1Z2	Escherichia_phage	94.5	3.6e-43
QBJ61232.1|44671_45391_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.3	7.7e-61
QBJ57448.1|45661_46829_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	5.8e-183
QBJ57449.1|47147_47438_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ57450.1|48958_49156_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57451.1|49141_51340_-	TonB-dependent receptor	NA	NA	NA	NA	NA
QBJ57452.1|51342_52680_-	lysine 6-monooxygenase	NA	NA	NA	NA	NA
QBJ57453.1|52676_54419_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
QBJ57454.1|54418_55366_-	N-acetyltransferase	NA	NA	NA	NA	NA
QBJ57455.1|55366_57091_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
QBJ57456.1|57226_58420_+	MFS transporter	NA	NA	NA	NA	NA
QBJ61233.1|58369_58567_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ57457.1|58792_59296_-|transposase	transposase	transposase	NA	NA	NA	NA
QBJ57458.1|65178_66348_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	97.4	2.2e-222
QBJ57459.1|66347_67145_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	100.0	6.6e-146
QBJ57460.1|68208_69364_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
QBJ57461.1|69555_70827_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	5.0e-172
>prophage 2
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	790629	798570	4805371		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
QBJ58054.1|790629_791391_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
QBJ58055.1|791384_792011_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.1	2.2e-35
QBJ58056.1|792150_793290_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
QBJ58057.1|793352_794345_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
QBJ58058.1|794438_795803_-	GntP family transporter	NA	NA	NA	NA	NA
QBJ58059.1|795891_796668_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
QBJ58060.1|796672_797311_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
QBJ58061.1|797307_798570_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
>prophage 3
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	841441	1024321	4805371	holin,terminase,plate,tRNA,transposase,protease,tail,head,portal	Enterobacteria_phage(42.19%)	170	NA	NA
QBJ58101.1|841441_844072_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
QBJ58102.1|844306_844492_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
QBJ58103.1|845815_846382_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
QBJ58104.1|846378_846807_+	DedA family protein	NA	NA	NA	NA	NA
QBJ58105.1|846879_848436_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
QBJ58106.1|848585_849101_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
QBJ58107.1|849164_850703_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
QBJ58108.1|850719_851892_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
QBJ58109.1|852018_852549_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
QBJ58110.1|852639_852975_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
QBJ58111.1|852964_853702_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
QBJ58112.1|853825_855010_-	MFS transporter	NA	NA	NA	NA	NA
QBJ58113.1|855300_856293_-	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
QBJ58114.1|856350_857415_-	proline/glycine betaine ABC transporter permease ProW	NA	NA	NA	NA	NA
QBJ58115.1|857407_858610_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
QBJ61257.1|858599_858848_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ58116.1|858965_859925_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
QBJ58117.1|859934_862079_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	2.4e-195
QBJ58118.1|862458_862704_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
QBJ58119.1|862951_863281_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
QBJ58120.1|863432_863777_+	DUF2002 family protein	NA	NA	NA	NA	NA
QBJ58121.1|863813_864263_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
QBJ58122.1|864671_865868_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
QBJ58123.1|866382_866787_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
QBJ58124.1|866833_867358_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
QBJ58125.1|867367_867667_-	transcriptional regulator	NA	NA	NA	NA	NA
QBJ58126.1|867849_868008_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
QBJ58127.1|868091_868541_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
QBJ58128.1|868541_869204_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
QBJ58129.1|869224_870541_-	GABA permease	NA	NA	NA	NA	NA
QBJ58130.1|870851_872132_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	3.2e-33
QBJ58131.1|872145_873594_-	NADP-dependent succinate-semialdehyde dehydrogenase I	NA	NA	NA	NA	NA
QBJ61258.1|873616_874885_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
QBJ58132.1|874904_875882_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
QBJ58133.1|876217_877771_-	alpha-amylase	NA	NA	NA	NA	NA
QBJ58134.1|880396_881875_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58135.1|882258_882447_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	69.2	1.6e-05
QBJ58136.1|882601_882721_+	ATPase	NA	NA	NA	NA	NA
QBJ58137.1|882785_884165_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
QBJ58138.1|884240_885468_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	6.3e-172
QBJ58139.1|885584_886976_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	96.8	7.0e-260
QBJ61259.1|886987_887230_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	95.0	3.9e-33
QBJ58140.1|887229_887601_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.0	8.0e-38
QBJ58141.1|887590_887977_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.9	1.1e-58
QBJ58142.1|887981_888206_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58143.1|888457_889021_+	ORF6N domain-containing protein	NA	Q8HA19	Enterobacteria_phage	56.9	2.6e-40
QBJ58144.1|890201_890417_+|holin	holin	holin	M1FN85	Enterobacteria_phage	91.5	4.2e-31
QBJ58145.1|890416_890914_+	lysozyme	NA	A5LH83	Enterobacteria_phage	98.2	2.4e-90
QBJ58146.1|891130_891313_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	75.4	1.4e-16
QBJ58147.1|891417_891768_+	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	99.1	4.7e-64
QBJ58148.1|891889_892384_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
QBJ61260.1|892617_894114_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.4	3.7e-299
QBJ58149.1|894125_894308_+	hypothetical protein	NA	Q8W630	Enterobacteria_phage	98.3	2.9e-25
QBJ61261.1|894432_895464_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	97.6	1.1e-193
QBJ58150.1|896575_897849_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
QBJ58151.1|898249_898591_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
QBJ58152.1|898739_900401_-	DNA repair protein RecN	NA	NA	NA	NA	NA
QBJ58153.1|900486_901365_-	NAD(+) kinase	NA	NA	NA	NA	NA
QBJ58154.1|901296_901491_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
QBJ58155.1|901487_902081_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
QBJ58156.1|902135_903422_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
QBJ61262.1|903442_904234_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
QBJ58157.1|904400_905762_+	signal recognition particle protein	NA	NA	NA	NA	NA
QBJ58158.1|906010_906259_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
QBJ61263.1|906277_906826_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
QBJ58159.1|906856_907624_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
QBJ58160.1|907665_908013_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
QBJ58161.1|908089_908572_-	OmpA family protein	NA	NA	NA	NA	NA
QBJ58162.1|911738_911930_-	diguanylate cyclase	NA	NA	NA	NA	NA
QBJ58163.1|911945_912149_+|transposase	transposase	transposase	NA	NA	NA	NA
QBJ58164.1|912200_913353_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.2e-65
QBJ58165.1|913453_913972_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
QBJ58166.1|914886_915264_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
QBJ58167.1|915472_916543_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
QBJ58168.1|916553_917675_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
QBJ58169.1|917717_918878_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
QBJ61264.1|918977_919025_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ58170.1|919128_919470_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
QBJ58171.1|921161_921452_-	RnfH family protein	NA	NA	NA	NA	NA
QBJ58172.1|921441_921918_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
QBJ58173.1|922049_922532_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
QBJ58174.1|923307_923931_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	77.4	1.3e-80
QBJ61265.1|925167_925656_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	77.9	6.0e-65
QBJ58175.1|925715_926756_-|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	83.5	1.5e-158
QBJ58176.1|926742_927333_-	DUF2313 domain-containing protein	NA	Q8W614	Enterobacteria_phage	98.0	1.4e-113
QBJ58177.1|927332_927836_-|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	95.8	3.7e-86
QBJ58178.1|929183_929594_-	hypothetical protein	NA	Q8W616	Enterobacteria_phage	95.6	3.0e-70
QBJ58179.1|929599_930133_-|plate	phage baseplate assembly protein V	plate	Q8W617	Enterobacteria_phage	96.0	3.7e-92
QBJ58180.1|930110_931193_-|plate	baseplate protein	plate	Q8W618	Enterobacteria_phage	98.8	8.0e-195
QBJ58181.1|931189_932581_-	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	95.7	1.4e-247
QBJ61266.1|932627_932834_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ58182.1|933954_935904_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	97.8	0.0e+00
QBJ61267.1|935988_936318_-|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	98.2	8.7e-52
QBJ58183.1|936323_936680_-|tail	phage tail protein	tail	Q8W622	Enterobacteria_phage	98.3	5.3e-63
QBJ58184.1|936679_938176_-|tail	phage tail protein	tail	Q8W623	Enterobacteria_phage	97.2	6.5e-272
QBJ58185.1|939455_939818_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-63
QBJ58186.1|939921_941250_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
QBJ58187.1|941371_942109_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
QBJ58188.1|942243_943224_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
QBJ58189.1|943220_943952_+	polyphenol oxidase	NA	NA	NA	NA	NA
QBJ58190.1|944081_946655_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
QBJ58191.1|952418_953717_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	3.7e-45
QBJ58192.1|953713_954037_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
QBJ58193.1|954082_955438_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
QBJ58194.1|955551_958212_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
QBJ58195.1|958243_958942_-	DTW domain-containing protein	NA	NA	NA	NA	NA
QBJ58196.1|959010_959430_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
QBJ58197.1|959636_960674_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
QBJ58198.1|960721_961411_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
QBJ58199.1|961715_962099_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
QBJ58200.1|962154_962742_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
QBJ58201.1|962844_963726_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ58202.1|963934_965269_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
QBJ58203.1|965400_966138_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
QBJ58204.1|967091_968248_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
QBJ58205.1|969267_969423_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
QBJ58206.1|969419_969995_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
QBJ58207.1|970027_970678_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
QBJ58208.1|970677_971634_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
QBJ58209.1|971630_972110_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
QBJ58210.1|972307_974107_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
QBJ58211.1|974122_975097_+	signal peptidase I	NA	NA	NA	NA	NA
QBJ58212.1|975369_976050_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
QBJ58213.1|976046_976952_+	GTPase Era	NA	NA	NA	NA	NA
QBJ58214.1|976963_977692_+	DNA repair protein RecO	NA	NA	NA	NA	NA
QBJ58215.1|977703_978435_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
QBJ58216.1|978434_978815_+	holo-ACP synthase	NA	NA	NA	NA	NA
QBJ61268.1|979036_979117_+	small toxic protein ShoB	NA	NA	NA	NA	NA
QBJ58217.1|979310_979571_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
QBJ58218.1|979785_980988_+	recombinase	NA	NA	NA	NA	NA
QBJ58219.1|981160_982348_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
QBJ58220.1|982788_983961_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
QBJ58221.1|985136_986349_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	2.7e-167
QBJ58222.1|986760_987072_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
QBJ58223.1|987256_988528_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
QBJ58224.1|988524_988911_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
QBJ58225.1|988907_990212_+	DNA helicase	NA	NA	NA	NA	NA
QBJ58226.1|991033_991594_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
QBJ58227.1|991723_991936_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ58228.1|992302_993459_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
QBJ58229.1|993589_994717_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
QBJ58230.1|995842_996223_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
QBJ58231.1|996219_996567_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	5.3e-60
QBJ58232.1|996616_998155_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	1.0e-283
QBJ58233.1|999179_1000355_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
QBJ61269.1|1000293_1000515_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58234.1|1000423_1002685_-	TonB-dependent receptor	NA	NA	NA	NA	NA
QBJ58235.1|1002853_1003630_-	energy transducer TonB	NA	NA	NA	NA	NA
QBJ58236.1|1003637_1004513_-	iron-regulated protein	NA	NA	NA	NA	NA
QBJ58237.1|1005942_1007171_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
QBJ58238.1|1007289_1008321_+|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
QBJ58239.1|1009128_1009311_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ58240.1|1009314_1009524_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58241.1|1009541_1009877_-	colicin transporter	NA	NA	NA	NA	NA
QBJ58242.1|1010005_1010353_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58243.1|1010372_1010963_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ58244.1|1010959_1011220_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ58245.1|1011317_1012530_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.9e-168
QBJ58246.1|1012905_1014033_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
QBJ58247.1|1014359_1014578_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	2.4e-34
QBJ61270.1|1015864_1016026_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	96.2	8.6e-21
QBJ58248.1|1016022_1016370_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	5.3e-60
QBJ58249.1|1016937_1018104_+|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	38.9	4.9e-57
QBJ58250.1|1018054_1018678_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	1.2e-78
QBJ58251.1|1018677_1018857_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58252.1|1018857_1020681_-	invasion protein	NA	NA	NA	NA	NA
QBJ58253.1|1021780_1021963_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58254.1|1022067_1022916_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ58255.1|1023124_1023760_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
QBJ58256.1|1023784_1024321_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 4
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	1192372	1333464	4805371	tRNA,transposase,tail,integrase,capsid,lysis,head,portal	Enterobacteria_phage(52.94%)	116	1239763:1239822	1288653:1289419
QBJ58396.1|1192372_1193788_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
QBJ58397.1|1193839_1194232_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
QBJ58398.1|1194233_1194593_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
QBJ58399.1|1197450_1198653_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
QBJ58400.1|1198988_1200227_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
QBJ58401.1|1200367_1200694_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
QBJ58402.1|1200808_1202065_-	ion channel protein	NA	NA	NA	NA	NA
QBJ58403.1|1202268_1203234_+	glucokinase	NA	NA	NA	NA	NA
QBJ58404.1|1203453_1203780_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
QBJ58405.1|1203801_1205049_+	fructose-like permease IIC component	NA	NA	NA	NA	NA
QBJ58406.1|1206148_1207186_+	aminopeptidase	NA	NA	NA	NA	NA
QBJ58407.1|1209708_1210566_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QBJ58408.1|1210578_1211313_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
QBJ58409.1|1214177_1215416_+	alanine transaminase	NA	NA	NA	NA	NA
QBJ61275.1|1215480_1215552_-	membrane protein YpdK	NA	NA	NA	NA	NA
QBJ58410.1|1215907_1216828_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	1.1e-75
QBJ58411.1|1217180_1217423_+	DUF2545 family protein	NA	NA	NA	NA	NA
QBJ58412.1|1217499_1217775_-	colanic acid biosynthesis lipoprotein YpdI	NA	NA	NA	NA	NA
QBJ58413.1|1218071_1218695_+	YfdX family protein	NA	NA	NA	NA	NA
QBJ58414.1|1220509_1222204_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
QBJ58415.1|1222273_1223218_+	transporter YfdV	NA	NA	NA	NA	NA
QBJ58416.1|1223291_1224437_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
QBJ58417.1|1224492_1228086_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	6.0e-37
QBJ58418.1|1228090_1228705_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
QBJ58419.1|1229120_1230284_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
QBJ58420.1|1230283_1231822_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
QBJ58421.1|1231929_1233258_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
QBJ58422.1|1233724_1234720_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
QBJ58423.1|1234727_1236161_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	5.3e-29
QBJ58424.1|1236405_1237734_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
QBJ61276.1|1239420_1239768_+	fructokinase	NA	NA	NA	NA	NA
1239763:1239822	attL	GGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGG	NA	NA	NA	NA
QBJ58425.1|1240677_1241280_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ58426.1|1241521_1241866_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	97.4	1.9e-57
QBJ58427.1|1241988_1242189_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
QBJ58428.1|1242717_1243965_-	MFS transporter	NA	NA	NA	NA	NA
QBJ58429.1|1245494_1246667_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.7	6.3e-230
QBJ58430.1|1247530_1247908_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ58431.1|1248172_1248628_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	2.7e-59
QBJ58432.1|1248627_1248798_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
QBJ58433.1|1248790_1249081_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
QBJ58434.1|1249077_1249440_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
QBJ58435.1|1249436_1249577_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
QBJ58436.1|1249662_1250046_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
QBJ58437.1|1250234_1251317_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
QBJ58438.1|1252665_1252881_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
QBJ58439.1|1252880_1253378_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	94.5	2.1e-86
QBJ58440.1|1253374_1253833_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	80.9	1.2e-56
QBJ58441.1|1254034_1254532_+	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
QBJ58442.1|1254528_1254786_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	97.6	3.3e-38
QBJ58443.1|1254789_1254978_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ58444.1|1255257_1256530_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
QBJ58445.1|1256455_1256665_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ58446.1|1256710_1257121_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
QBJ58447.1|1257178_1257412_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
QBJ58448.1|1257800_1258346_+	DNA-packaging protein NohD	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
QBJ58449.1|1260240_1260447_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
QBJ58450.1|1260443_1262045_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.2e-310
QBJ58451.1|1262025_1263345_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
QBJ58452.1|1263354_1263687_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
QBJ58453.1|1263742_1264768_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	4.3e-190
QBJ58454.1|1264809_1265208_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
QBJ58455.1|1265219_1265573_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
QBJ58456.1|1265584_1266163_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	89.6	2.0e-80
QBJ58457.1|1266159_1266555_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
QBJ58458.1|1266562_1267303_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.0e-129
QBJ58459.1|1267318_1267741_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
QBJ58460.1|1267722_1268157_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
QBJ58461.1|1268149_1269901_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	93.1	5.1e-284
QBJ61277.1|1269935_1270709_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.5	2.5e-126
QBJ58462.1|1270705_1271035_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	3.1e-57
QBJ58463.1|1271034_1271733_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
QBJ58464.1|1271738_1272482_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	7.5e-152
QBJ58465.1|1272418_1273051_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.6e-94
QBJ58466.1|1273111_1276609_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
QBJ58467.1|1277260_1280344_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.3e-68
QBJ58468.1|1280343_1280925_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	8.0e-101
QBJ61278.1|1283903_1285061_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	1.4e-221
QBJ58469.1|1285372_1286305_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
QBJ58470.1|1286598_1287354_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
QBJ58471.1|1291192_1292533_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
1288653:1289419	attR	GGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACTGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACAGCACGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGCTATGTCGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGTCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
QBJ58472.1|1292904_1293189_+	DUF406 family protein	NA	NA	NA	NA	NA
QBJ58473.1|1293368_1294679_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
QBJ58474.1|1294678_1296823_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
QBJ58475.1|1297025_1297511_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
QBJ58476.1|1298194_1298758_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
QBJ58477.1|1298839_1301482_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
QBJ58478.1|1303701_1304208_+	fimbrial protein	NA	NA	NA	NA	NA
QBJ58479.1|1304179_1304296_+	fimbrial protein	NA	NA	NA	NA	NA
QBJ58480.1|1304246_1304675_+	fimbrial protein	NA	NA	NA	NA	NA
QBJ58481.1|1304671_1305196_+	fimbrial protein	NA	NA	NA	NA	NA
QBJ58482.1|1305197_1306055_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
QBJ58483.1|1306176_1306728_-	endonuclease SmrB	NA	NA	NA	NA	NA
QBJ58484.1|1306893_1307826_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
QBJ58485.1|1308944_1309769_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
QBJ58486.1|1309768_1310578_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58487.1|1310577_1311126_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
QBJ58488.1|1311159_1311438_+	YfcL family protein	NA	NA	NA	NA	NA
QBJ58489.1|1311558_1313565_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
QBJ58490.1|1313723_1314944_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
QBJ58491.1|1315218_1316397_+	MFS transporter	NA	NA	NA	NA	NA
QBJ58492.1|1316393_1317389_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
QBJ58493.1|1317487_1318624_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
QBJ58494.1|1318689_1319703_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
QBJ58495.1|1319702_1320515_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
QBJ58496.1|1320597_1321257_+	DedA family protein	NA	NA	NA	NA	NA
QBJ58497.1|1321412_1322327_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
QBJ58498.1|1322396_1323665_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
QBJ58499.1|1323654_1324317_+	cell division protein DedD	NA	NA	NA	NA	NA
QBJ58500.1|1325098_1326616_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
QBJ58501.1|1326710_1327280_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
QBJ58502.1|1327545_1328328_+	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
QBJ58503.1|1328548_1329331_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
QBJ58504.1|1329420_1330107_+	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
QBJ58505.1|1330103_1330820_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
QBJ58506.1|1330827_1331601_+	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	38.1	2.4e-23
QBJ58507.1|1332627_1333464_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	43.6	2.1e-62
>prophage 5
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	1549451	1556890	4805371		Enterobacteria_phage(100.0%)	7	NA	NA
QBJ58673.1|1549451_1549700_-	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
QBJ58674.1|1550214_1551900_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
QBJ58675.1|1551896_1552616_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
QBJ58676.1|1552662_1553133_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
QBJ61287.1|1553173_1553635_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
QBJ58677.1|1553756_1555757_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
QBJ58678.1|1555753_1556890_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 6
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	1790147	1846876	4805371	holin,tail,transposase,capsid	Escherichia_phage(32.0%)	52	NA	NA
QBJ58859.1|1790147_1791476_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
QBJ58860.1|1791530_1794206_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
QBJ58861.1|1794683_1795331_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
QBJ58862.1|1796068_1797700_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
QBJ58863.1|1797785_1798706_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
QBJ58864.1|1798720_1799629_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
QBJ58865.1|1799640_1800654_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
QBJ58866.1|1800650_1801655_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.8e-23
QBJ58867.1|1801707_1802037_-	DUF440 family protein	NA	NA	NA	NA	NA
QBJ58868.1|1802071_1803532_-	cardiolipin synthase	NA	NA	NA	NA	NA
QBJ58869.1|1803674_1803848_+	YciY family protein	NA	NA	NA	NA	NA
QBJ58870.1|1803902_1805156_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
QBJ61301.1|1806719_1807016_-	YciI family protein	NA	NA	NA	NA	NA
QBJ58871.1|1807814_1808366_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	40.9	1.5e-27
QBJ58872.1|1809929_1810487_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58873.1|1810487_1810766_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58874.1|1810768_1811041_+	HNH endonuclease	NA	NA	NA	NA	NA
QBJ58875.1|1811040_1811241_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58876.1|1812302_1812518_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58877.1|1813033_1813744_+|transposase	transposase	transposase	NA	NA	NA	NA
QBJ58878.1|1813766_1813976_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58879.1|1817020_1818176_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
QBJ58880.1|1820934_1822455_-	recombinase family protein	NA	NA	NA	NA	NA
QBJ58881.1|1822545_1823265_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
QBJ58882.1|1823304_1823703_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
QBJ58883.1|1823807_1824347_-	septation protein A	NA	NA	NA	NA	NA
QBJ58884.1|1824376_1825120_-	UPF0259 family protein	NA	NA	NA	NA	NA
QBJ58885.1|1825476_1826115_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
QBJ58886.1|1826535_1826754_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
QBJ58887.1|1826786_1826999_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	4.4e-33
QBJ58888.1|1827882_1828269_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.0	9.5e-58
QBJ58889.1|1829501_1829732_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	76.9	5.0e-22
QBJ58890.1|1829742_1829910_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
QBJ58891.1|1829906_1830251_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
QBJ58892.1|1830485_1830698_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
QBJ61302.1|1831001_1831274_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ58893.1|1831275_1832334_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.4	1.3e-88
QBJ58894.1|1832334_1832715_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.5e-34
QBJ58895.1|1832711_1833533_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	1.4e-79
QBJ58896.1|1833757_1833955_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
QBJ58897.1|1834105_1835164_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	94.6	2.3e-199
QBJ58898.1|1837695_1839549_+	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	90.2	0.0e+00
QBJ58899.1|1839699_1839915_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
QBJ58900.1|1839919_1840234_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
QBJ58901.1|1840667_1841824_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
QBJ58902.1|1842178_1842706_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	84.0	7.1e-80
QBJ58903.1|1842734_1843268_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	85.9	3.4e-82
QBJ58904.1|1844259_1844442_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
QBJ58905.1|1844558_1844696_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
QBJ58906.1|1844640_1845309_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QBJ58907.1|1846046_1846604_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
QBJ58908.1|1846600_1846876_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
>prophage 7
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	1946695	1957902	4805371	tRNA,transposase	Escherichia_phage(50.0%)	10	NA	NA
QBJ58986.1|1946695_1948069_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
QBJ58987.1|1948197_1949133_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
QBJ58988.1|1949718_1950875_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
QBJ61307.1|1951863_1952187_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.1	3.8e-52
QBJ58989.1|1952279_1952498_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	6.8e-29
QBJ58990.1|1952499_1952865_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
QBJ58991.1|1952861_1953527_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	44.9	4.6e-36
QBJ58992.1|1953526_1953892_+	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	53.0	2.3e-29
QBJ58993.1|1954289_1954502_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	91.4	6.8e-26
QBJ58994.1|1957347_1957902_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.5e-68
>prophage 8
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	2142107	2147829	4805371		Escherichia_phage(57.14%)	11	NA	NA
QBJ59112.1|2142107_2142464_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	6.3e-56
QBJ59113.1|2142521_2142944_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.5	2.1e-66
QBJ59114.1|2142959_2143685_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	70.5	9.7e-88
QBJ59115.1|2143706_2144453_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	82.1	4.0e-113
QBJ59116.1|2144459_2145524_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	7.1e-63
QBJ59117.1|2145595_2146021_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
QBJ59118.1|2146017_2146281_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBJ59119.1|2146392_2146893_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	34.9	1.5e-15
QBJ59120.1|2146912_2147107_+	antitoxin	NA	NA	NA	NA	NA
QBJ59121.1|2147106_2147397_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
QBJ59122.1|2147676_2147829_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.7e-07
>prophage 9
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	2399410	2463050	4805371	tRNA,transposase,protease,tail,integrase	Acinetobacter_phage(12.5%)	51	2418879:2418938	2443897:2444409
QBJ59343.1|2399410_2400292_-|protease	protease HtpX	protease	NA	NA	NA	NA
QBJ59344.1|2400483_2402532_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
QBJ59345.1|2402551_2403250_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
QBJ59346.1|2403346_2403844_-	GAF domain-containing protein	NA	NA	NA	NA	NA
QBJ59347.1|2403973_2405257_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
QBJ59348.1|2405225_2407859_+	PqiB family protein	NA	NA	NA	NA	NA
QBJ59349.1|2407939_2409379_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
QBJ61329.1|2410612_2410804_+	DUF1482 family protein	NA	NA	NA	NA	NA
QBJ59350.1|2411046_2412203_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.0e-67
QBJ59351.1|2415512_2417228_+	T3SS effector E3 ubiquitin-protein ligase IpaH3	NA	NA	NA	NA	NA
QBJ59352.1|2417343_2418500_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
QBJ59353.1|2418644_2418905_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	50.9	5.9e-11
2418879:2418938	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
QBJ59354.1|2419437_2420710_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
QBJ59355.1|2421003_2422080_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	1.2e-97
QBJ59356.1|2422472_2422814_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
QBJ59357.1|2422826_2423699_-	copper resistance D family protein	NA	NA	NA	NA	NA
QBJ59358.1|2423702_2424077_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
QBJ59359.1|2424215_2424446_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
QBJ59360.1|2424547_2425204_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
QBJ59361.1|2425227_2425890_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
QBJ59362.1|2425886_2427947_-	oligopeptidase B	NA	NA	NA	NA	NA
QBJ59363.1|2428155_2428815_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
QBJ59364.1|2429141_2429498_-	protein YebF	NA	NA	NA	NA	NA
QBJ59365.1|2429564_2429855_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
QBJ59366.1|2429988_2431167_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
QBJ59367.1|2431222_2431864_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
QBJ59368.1|2431900_2433712_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
QBJ59369.1|2433946_2435422_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
QBJ59370.1|2435758_2436628_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ59371.1|2436755_2438198_+	pyruvate kinase II	NA	NA	NA	NA	NA
QBJ61330.1|2438257_2439052_-	NGG1p interacting factor NIF3	NA	NA	NA	NA	NA
QBJ59372.1|2440365_2442234_+	glycosyl hydrolase	NA	NA	NA	NA	NA
QBJ59373.1|2446209_2447181_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
2443897:2444409	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACTGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACTGCACGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGCTATGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGTCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGC	NA	NA	NA	NA
QBJ59374.1|2447300_2448623_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	6.9e-15
QBJ61331.1|2448638_2449571_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
QBJ59375.1|2449649_2450405_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
QBJ59376.1|2450401_2451187_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
QBJ59377.1|2451333_2452344_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.9	1.6e-08
QBJ59378.1|2452352_2452964_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
QBJ61332.1|2453102_2453168_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ59379.1|2453240_2453843_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
QBJ59380.1|2453844_2454366_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	1.0e-09
QBJ59381.1|2454400_2455141_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
QBJ61333.1|2455169_2455622_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
QBJ59382.1|2455739_2457512_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
QBJ59383.1|2457821_2458388_+	hydrolase	NA	NA	NA	NA	NA
QBJ59384.1|2458742_2458991_+	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
QBJ59385.1|2459591_2461343_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
QBJ59386.1|2461343_2461523_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ59387.1|2461522_2462146_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	3.2e-79
QBJ59388.1|2462096_2463050_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	36.7	2.0e-32
>prophage 10
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	2467450	2472101	4805371		Enterobacteria_phage(57.14%)	8	NA	NA
QBJ59389.1|2467450_2468248_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.5e-145
QBJ61334.1|2468597_2468840_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	95.0	3.5e-34
QBJ59390.1|2468839_2469214_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.2	2.9e-35
QBJ59391.1|2469210_2470065_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	9.7e-79
QBJ59392.1|2470557_2470884_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ59393.1|2470919_2471051_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
QBJ59394.1|2471331_2471667_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	73.8	3.4e-43
QBJ59395.1|2471927_2472101_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	95.3	2.1e-17
>prophage 11
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	2709449	2757743	4805371	tail,transposase,protease	Acidithiobacillus_phage(22.22%)	38	NA	NA
QBJ59605.1|2709449_2710160_+|transposase	transposase	transposase	NA	NA	NA	NA
QBJ59606.1|2710184_2710391_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ59607.1|2710489_2712670_+|tail	phage tail tape measure protein	tail	D2K036	Staphylococcus_phage	28.0	4.4e-59
QBJ59608.1|2713751_2715287_+|transposase	IS21-like element ISSso4 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	1.7e-102
QBJ59609.1|2715303_2716059_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	43.4	2.4e-44
QBJ59610.1|2716182_2717454_-	resolvase	NA	NA	NA	NA	NA
QBJ59611.1|2717438_2718712_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
QBJ59612.1|2719213_2719819_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
QBJ59613.1|2719839_2720067_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ59614.1|2720104_2721346_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
QBJ59615.1|2724200_2725121_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	5.5e-11
QBJ59616.1|2725120_2725426_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
QBJ59617.1|2728475_2729648_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
QBJ59618.1|2729767_2730460_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
QBJ59619.1|2730432_2731461_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
QBJ59620.1|2731543_2734288_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
QBJ59621.1|2735481_2735655_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
QBJ59622.1|2735644_2735875_-	protein YmcE	NA	NA	NA	NA	NA
QBJ61342.1|2735849_2736038_-	cold-shock protein	NA	NA	NA	NA	NA
QBJ59623.1|2736048_2736261_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
QBJ59624.1|2737323_2737536_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
QBJ59625.1|2737982_2738288_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ59626.1|2738394_2739039_+	lipoprotein GfcB	NA	NA	NA	NA	NA
QBJ59627.1|2739035_2739782_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ59628.1|2739781_2741878_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
QBJ59629.1|2741923_2743063_+	polysaccharide export protein	NA	NA	NA	NA	NA
QBJ59630.1|2743050_2743497_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
QBJ59631.1|2743516_2745697_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
QBJ59632.1|2745811_2747110_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
QBJ59633.1|2747189_2747282_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
QBJ59634.1|2747294_2748431_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
QBJ59635.1|2748442_2749987_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
QBJ59636.1|2750120_2750978_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
QBJ59637.1|2751034_2751373_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
QBJ59638.1|2751369_2751957_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
QBJ59639.1|2752678_2754472_-	hydrogenase 1 large subunit	NA	NA	NA	NA	NA
QBJ59640.1|2754468_2755587_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
QBJ59641.1|2757083_2757743_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
>prophage 12
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	2973783	3032096	4805371	terminase,transposase,tail,integrase,head	Salmonella_phage(25.0%)	50	2983977:2984011	3016511:3016545
QBJ59813.1|2973783_2975112_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
QBJ59814.1|2977156_2977834_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	29.7	5.8e-18
QBJ59815.1|2977907_2978174_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
QBJ59816.1|2978438_2978699_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
QBJ59817.1|2978927_2980013_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
QBJ59818.1|2980153_2981116_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
QBJ59819.1|2981143_2983294_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
QBJ59820.1|2983413_2983896_+	NADAR family protein	NA	A0A0H3TLU0	Faustovirus	52.0	1.7e-35
2983977:2984011	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
QBJ59821.1|2984127_2985492_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	1.9e-52
QBJ59822.1|2985720_2986392_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
QBJ59823.1|2986394_2987390_+	secretion protein HlyD	NA	NA	NA	NA	NA
QBJ59824.1|2987382_2989119_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	1.8e-18
QBJ59825.1|2989111_2990245_+	ABC transporter permease	NA	NA	NA	NA	NA
QBJ59826.1|2990255_2991362_+	ABC transporter permease	NA	NA	NA	NA	NA
QBJ59827.1|2991323_2991734_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ59828.1|2991866_2992628_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
QBJ59829.1|2992624_2993866_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
QBJ59830.1|2995559_2996264_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
QBJ59831.1|2996400_2996853_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
QBJ59832.1|2996854_2997100_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
QBJ59833.1|2997092_2997578_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
QBJ59834.1|2997580_2998093_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
QBJ59835.1|2998114_2999104_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
QBJ59836.1|2999500_3000409_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
QBJ59837.1|3000600_3002622_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
QBJ59838.1|3003200_3003878_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
QBJ59839.1|3003870_3004626_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
QBJ59840.1|3004612_3005767_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
QBJ59841.1|3005763_3006804_-	biotin synthase	NA	NA	NA	NA	NA
QBJ59842.1|3006890_3008180_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
QBJ59843.1|3008238_3008715_+	kinase inhibitor	NA	NA	NA	NA	NA
QBJ59844.1|3009296_3011060_+	invasion plasmid antigen	NA	NA	NA	NA	NA
QBJ59845.1|3011060_3011240_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ59846.1|3011239_3011863_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.4e-79
QBJ59847.1|3011813_3013067_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	40.2	1.3e-63
QBJ59848.1|3014306_3015077_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.2	5.8e-139
QBJ59849.1|3015211_3016495_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
QBJ59850.1|3016728_3018909_-	hydratase	NA	NA	NA	NA	NA
3016511:3016545	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
QBJ59851.1|3019863_3020817_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ59852.1|3020857_3021853_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
QBJ59853.1|3022112_3022244_-	DNA invertase	NA	A0A0C4UR34	Shigella_phage	84.4	8.8e-08
QBJ59854.1|3023042_3023549_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
QBJ59855.1|3023552_3024773_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	86.1	4.5e-194
QBJ61349.1|3024776_3025520_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
QBJ59856.1|3026876_3028280_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	1.2e-187
QBJ59857.1|3028230_3028995_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	53.8	5.9e-11
QBJ59858.1|3029192_3029702_+	DedA family protein	NA	NA	NA	NA	NA
QBJ59859.1|3029834_3030041_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	4.0e-31
QBJ59860.1|3030257_3030755_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	96.4	3.9e-88
QBJ59861.1|3030823_3032096_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 13
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	3036269	3046658	4805371	integrase,transposase	Escherichia_phage(27.27%)	15	3044559:3044573	3053537:3053551
QBJ59862.1|3036269_3036425_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.8e-07
QBJ59863.1|3036628_3037036_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
QBJ59864.1|3037112_3037340_+	transcriptional regulator	NA	NA	NA	NA	NA
QBJ59865.1|3037349_3037745_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.2	1.6e-60
QBJ59866.1|3037972_3039129_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
QBJ59867.1|3039876_3040623_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	81.7	2.0e-112
QBJ59868.1|3040637_3041060_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
QBJ59869.1|3041060_3041474_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.6e-58
QBJ59870.1|3041642_3042308_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
QBJ59871.1|3042478_3042691_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
QBJ59872.1|3042940_3043228_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ59873.1|3043616_3044773_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
3044559:3044573	attL	TTACGCAGTTGCAGA	NA	NA	NA	NA
QBJ59874.1|3044850_3045294_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	49.3	9.9e-35
QBJ59875.1|3045470_3045599_+	hydrolase	NA	NA	NA	NA	NA
QBJ59876.1|3045599_3046658_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
3053537:3053551	attR	TCTGCAACTGCGTAA	NA	NA	NA	NA
>prophage 14
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	3451816	3531353	4805371	plate,transposase	Enterobacteria_phage(21.43%)	58	NA	NA
QBJ60198.1|3451816_3453044_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
QBJ60199.1|3453305_3454175_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.2e-52
QBJ60200.1|3454334_3454928_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
QBJ60201.1|3454939_3455176_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
QBJ60202.1|3455284_3456610_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
QBJ60203.1|3456835_3457690_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QBJ60204.1|3458217_3458937_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
QBJ60205.1|3458947_3460375_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
QBJ60206.1|3460367_3461063_+	lactate utilization protein C	NA	NA	NA	NA	NA
QBJ60207.1|3461943_3462177_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
QBJ60208.1|3462216_3463080_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
QBJ60209.1|3463069_3464617_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
QBJ60210.1|3464616_3465975_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
QBJ60211.1|3466117_3467068_+	carbamate kinase family protein	NA	NA	NA	NA	NA
QBJ60212.1|3467077_3468460_+	deaminase	NA	NA	NA	NA	NA
QBJ60213.1|3468836_3469886_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
QBJ60214.1|3470905_3471721_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ60215.1|3473399_3473645_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ60216.1|3473661_3474294_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ60217.1|3475407_3478482_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.9	0.0e+00
QBJ60218.1|3478604_3479687_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
QBJ60219.1|3480638_3482303_+	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
QBJ60220.1|3482304_3483249_+	2,3-dihydroxyphenylpropionate/2, 3-dihydroxicinnamic acid 1,2-dioxygenase	NA	NA	NA	NA	NA
QBJ60221.1|3484980_3485952_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	32.7	5.6e-14
QBJ60222.1|3486902_3487934_-|transposase	IS630-like element IS630 family transposase	transposase	NA	NA	NA	NA
QBJ60223.1|3490156_3490492_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ60224.1|3491223_3491538_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ60225.1|3491786_3493040_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
QBJ60226.1|3493051_3494155_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
QBJ60227.1|3494442_3495498_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
QBJ60228.1|3495536_3495938_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
QBJ60229.1|3495995_3497240_-	esterase FrsA	NA	NA	NA	NA	NA
QBJ60230.1|3497331_3497790_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
QBJ60231.1|3498050_3499508_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
QBJ60232.1|3499564_3500179_-	peptide chain release factor H	NA	NA	NA	NA	NA
QBJ60233.1|3501021_3502218_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
QBJ60234.1|3502196_3502790_-	RNA ligase RtcB family protein	NA	A0A0A0RRX9	Bacillus_phage	31.1	1.6e-08
QBJ60235.1|3503008_3503461_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QBJ60236.1|3503457_3504513_-	DNA polymerase IV	NA	NA	NA	NA	NA
QBJ60237.1|3504583_3505354_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
QBJ60238.1|3505313_3507053_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
QBJ60239.1|3507175_3507673_-|transposase	transposase	transposase	NA	NA	NA	NA
QBJ60240.1|3508912_3509686_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
QBJ60241.1|3509871_3510132_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
QBJ60242.1|3510134_3510413_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
QBJ60243.1|3510568_3511309_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
QBJ60244.1|3511279_3512047_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
QBJ60245.1|3512252_3512831_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
QBJ60246.1|3515070_3515544_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
QBJ60247.1|3515697_3516468_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
QBJ60248.1|3516509_3517646_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
QBJ60249.1|3518114_3518492_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ60250.1|3520337_3520787_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ60251.1|3525081_3527223_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	2.8e-26
QBJ60252.1|3527432_3527951_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
QBJ60253.1|3528647_3529148_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
QBJ60254.1|3529182_3529407_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ60255.1|3530939_3531353_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 15
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	3576013	3650056	4805371	tRNA,protease,transposase	Shigella_phage(18.18%)	59	NA	NA
QBJ60289.1|3576013_3577312_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
QBJ60290.1|3577376_3577766_-	VOC family protein	NA	NA	NA	NA	NA
QBJ60291.1|3577822_3579964_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
QBJ60292.1|3580124_3581453_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
QBJ60293.1|3581501_3582461_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
QBJ60294.1|3582473_3585956_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	7.4e-210
QBJ60295.1|3585992_3586589_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
QBJ60296.1|3586585_3587734_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
QBJ60297.1|3587733_3588522_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
QBJ60298.1|3588525_3588981_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
QBJ60299.1|3589085_3590111_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
QBJ60300.1|3590114_3590600_-	molecular chaperone Skp	NA	NA	NA	NA	NA
QBJ60301.1|3590721_3593154_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
QBJ60302.1|3593183_3594536_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
QBJ60303.1|3594547_3595405_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
QBJ60304.1|3595417_3596176_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
QBJ60305.1|3596364_3597561_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
QBJ60306.1|3597652_3598210_-	ribosome recycling factor	NA	NA	NA	NA	NA
QBJ60307.1|3598501_3599227_-	UMP kinase	NA	NA	NA	NA	NA
QBJ60308.1|3599373_3600225_-	elongation factor Ts	NA	NA	NA	NA	NA
QBJ60309.1|3600482_3601208_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
QBJ60310.1|3601575_3602370_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
QBJ60311.1|3602431_3605131_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
QBJ60312.1|3605133_3605958_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
QBJ60313.1|3606012_3606825_+	phosphodiesterase YaeI	NA	NA	NA	NA	NA
QBJ60314.1|3606743_3606941_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ60315.1|3606986_3607373_+	DUF3461 family protein	NA	NA	NA	NA	NA
QBJ60316.1|3607461_3608619_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ60317.1|3608773_3610198_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
QBJ60318.1|3611760_3612621_-	dGTPase	NA	NA	NA	NA	NA
QBJ60319.1|3612704_3613403_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
QBJ60320.1|3613395_3614196_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
QBJ60321.1|3614233_3614857_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
QBJ60322.1|3614903_3615248_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
QBJ61362.1|3615240_3615306_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ60323.1|3615329_3616751_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
QBJ60324.1|3616975_3618256_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
QBJ60325.1|3618413_3620396_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
QBJ60326.1|3620392_3621283_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
QBJ60327.1|3621282_3622080_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
QBJ60328.1|3622130_3624320_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
QBJ60329.1|3624539_3627074_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
QBJ60330.1|3627269_3629699_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.1	1.0e-40
QBJ60331.1|3629772_3630303_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
QBJ60332.1|3630317_3631022_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
QBJ60333.1|3631199_3631655_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
QBJ60334.1|3631691_3632618_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
QBJ60335.1|3632656_3634075_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
QBJ60336.1|3634071_3634551_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
QBJ61363.1|3634920_3635505_+	fimbrial protein	NA	NA	NA	NA	NA
QBJ60337.1|3635609_3636350_+	fimbrial chaperone	NA	NA	NA	NA	NA
QBJ60338.1|3640712_3641940_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
QBJ60339.1|3641947_3642421_+	fimbrial protein	NA	NA	NA	NA	NA
QBJ60340.1|3642435_3643038_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
QBJ60341.1|3643064_3643661_+	fimbrial protein StaF	NA	NA	NA	NA	NA
QBJ60342.1|3644441_3645715_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
QBJ60343.1|3647210_3648005_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
QBJ60344.1|3648016_3648868_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
QBJ60345.1|3649159_3650056_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.6e-60
>prophage 16
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	3989171	4053508	4805371	tRNA,protease,transposase	Vibrio_phage(14.29%)	53	NA	NA
QBJ60601.1|3989171_3989447_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
QBJ60602.1|3989563_3991189_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
QBJ60603.1|3991272_3992436_-	glutathionylspermidine synthase preATP-grasp family protein	NA	B2ZXR7	Ralstonia_phage	43.2	2.4e-80
QBJ60604.1|3992438_3993038_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
QBJ60605.1|3993857_3994589_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
QBJ60606.1|3994768_3997210_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	1.9e-66
QBJ60607.1|3997248_3997674_-	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
QBJ60608.1|3997878_3999177_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
QBJ60609.1|3999280_3999478_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
QBJ60610.1|3999559_4000564_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
QBJ60611.1|4000566_4001826_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
QBJ60612.1|4001911_4003192_-	GTPase HflX	NA	NA	NA	NA	NA
QBJ60613.1|4003268_4003577_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
QBJ60614.1|4003662_4004613_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
QBJ60615.1|4004605_4006453_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
QBJ60616.1|4006462_4007800_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
QBJ60617.1|4007818_4008280_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
QBJ60618.1|4008251_4009799_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
QBJ60619.1|4009797_4010937_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
QBJ61379.1|4010919_4010973_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ60620.1|4011836_4012382_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
QBJ60621.1|4012476_4013529_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
QBJ60622.1|4013625_4014594_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
QBJ60623.1|4014615_4017939_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
QBJ60624.1|4018089_4019457_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
QBJ60625.1|4020180_4020369_-	transporter	NA	NA	NA	NA	NA
QBJ60626.1|4020587_4021565_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
QBJ60627.1|4021889_4023698_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
QBJ60628.1|4023690_4024425_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
QBJ60629.1|4024435_4024831_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
QBJ60630.1|4024841_4025201_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
QBJ61380.1|4025263_4026397_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
QBJ60631.1|4026485_4027019_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
QBJ60632.1|4027015_4027333_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
QBJ60633.1|4027507_4027654_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
QBJ60634.1|4027764_4027890_-	entericidin A	NA	NA	NA	NA	NA
QBJ60635.1|4027941_4028508_-	elongation factor P	NA	NA	NA	NA	NA
QBJ60636.1|4028549_4029578_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
QBJ60637.1|4030855_4031614_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ60638.1|4031816_4032170_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
QBJ60639.1|4032307_4033954_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
QBJ60640.1|4033997_4034291_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
QBJ60641.1|4034566_4035823_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
QBJ60642.1|4035844_4036315_-	membrane protein FxsA	NA	NA	NA	NA	NA
QBJ60643.1|4036651_4038088_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
QBJ60644.1|4038205_4039507_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
QBJ60645.1|4039622_4039961_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
QBJ60646.1|4039936_4041634_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
QBJ60647.1|4041670_4042246_+	transcriptional regulator	NA	NA	NA	NA	NA
QBJ60648.1|4047370_4048527_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.3e-67
QBJ61381.1|4048638_4048986_+	calcium-binding protein	NA	NA	NA	NA	NA
QBJ60649.1|4050124_4051393_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.3	3.2e-171
QBJ60650.1|4052352_4053508_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-67
>prophage 17
CP035008	Shigella sonnei strain LC1477/18 chromosome, complete genome	4805371	4473477	4529813	4805371	transposase	Enterobacteria_phage(12.5%)	42	NA	NA
QBJ60970.1|4473477_4474650_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
QBJ60971.1|4475914_4476253_-	macrodomain Ori organization protein MaoP	NA	NA	NA	NA	NA
QBJ60972.1|4476371_4477211_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
QBJ60973.1|4482995_4483688_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ60974.1|4483710_4485138_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
QBJ60975.1|4485103_4486096_-	transcriptional regulator RbsR	NA	NA	NA	NA	NA
QBJ61394.1|4486099_4487029_-	ribokinase	NA	NA	NA	NA	NA
QBJ60976.1|4488065_4489031_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
QBJ60977.1|4489035_4490541_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	3.0e-14
QBJ60978.1|4490548_4490968_-	D-ribose pyranase	NA	NA	NA	NA	NA
QBJ60979.1|4491134_4493003_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
QBJ60980.1|4494570_4494795_-	xylanase	NA	NA	NA	NA	NA
QBJ60981.1|4494794_4496411_-	carbohydrate porin	NA	NA	NA	NA	NA
QBJ60982.1|4496496_4497585_-	glycosyl hydrolase family protein	NA	NA	NA	NA	NA
QBJ60983.1|4497703_4498831_+|transposase	IS110-like element ISSso6 family transposase	transposase	NA	NA	NA	NA
QBJ60984.1|4498965_4499181_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ60985.1|4499428_4501306_-	PTS beta-glucoside transporter subunit IIABC	NA	NA	NA	NA	NA
QBJ60986.1|4501439_4502276_-	transcriptional antiterminator BglG	NA	NA	NA	NA	NA
QBJ60987.1|4502561_4503287_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
QBJ60988.1|4503301_4504075_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
QBJ60989.1|4504165_4505056_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
QBJ60990.1|4505055_4506015_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
QBJ60991.1|4506101_4507142_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	4.7e-51
QBJ60992.1|4507389_4508463_-	fimbrial protein	NA	NA	NA	NA	NA
QBJ60993.1|4509862_4511027_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	9.2e-181
QBJ60994.1|4512030_4512456_-	pilus assembly protein	NA	NA	NA	NA	NA
QBJ60995.1|4513236_4513539_-	fimbrial protein	NA	NA	NA	NA	NA
QBJ60996.1|4513586_4514159_-	fimbrial protein	NA	NA	NA	NA	NA
QBJ60997.1|4514450_4515779_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
QBJ60998.1|4516389_4516629_+	DUF1819 family protein	NA	NA	NA	NA	NA
QBJ60999.1|4518125_4518599_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
QBJ61000.1|4518693_4519218_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
QBJ61001.1|4519275_4520064_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
QBJ61002.1|4520139_4520637_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ61003.1|4520697_4521069_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ61004.1|4521101_4521425_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ61005.1|4521478_4521856_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ61006.1|4522086_4523703_-	transcriptional antiterminator	NA	NA	NA	NA	NA
QBJ61007.1|4523703_4525230_-	transcriptional antiterminator	NA	NA	NA	NA	NA
QBJ61008.1|4525232_4526900_-	AAA family ATPase	NA	NA	NA	NA	NA
QBJ61009.1|4526896_4529005_-|transposase	transposase	transposase	NA	NA	NA	NA
QBJ61010.1|4528991_4529813_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
