The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	49314	57927	3015457		Streptococcus_phage(66.67%)	11	NA	NA
QBJ54599.1|49314_51012_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
QBJ54600.1|51033_51342_+	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
QBJ54601.1|51357_51957_+	recombination protein RecR	NA	NA	NA	NA	NA
QBJ54602.1|51971_52223_+	DUF2508 domain-containing protein	NA	NA	NA	NA	NA
QBJ54603.1|52608_53274_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
QBJ54604.1|53270_53600_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54605.1|53616_54636_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
QBJ54606.1|54661_55009_+	initiation-control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
QBJ54607.1|55107_56004_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
QBJ54608.1|56007_56793_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
QBJ54609.1|56931_57927_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	2.6e-51
>prophage 2
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	254747	309932	3015457	protease,transposase	unidentified_phage(40.0%)	39	NA	NA
QBJ54768.1|254747_255677_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	1.5e-19
QBJ54769.1|256027_256705_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
QBJ54770.1|256719_257376_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
QBJ54771.1|257446_259303_-	potassium transporter	NA	NA	NA	NA	NA
QBJ54772.1|259324_260392_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
QBJ54773.1|260410_261058_-	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
QBJ54774.1|261289_263596_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
QBJ54775.1|263888_264818_+	enoyl-[acyl-carrier-protein] reductase FabK	NA	NA	NA	NA	NA
QBJ54776.1|264986_265916_+	type I pantothenate kinase	NA	NA	NA	NA	NA
QBJ54777.1|266009_267566_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	29.2	5.6e-16
QBJ54778.1|269728_270490_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ54779.1|270732_271431_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBJ54780.1|271650_271995_+	transcriptional regulator	NA	NA	NA	NA	NA
QBJ54781.1|272126_273425_-	MFS transporter	NA	NA	NA	NA	NA
QBJ54782.1|276271_276586_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	36.0	3.3e-08
QBJ54783.1|279493_280084_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54784.1|282167_282551_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54785.1|282540_284388_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.3	3.4e-20
QBJ54786.1|284627_284882_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
QBJ54787.1|284893_285439_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
QBJ54788.1|285451_285634_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54789.1|285648_286071_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
QBJ54790.1|286131_286572_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
QBJ54791.1|286621_287101_-	N-acetyltransferase	NA	NA	NA	NA	NA
QBJ54792.1|288177_289188_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
QBJ54793.1|289280_290204_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-32
QBJ54794.1|290607_290940_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
QBJ54795.1|293007_293934_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.4	8.5e-20
QBJ54796.1|293934_296106_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
QBJ54797.1|296228_298763_+	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.3	1.2e-68
QBJ54798.1|300134_300344_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54799.1|300340_300889_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	39.8	1.6e-29
QBJ54800.1|301466_302387_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	37.4	2.9e-28
QBJ54801.1|302858_303047_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54802.1|303733_304264_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
QBJ54803.1|304378_308152_-	mucus-binding protein	NA	NA	NA	NA	NA
QBJ54804.1|308357_308480_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54805.1|308523_309150_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	44.7	1.4e-37
QBJ54806.1|309404_309932_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	451122	512585	3015457	tRNA,transposase	Bacillus_phage(25.0%)	49	NA	NA
QBJ54936.1|451122_452046_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.3e-32
QBJ54937.1|452146_453574_+	amino acid permease	NA	NA	NA	NA	NA
QBJ54938.1|453694_454276_+	ECF transporter S component	NA	NA	NA	NA	NA
QBJ54939.1|454368_454545_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ54940.1|457746_459186_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
QBJ54941.1|459178_460174_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
QBJ54942.1|460302_462036_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	22.5	2.1e-19
QBJ54943.1|462035_463796_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.3	3.7e-24
QBJ54944.1|463892_463997_+	ribosome recycling factor	NA	NA	NA	NA	NA
QBJ54945.1|464001_464979_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ54946.1|465169_466147_-	heptaprenyl diphosphate synthase	NA	NA	NA	NA	NA
QBJ54947.1|466291_467206_+	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
QBJ54948.1|467431_467959_+|transposase	transposase	transposase	NA	NA	NA	NA
QBJ57162.1|468213_468840_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	44.7	1.4e-37
QBJ54949.1|468912_469887_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
QBJ54950.1|470333_470975_+	cell wall hydrolase	NA	S5M633	Brevibacillus_phage	42.0	6.7e-24
QBJ54951.1|471025_471613_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
QBJ54952.1|471635_472184_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
QBJ54953.1|472296_473466_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
QBJ54954.1|473906_476174_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.7	4.8e-133
QBJ54955.1|476190_478230_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	33.3	4.7e-95
QBJ54956.1|478226_479402_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
QBJ54957.1|479442_479763_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	NA	NA	NA	NA
QBJ54958.1|479762_481226_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
QBJ54959.1|481225_482650_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit B	tRNA	NA	NA	NA	NA
QBJ54960.1|482754_483777_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
QBJ54961.1|484110_485484_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.8	5.5e-124
QBJ54962.1|485939_486515_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ54963.1|486781_489121_+	magnesium-transporting ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.8	1.6e-38
QBJ54964.1|491685_492564_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ54965.1|492588_493365_+	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
QBJ54966.1|493520_493886_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
QBJ54967.1|494229_494430_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
QBJ54968.1|494616_495624_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
QBJ54969.1|497252_497693_-	universal stress protein	NA	NA	NA	NA	NA
QBJ54970.1|497826_499134_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBJ54971.1|499126_499993_+	acyltransferase	NA	NA	NA	NA	NA
QBJ54972.1|500142_500343_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ54973.1|500541_500982_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54974.1|501415_501979_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ54975.1|502061_502898_-|transposase	transposase	transposase	U5P429	Shigella_phage	28.5	2.2e-19
QBJ54976.1|502945_503653_-|transposase	transposase	transposase	NA	NA	NA	NA
QBJ54977.1|503768_505115_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
QBJ54978.1|505382_506558_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
QBJ54979.1|506746_507865_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.3	7.1e-21
QBJ54980.1|508242_509172_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
QBJ54981.1|509361_510078_+	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	33.1	2.5e-19
QBJ54982.1|510146_511295_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
QBJ54983.1|511655_512585_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
>prophage 4
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	993054	1053535	3015457	transposase	unidentified_phage(12.5%)	56	NA	NA
QBJ55399.1|993054_993984_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.5	5.0e-20
QBJ55400.1|994092_994971_-|transposase	IS982-like element ISLpl4 family transposase	transposase	NA	NA	NA	NA
QBJ55401.1|995960_997040_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
QBJ55402.1|997137_997626_+	N-acetyltransferase	NA	NA	NA	NA	NA
QBJ55403.1|997773_999117_+	glycosyl hydrolase family 25	NA	A0A1S5RCQ2	Lactobacillus_phage	32.2	1.4e-36
QBJ55404.1|1000477_1001653_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
QBJ55405.1|1002807_1003560_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55406.1|1003559_1004237_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	29.1	2.7e-07
QBJ55407.1|1004391_1005471_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55408.1|1005726_1006521_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
QBJ55409.1|1006678_1007785_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
QBJ55410.1|1007781_1008168_-	ribonuclease HI	NA	NA	NA	NA	NA
QBJ55411.1|1008202_1008589_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55412.1|1008682_1010338_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
QBJ55413.1|1010670_1011120_+	signal peptidase II	NA	NA	NA	NA	NA
QBJ57169.1|1011139_1012063_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.1	1.2e-10
QBJ55414.1|1012221_1012746_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
QBJ55415.1|1012780_1013863_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
QBJ55416.1|1013859_1016421_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
QBJ55417.1|1016745_1018491_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55418.1|1018643_1019243_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	39.3	3.3e-33
QBJ55419.1|1019353_1019764_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55420.1|1020278_1020947_-	chloramphenicol acetyltransferase CAT	NA	NA	NA	NA	NA
QBJ55421.1|1020947_1021319_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ55422.1|1021322_1022048_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
QBJ55423.1|1022250_1022745_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
QBJ55424.1|1023139_1024039_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.6	1.3e-36
QBJ55425.1|1024051_1024813_+	ABC transporter permease	NA	NA	NA	NA	NA
QBJ55426.1|1024930_1026637_-	DUF814 domain-containing protein	NA	NA	NA	NA	NA
QBJ55427.1|1027120_1027543_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ55428.1|1027627_1028497_+	DegV family protein	NA	NA	NA	NA	NA
QBJ55429.1|1028498_1028933_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QBJ55430.1|1029047_1029785_+	DUF975 domain-containing protein	NA	NA	NA	NA	NA
QBJ55431.1|1029900_1030629_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55432.1|1030720_1031011_+	RNA-binding protein	NA	NA	NA	NA	NA
QBJ55433.1|1031092_1031881_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
QBJ55434.1|1032082_1033270_-	MFS transporter	NA	NA	NA	NA	NA
QBJ55435.1|1033607_1033940_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55436.1|1033967_1034276_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55437.1|1034504_1035242_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
QBJ55438.1|1035377_1036235_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
QBJ55439.1|1036256_1036442_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55440.1|1036459_1037800_+	amino acid permease	NA	NA	NA	NA	NA
QBJ55441.1|1037992_1038877_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55442.1|1039027_1039378_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55443.1|1042381_1043180_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
QBJ55444.1|1043892_1044594_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
QBJ55445.1|1044595_1045621_+	ribitol-5-phosphate dehydrogenase	NA	NA	NA	NA	NA
QBJ55446.1|1045608_1046715_+	ribitolphosphotransferase	NA	NA	NA	NA	NA
QBJ55447.1|1046740_1048636_+	CDP-glycerol--poly(glycerophosphate) glycerophosphotransferase	NA	NA	NA	NA	NA
QBJ55448.1|1048734_1049262_+	N-acetyltransferase	NA	NA	NA	NA	NA
QBJ55449.1|1049432_1049870_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ55450.1|1049935_1051285_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.6e-27
QBJ55451.1|1051363_1051642_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55452.1|1051943_1052651_+|transposase	transposase	transposase	NA	NA	NA	NA
QBJ55453.1|1052698_1053535_+|transposase	transposase	transposase	U5P429	Shigella_phage	28.5	2.2e-19
>prophage 5
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	1205845	1303582	3015457	tRNA,transposase,head,holin,capsid,portal,protease,tail,integrase,terminase	Lactobacillus_phage(66.0%)	101	1248755:1248772	1310515:1310532
QBJ55579.1|1205845_1207399_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.2	8.8e-54
QBJ55580.1|1207446_1207806_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
QBJ55581.1|1207795_1207975_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55582.1|1208101_1209379_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
QBJ55583.1|1209375_1209618_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
QBJ55584.1|1209641_1210856_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.5	1.9e-27
QBJ55585.1|1212420_1212570_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
QBJ55586.1|1212601_1213777_-	peptidase S12	NA	NA	NA	NA	NA
QBJ55587.1|1214210_1215353_-	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	32.0	4.3e-21
QBJ55588.1|1215454_1217323_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	47.2	5.0e-136
QBJ55589.1|1217366_1217966_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
QBJ55590.1|1217986_1219030_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
QBJ55591.1|1219422_1220133_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
QBJ55592.1|1220133_1221135_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
QBJ55593.1|1221147_1222071_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
QBJ55594.1|1222542_1223064_-	shikimate kinase	NA	NA	NA	NA	NA
QBJ55595.1|1223066_1224164_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
QBJ55596.1|1224166_1225465_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
QBJ55597.1|1226013_1227183_-	chorismate synthase	NA	NA	NA	NA	NA
QBJ55598.1|1227175_1228630_-	MFS transporter	NA	NA	NA	NA	NA
QBJ55599.1|1229098_1230028_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	31.8	1.1e-19
QBJ55600.1|1230037_1230856_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
QBJ55601.1|1231318_1231672_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
QBJ55602.1|1231694_1234271_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
QBJ55603.1|1234285_1234591_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55604.1|1234580_1234880_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
QBJ55605.1|1234924_1236142_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
QBJ55606.1|1236162_1236639_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
QBJ55607.1|1236934_1241248_-	PolC-type DNA polymerase III	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	7.7e-15
QBJ55608.1|1241741_1243451_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
QBJ55609.1|1243490_1244768_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
QBJ55610.1|1244805_1245591_-	CDP-archaeol synthase	NA	NA	NA	NA	NA
QBJ55611.1|1245606_1246386_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.8e-23
QBJ55612.1|1246505_1247069_-	ribosome-recycling factor	NA	NA	NA	NA	NA
QBJ55613.1|1247070_1247793_-	UMP kinase	NA	NA	NA	NA	NA
QBJ55614.1|1247992_1248871_-	elongation factor Ts	NA	NA	NA	NA	NA
1248755:1248772	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
QBJ55615.1|1248973_1249777_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
QBJ55616.1|1250001_1250724_+	HAD family hydrolase	NA	NA	NA	NA	NA
QBJ55617.1|1251012_1252011_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
QBJ55618.1|1252095_1252401_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
QBJ55619.1|1252384_1253143_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
QBJ55620.1|1253254_1253890_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
QBJ55621.1|1253947_1254184_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55622.1|1254281_1254521_-	DUF896 family protein	NA	NA	NA	NA	NA
QBJ55623.1|1254672_1255305_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	54.8	3.9e-16
QBJ55624.1|1255397_1256045_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55625.1|1256144_1256774_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55626.1|1256823_1257993_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
QBJ55627.1|1258028_1258421_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55628.1|1258584_1258986_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55629.1|1259415_1260357_+	glycosyltransferase	NA	V9QJB1	Oenococcus_phage	49.4	4.8e-79
QBJ55630.1|1261920_1262184_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	89.7	2.2e-34
QBJ55631.1|1262183_1263365_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	85.8	9.3e-189
QBJ55632.1|1263376_1263589_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	73.8	8.4e-16
QBJ55633.1|1263662_1263890_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	67.1	1.4e-16
QBJ55634.1|1263886_1264912_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	75.4	3.3e-49
QBJ55635.1|1265245_1265485_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	89.6	5.7e-29
QBJ55636.1|1266852_1269264_-	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	94.0	0.0e+00
QBJ55637.1|1269332_1271105_-|tail	phage tail protein	tail	A0A2P0ZLH2	Lactobacillus_phage	90.7	1.1e-305
QBJ55638.1|1271179_1276078_-	peptidase M23	NA	A0A2P0ZLG0	Lactobacillus_phage	69.5	0.0e+00
QBJ55639.1|1276108_1276294_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55640.1|1276338_1276713_-	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	91.9	2.3e-56
QBJ55641.1|1276788_1277445_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	85.3	2.4e-101
QBJ55642.1|1277460_1277841_-	DUF806 domain-containing protein	NA	A0A2P0ZLF4	Lactobacillus_phage	80.2	1.4e-48
QBJ55643.1|1277840_1278248_-	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	93.2	1.7e-65
QBJ55644.1|1278250_1278598_-|head,tail	head-tail adaptor protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	70.4	1.3e-42
QBJ55645.1|1278587_1278920_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	84.5	1.4e-44
QBJ55646.1|1278992_1280198_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	87.1	4.0e-195
QBJ55647.1|1280197_1280962_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	92.5	1.4e-124
QBJ55648.1|1280939_1282103_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	94.0	4.2e-210
QBJ55649.1|1282105_1282300_-	DUF1056 domain-containing protein	NA	E9LUQ0	Lactobacillus_phage	93.8	2.8e-26
QBJ55650.1|1284138_1284591_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	94.0	2.8e-77
QBJ55651.1|1284798_1285311_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	91.7	5.3e-80
QBJ55652.1|1285452_1285767_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55653.1|1285768_1286071_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55654.1|1286742_1287168_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	87.9	3.2e-67
QBJ55655.1|1288256_1288475_-	hypothetical protein	NA	Q597W8	Lactobacillus_virus	79.2	1.0e-24
QBJ55656.1|1288467_1288653_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	74.2	1.5e-05
QBJ55657.1|1288665_1288875_-	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	95.7	2.0e-30
QBJ55658.1|1288871_1289249_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55659.1|1289245_1289746_-	hypothetical protein	NA	O03915	Lactobacillus_phage	65.5	2.3e-56
QBJ55660.1|1289881_1290667_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.4	7.7e-131
QBJ55661.1|1290666_1291425_-	replisome organizer	NA	E9LUM6	Lactobacillus_phage	56.6	3.0e-39
QBJ55662.1|1291474_1292167_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	98.7	1.8e-131
QBJ55663.1|1292213_1292873_-	DUF669 domain-containing protein	NA	E9LUU2	Lactobacillus_phage	78.5	6.6e-75
QBJ55664.1|1292875_1293538_-	nucleotide-binding protein	NA	E9LUU1	Lactobacillus_phage	95.0	4.5e-116
QBJ55665.1|1293538_1294399_-	DUF1351 domain-containing protein	NA	A0A2D1GPE4	Lactobacillus_phage	33.8	3.5e-36
QBJ55666.1|1294714_1294969_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55667.1|1295111_1295372_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55668.1|1295526_1295709_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55669.1|1295722_1295932_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55670.1|1295943_1296660_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	58.5	5.7e-64
QBJ55671.1|1296716_1296968_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55672.1|1296982_1297758_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
QBJ55673.1|1297927_1298143_-	transcriptional regulator	NA	A0A2H4JBV7	uncultured_Caudovirales_phage	71.0	5.9e-17
QBJ57173.1|1298335_1299007_+	multidrug transporter	NA	D7RWL5	Brochothrix_phage	55.0	9.7e-42
QBJ55674.1|1299129_1300404_+	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	35.8	1.6e-24
QBJ55675.1|1300712_1300901_+	hypothetical protein	NA	E9LUS5	Lactobacillus_phage	98.4	3.6e-26
QBJ55676.1|1301058_1301373_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55677.1|1301563_1301872_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55678.1|1302418_1303582_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.5	1.2e-55
1310515:1310532	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 6
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	1594501	1657864	3015457	plate,transposase,head,holin,capsid,portal,tail,integrase,terminase	Lactobacillus_phage(41.03%)	78	1642907:1642928	1657147:1657168
QBJ55929.1|1594501_1595029_-|transposase	transposase	transposase	NA	NA	NA	NA
QBJ55930.1|1595213_1596185_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55931.1|1596199_1598089_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.4e-58
QBJ55932.1|1598088_1599819_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.0e-46
QBJ55933.1|1600041_1600434_-	DUF1093 domain-containing protein	NA	NA	NA	NA	NA
QBJ55934.1|1600656_1601508_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
QBJ55935.1|1601989_1603312_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	35.1	1.4e-12
QBJ57184.1|1603618_1603984_-|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	79.2	4.7e-14
QBJ55936.1|1603997_1604261_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	95.4	1.1e-36
QBJ55937.1|1604260_1605418_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	85.1	1.4e-189
QBJ55938.1|1605736_1605949_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	80.3	1.8e-18
QBJ55939.1|1605945_1606971_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	75.5	9.9e-54
QBJ55940.1|1607052_1607181_-	XkdX family protein	NA	NA	NA	NA	NA
QBJ55941.1|1608386_1608968_-|plate	phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	47.4	1.5e-43
QBJ55942.1|1608982_1609975_-	SGNH/GDSL hydrolase family protein	NA	A0A1S6L1H1	Staphylococcus_phage	35.0	1.8e-31
QBJ55943.1|1609979_1611878_-	endolysin	NA	A0A1X9IGI5	Lactococcus_phage	34.3	5.7e-47
QBJ55944.1|1611877_1612615_-|tail	phage tail protein	tail	A0A1S5SA63	Streptococcus_phage	35.3	1.7e-39
QBJ55945.1|1612608_1616613_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	44.5	1.2e-81
QBJ55946.1|1616612_1616849_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55947.1|1616941_1617430_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55948.1|1617447_1618008_-|tail	phage tail protein	tail	NA	NA	NA	NA
QBJ55949.1|1618019_1618406_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
QBJ55950.1|1618407_1618962_-|tail	phage tail protein	tail	NA	NA	NA	NA
QBJ57185.1|1618951_1619275_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55951.1|1619279_1619645_-	hypothetical protein	NA	A0A1W6JNH7	Staphylococcus_phage	39.6	2.3e-05
QBJ55952.1|1619659_1620712_-|capsid	phage capsid protein	capsid	A0A0S0N2Q7	Pseudomonas_phage	31.0	2.0e-33
QBJ55953.1|1620728_1621376_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
QBJ55954.1|1621482_1622427_-|head	phage head morphogenesis protein	head	NA	NA	NA	NA
QBJ55955.1|1622426_1624085_-|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	32.7	1.3e-63
QBJ55956.1|1624074_1625361_-|terminase	PBSX family phage terminase large subunit	terminase	B7T0C6	Staphylococcus_virus	49.6	9.1e-113
QBJ55957.1|1625344_1625902_-|terminase	terminase small subunit	terminase	H9A0M8	Staphylococcus_phage	46.5	1.0e-12
QBJ57186.1|1625942_1626275_-	DUF2829 domain-containing protein	NA	A0A0K2FLC4	Brevibacillus_phage	44.3	1.5e-11
QBJ55958.1|1626364_1626598_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55959.1|1626665_1627547_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55960.1|1628157_1628619_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	2.0e-38
QBJ55961.1|1629011_1629329_-	hypothetical protein	NA	A0A2K9VC43	Lactobacillus_phage	43.8	8.2e-15
QBJ55962.1|1629332_1629725_-	hypothetical protein	NA	E9LUP3	Lactobacillus_phage	65.9	8.8e-43
QBJ55963.1|1629721_1630162_-	hypothetical protein	NA	A0A1S5RCV6	Lactobacillus_phage	53.4	2.3e-36
QBJ55964.1|1630145_1630343_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55965.1|1630346_1630658_-	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	90.3	3.2e-48
QBJ55966.1|1630660_1631035_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55967.1|1631031_1631550_-	hypothetical protein	NA	O03915	Lactobacillus_phage	52.3	9.5e-37
QBJ55968.1|1631554_1632277_-	oxidoreductase	NA	Q8SDM9	Staphylococcus_phage	44.7	2.8e-50
QBJ55969.1|1632273_1632561_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55970.1|1632557_1633523_-	DnaD domain protein	NA	NA	NA	NA	NA
QBJ55971.1|1633548_1634409_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.4	3.6e-73
QBJ55972.1|1634332_1635220_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	46.7	2.8e-60
QBJ55973.1|1635216_1635603_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55974.1|1635735_1635906_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55975.1|1635973_1636486_-	XRE family transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	2.3e-27
QBJ55976.1|1636553_1636859_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
QBJ57187.1|1637037_1637292_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBJ55977.1|1637437_1637941_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	41.4	1.1e-21
QBJ55978.1|1637955_1638378_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	34.4	1.0e-12
QBJ55979.1|1638481_1639201_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55980.1|1639774_1640134_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ55981.1|1642393_1642600_-	hypothetical protein	NA	NA	NA	NA	NA
1642907:1642928	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
QBJ55982.1|1643013_1643325_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55983.1|1643407_1643788_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55984.1|1643937_1644207_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
QBJ55985.1|1644299_1645865_-|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	34.4	1.1e-40
QBJ55986.1|1645854_1646961_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.2	1.8e-48
QBJ55987.1|1646961_1647162_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55988.1|1647115_1648819_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.1	4.1e-121
QBJ55989.1|1648815_1649289_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
QBJ55990.1|1650220_1650487_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55991.1|1650527_1650908_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	43.9	1.9e-18
QBJ57188.1|1650900_1651239_-|head,tail	head-tail adaptor protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	35.6	4.6e-08
QBJ55992.1|1651225_1651417_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55993.1|1651432_1651912_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55994.1|1652057_1653452_-	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	41.4	2.2e-67
QBJ55995.1|1653451_1654252_-	DNA replication protein	NA	NA	NA	NA	NA
QBJ55996.1|1654248_1654467_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55997.1|1654598_1654706_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ55998.1|1654748_1654931_-	DNA-binding protein	NA	NA	NA	NA	NA
QBJ55999.1|1655109_1655760_+	XRE family transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	46.5	3.6e-09
QBJ56000.1|1655810_1656968_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.5	2.5e-53
QBJ56001.1|1657336_1657864_+|transposase	transposase	transposase	NA	NA	NA	NA
1657147:1657168	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
>prophage 7
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	1993251	2057906	3015457	protease,transposase	Bacillus_phage(33.33%)	51	NA	NA
QBJ56290.1|1993251_1994175_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	1.3e-31
QBJ56291.1|1994850_1995447_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
QBJ56292.1|1995456_1996497_-	Zn-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
QBJ56293.1|1996517_1997375_-	KR domain-containing protein	NA	NA	NA	NA	NA
QBJ56294.1|1997814_1998036_-	antitoxin MazE	NA	NA	NA	NA	NA
QBJ56295.1|1998291_1998735_-	universal stress protein	NA	NA	NA	NA	NA
QBJ56296.1|1998806_1999376_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
QBJ56297.1|1999472_2000156_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
QBJ56298.1|2000297_2000813_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56299.1|2001234_2001582_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SAB3	Streptococcus_phage	43.0	1.1e-15
QBJ56300.1|2001581_2001800_-	transcription elongation factor GreAB	NA	NA	NA	NA	NA
QBJ56301.1|2002563_2003103_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56302.1|2003271_2004039_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56303.1|2004117_2005440_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
QBJ56304.1|2005527_2006703_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
QBJ56305.1|2006986_2007613_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56306.1|2007602_2008259_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.3	1.5e-31
QBJ56307.1|2008255_2008855_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56308.1|2008904_2009000_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
QBJ56309.1|2009026_2009956_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.5	5.5e-19
QBJ56310.1|2010002_2010665_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56311.1|2010713_2011783_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	4.8e-35
QBJ56312.1|2011825_2012458_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56313.1|2012530_2012992_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56314.1|2013587_2014181_-	NADP oxidoreductase	NA	NA	NA	NA	NA
QBJ56315.1|2015484_2016351_-	DUF3737 domain-containing protein	NA	NA	NA	NA	NA
QBJ56316.1|2016453_2017482_-	aldo/keto reductase	NA	NA	NA	NA	NA
QBJ56317.1|2018119_2019907_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.0	9.5e-44
QBJ56318.1|2019906_2021658_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	1.7e-53
QBJ56319.1|2021926_2023321_+	MFS transporter	NA	NA	NA	NA	NA
QBJ56320.1|2023489_2023717_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56321.1|2023810_2024362_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56322.1|2024515_2028223_-	DUF3533 domain-containing protein	NA	NA	NA	NA	NA
QBJ56323.1|2028247_2028895_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56324.1|2028900_2029230_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56325.1|2029718_2030663_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
QBJ56326.1|2030739_2031285_-	N-acetyltransferase	NA	NA	NA	NA	NA
QBJ56327.1|2031547_2032075_-	N-acetyltransferase	NA	NA	NA	NA	NA
QBJ56328.1|2032670_2033876_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBJ56329.1|2033969_2035592_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	26.1	8.4e-47
QBJ56330.1|2036786_2038619_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
QBJ56331.1|2038762_2041270_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.2	9.7e-135
QBJ56332.1|2041577_2042792_-	MFS transporter	NA	NA	NA	NA	NA
QBJ56333.1|2045443_2046694_-	MFS transporter	NA	NA	NA	NA	NA
QBJ56334.1|2046799_2048095_-	alkaline phosphatase family protein	NA	A0A1V0QG10	Shearwaterpox_virus	21.3	1.0e-07
QBJ56335.1|2049214_2049934_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
QBJ56336.1|2050316_2052821_-	cell surface protein	NA	NA	NA	NA	NA
QBJ56337.1|2053210_2053453_-	cytochrome B5	NA	NA	NA	NA	NA
QBJ56338.1|2053965_2054499_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
QBJ56339.1|2054943_2056074_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.0	5.7e-18
QBJ56340.1|2056982_2057906_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.1e-32
>prophage 8
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	2129898	2195629	3015457	transposase	unidentified_phage(23.08%)	54	NA	NA
QBJ56407.1|2129898_2130828_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	5.0e-20
QBJ56408.1|2130854_2130953_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
QBJ56409.1|2131384_2131711_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
QBJ56410.1|2131734_2133207_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBJ56411.1|2133206_2134589_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
QBJ56412.1|2134785_2135805_-	aldehyde reductase	NA	NA	NA	NA	NA
QBJ56413.1|2135910_2136354_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56414.1|2136737_2137352_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V574	Lactobacillus_phage	60.0	1.3e-11
QBJ56415.1|2137542_2138472_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
QBJ56416.1|2138838_2139501_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K9V574	Lactobacillus_phage	48.9	7.7e-15
QBJ56417.1|2140412_2140760_+	RNA-binding protein	NA	NA	NA	NA	NA
QBJ56418.1|2140745_2141639_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBJ56419.1|2142399_2143044_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
QBJ56420.1|2143247_2144378_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.2	5.7e-18
QBJ56421.1|2144448_2144874_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56422.1|2144873_2146394_-	LytTR family transcriptional regulator	NA	D0R0A3	Streptococcus_phage	28.0	6.5e-25
QBJ56423.1|2146734_2147646_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ57198.1|2148227_2148971_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
QBJ56424.1|2149018_2150425_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56425.1|2150441_2151080_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
QBJ56426.1|2151553_2151964_+	cupin domain-containing protein	NA	NA	NA	NA	NA
QBJ56427.1|2152346_2153102_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
QBJ56428.1|2153118_2153775_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
QBJ56429.1|2153938_2155129_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56430.1|2155150_2156932_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	5.6e-44
QBJ56431.1|2159939_2161139_+	amidohydrolase	NA	NA	NA	NA	NA
QBJ56432.1|2161230_2162121_-	KR domain-containing protein	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.1	1.7e-57
QBJ56433.1|2162921_2164097_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
QBJ56434.1|2164315_2165137_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56435.1|2165263_2166748_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
QBJ56436.1|2167044_2167440_+	transglycosylase	NA	A0A249XZV3	Enterococcus_phage	60.0	2.1e-15
QBJ56437.1|2167735_2168908_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
QBJ56438.1|2169229_2169445_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56439.1|2170138_2171260_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	27.8	4.2e-13
QBJ56440.1|2171624_2173550_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.3	1.2e-81
QBJ56441.1|2173549_2173819_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
QBJ56442.1|2173833_2174208_-	copper-binding protein	NA	NA	NA	NA	NA
QBJ56443.1|2178818_2179580_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56444.1|2179718_2179853_+	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
QBJ57199.1|2180036_2181305_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
QBJ56445.1|2181395_2181479_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
QBJ56446.1|2181505_2182435_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.4	1.6e-18
QBJ56447.1|2183453_2184629_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
QBJ56448.1|2184664_2184940_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56449.1|2184954_2185254_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
QBJ56450.1|2185266_2185737_-	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
QBJ56451.1|2185766_2187803_-	PRD domain-containing protein	NA	NA	NA	NA	NA
QBJ56452.1|2188907_2189135_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56453.1|2190167_2190410_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56454.1|2190443_2191181_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	37.2	4.5e-40
QBJ56455.1|2191596_2192289_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
QBJ56456.1|2192364_2193447_-	AI-2E family transporter	NA	NA	NA	NA	NA
QBJ56457.1|2193593_2194748_-	ROK family protein	NA	NA	NA	NA	NA
QBJ56458.1|2195101_2195629_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	2241936	2297402	3015457	holin,tRNA,transposase,bacteriocin	Erysipelothrix_phage(18.18%)	49	NA	NA
QBJ56503.1|2241936_2243382_+|tRNA	tRNA (uracil-5-)-methyltransferase	tRNA	A0A2K5B251	Erysipelothrix_phage	37.7	4.9e-83
QBJ56504.1|2243420_2243864_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56505.1|2244176_2245028_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
QBJ56506.1|2245142_2245967_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
QBJ56507.1|2246038_2246488_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56508.1|2249929_2250598_-	endonuclease III	NA	NA	NA	NA	NA
QBJ56509.1|2250713_2250971_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56510.1|2251005_2251557_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	41.5	1.2e-34
QBJ56511.1|2251938_2253213_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56512.1|2253348_2253945_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56513.1|2254134_2254617_+	transcriptional repressor	NA	NA	NA	NA	NA
QBJ56514.1|2254861_2255218_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
QBJ56515.1|2255412_2255640_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56516.1|2255694_2256549_-	3',5'-cyclic-nucleotide phosphodiesterase	NA	NA	NA	NA	NA
QBJ56517.1|2256990_2257542_+	N-acetyltransferase	NA	NA	NA	NA	NA
QBJ56518.1|2257954_2258374_-	effector of murein hydrolase LrgA	NA	NA	NA	NA	NA
QBJ56519.1|2258393_2259122_-|holin	antiholin LrgB	holin	NA	NA	NA	NA
QBJ56520.1|2259296_2260136_-	DegV family protein	NA	NA	NA	NA	NA
QBJ56521.1|2260660_2260828_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56522.1|2260995_2261694_+	peptidase	NA	NA	NA	NA	NA
QBJ56523.1|2263776_2264658_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
QBJ56524.1|2265019_2265961_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
QBJ56525.1|2266027_2267140_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	1.3e-35
QBJ56526.1|2267275_2268610_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.4	2.5e-25
QBJ56527.1|2268804_2269134_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
QBJ56528.1|2269355_2270654_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
QBJ56529.1|2270970_2272260_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	6.0e-72
QBJ56530.1|2272302_2273280_+	guanosine monophosphate reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.4e-137
QBJ56531.1|2273435_2274221_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
QBJ56532.1|2274300_2275758_-	cardiolipin synthase	NA	NA	NA	NA	NA
QBJ56533.1|2276440_2277160_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56534.1|2277269_2279144_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
QBJ56535.1|2279201_2279795_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
QBJ56536.1|2280441_2281617_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
QBJ56537.1|2282740_2284165_+	amino acid permease	NA	NA	NA	NA	NA
QBJ56538.1|2284426_2286469_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.7	8.0e-63
QBJ56539.1|2286541_2287486_-	cation transporter	NA	NA	NA	NA	NA
QBJ56540.1|2287814_2288861_-	AI-2E family transporter	NA	NA	NA	NA	NA
QBJ56541.1|2289322_2290441_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	43.5	4.1e-69
QBJ56542.1|2290528_2290912_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
QBJ56543.1|2290926_2291235_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
QBJ56544.1|2291584_2292223_-	hemolysin III	NA	NA	NA	NA	NA
QBJ56545.1|2292499_2292844_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56546.1|2292982_2293870_+	cation transporter	NA	NA	NA	NA	NA
QBJ56547.1|2294055_2294694_-	XRE family transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	49.2	1.4e-05
QBJ56548.1|2294771_2295005_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56549.1|2295514_2295685_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56550.1|2295810_2296518_+|transposase	transposase	transposase	NA	NA	NA	NA
QBJ56551.1|2296565_2297402_+|transposase	transposase	transposase	U5P429	Shigella_phage	28.5	2.2e-19
>prophage 10
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	2387301	2448826	3015457	transposase	unidentified_phage(10.0%)	57	NA	NA
QBJ56626.1|2387301_2388477_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
QBJ56627.1|2389177_2389987_-	WxL domain-containing protein	NA	NA	NA	NA	NA
QBJ56628.1|2390112_2391042_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
QBJ56629.1|2391587_2392091_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56630.1|2392251_2392920_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56631.1|2393226_2394888_+	phosphoenolpyruvate carboxykinase (ATP)	NA	NA	NA	NA	NA
QBJ56632.1|2394989_2395187_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56633.1|2395353_2396763_+	glutamate decarboxylase	NA	NA	NA	NA	NA
QBJ56634.1|2396894_2398061_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
QBJ56635.1|2398341_2398686_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56636.1|2398792_2399164_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56637.1|2399610_2399838_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56638.1|2399971_2401147_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
QBJ56639.1|2401254_2401794_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56640.1|2402288_2402819_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56641.1|2402986_2403580_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56642.1|2403601_2403913_-	DUF2316 domain-containing protein	NA	NA	NA	NA	NA
QBJ56643.1|2403926_2404928_-	amidohydrolase	NA	NA	NA	NA	NA
QBJ56644.1|2405047_2405626_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56645.1|2405786_2406740_+	peroxidase	NA	S4VXK8	Pandoravirus	28.7	5.7e-19
QBJ56646.1|2407007_2407721_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
QBJ56647.1|2407721_2408417_+	YdcF family protein	NA	NA	NA	NA	NA
QBJ57204.1|2409606_2409852_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56648.1|2409844_2410018_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56649.1|2410154_2410340_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56650.1|2410485_2412390_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	2.6e-95
QBJ56651.1|2412543_2413296_-	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	31.0	3.8e-26
QBJ56652.1|2413680_2414001_+	thioredoxin	NA	A0A2K9L3H4	Tupanvirus	39.1	5.2e-09
QBJ56653.1|2414024_2414294_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
QBJ56654.1|2414393_2414597_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56655.1|2414725_2415280_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
QBJ56656.1|2415283_2415517_-	copper chaperone	NA	NA	NA	NA	NA
QBJ56657.1|2415714_2416380_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56658.1|2416690_2418607_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.6	2.8e-73
QBJ57205.1|2419439_2419646_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56659.1|2419759_2420233_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QBJ56660.1|2420291_2421644_-	NADH oxidase	NA	NA	NA	NA	NA
QBJ56661.1|2421960_2424111_-	cell surface protein	NA	NA	NA	NA	NA
QBJ56662.1|2424132_2425146_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
QBJ56663.1|2425243_2425936_-	WxL domain-containing protein	NA	NA	NA	NA	NA
QBJ56664.1|2425973_2426546_-	WxL domain-containing protein	NA	NA	NA	NA	NA
QBJ56665.1|2426542_2426821_-	cell surface protein	NA	NA	NA	NA	NA
QBJ56666.1|2427482_2428070_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56667.1|2428197_2428497_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56668.1|2428498_2429836_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56669.1|2429853_2431047_-	ATPase	NA	A0MZB4	Enterobacteria_phage	24.8	7.6e-05
QBJ56670.1|2431418_2432069_+	aquaporin	NA	A0A1V0SCL5	Indivirus	41.6	1.9e-05
QBJ56671.1|2432280_2434017_-	AarF/ABC1/UbiB kinase family protein	NA	G8DDN0	Micromonas_pusilla_virus	27.7	2.5e-41
QBJ56672.1|2434512_2435904_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
QBJ56673.1|2436047_2437994_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
QBJ56674.1|2438012_2440064_-	beta-galactosidase	NA	NA	NA	NA	NA
QBJ56675.1|2441097_2441884_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
QBJ56676.1|2443298_2443694_-	PASTA domain-containing protein	NA	NA	NA	NA	NA
QBJ56677.1|2443816_2444604_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
QBJ57206.1|2444558_2444678_-	DNA methyltransferase	NA	NA	NA	NA	NA
QBJ56678.1|2445047_2447006_-	alpha-rhamnosidase	NA	NA	NA	NA	NA
QBJ56679.1|2447905_2448826_-|transposase	IS30 family transposase ISLsa1	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
>prophage 11
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	2787675	2844967	3015457	transposase,protease	unidentified_phage(30.0%)	58	NA	NA
QBJ56964.1|2787675_2788437_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBJ56965.1|2789373_2790168_-	LysM domain-containing protein	NA	K4ID66	Lactobacillus_phage	47.1	5.6e-12
QBJ56966.1|2790717_2790819_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
QBJ56967.1|2790845_2791775_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	34.5	6.5e-20
QBJ56968.1|2792266_2792890_-	LysM domain-containing protein	NA	NA	NA	NA	NA
QBJ56969.1|2793294_2793669_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
QBJ56970.1|2793678_2794596_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56971.1|2794592_2795309_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	37.1	1.9e-19
QBJ56972.1|2795308_2797678_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
QBJ56973.1|2798096_2798459_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56974.1|2798647_2799844_+	acetate kinase	NA	NA	NA	NA	NA
QBJ56975.1|2799973_2800417_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QBJ56976.1|2800490_2800913_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56977.1|2801101_2802304_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
QBJ56978.1|2802435_2802768_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56979.1|2802867_2803938_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBJ56980.1|2803934_2804750_-	ABC transporter permease	NA	NA	NA	NA	NA
QBJ56981.1|2804749_2805583_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.5	3.8e-11
QBJ56982.1|2805594_2806692_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.6	1.5e-36
QBJ56983.1|2806762_2807305_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56984.1|2807772_2808240_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
QBJ56985.1|2808425_2808911_+	N-acetyltransferase	NA	NA	NA	NA	NA
QBJ56986.1|2808914_2809442_+	N-acetyltransferase	NA	NA	NA	NA	NA
QBJ56987.1|2809535_2809721_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56988.1|2809981_2810335_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ56989.1|2810334_2811228_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
QBJ56990.1|2811240_2811558_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56991.1|2811523_2812453_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
QBJ56992.1|2812479_2813301_+	acetoin ABC transporter permease	NA	NA	NA	NA	NA
QBJ56993.1|2813406_2814774_-	acetaldehyde dehydrogenase	NA	NA	NA	NA	NA
QBJ56994.1|2815200_2816064_+	fructose-1,6-bisphosphate aldolase, class II	NA	NA	NA	NA	NA
QBJ56995.1|2816356_2817673_-	MFS transporter	NA	NA	NA	NA	NA
QBJ56996.1|2817842_2818745_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
QBJ56997.1|2818757_2818958_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ56998.1|2821124_2821370_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ56999.1|2821498_2822062_+	biotin transporter BioY	NA	NA	NA	NA	NA
QBJ57000.1|2822099_2823071_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
QBJ57001.1|2823067_2823388_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57002.1|2823541_2824717_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
QBJ57003.1|2824891_2826058_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ57004.1|2826653_2827469_+	ABC transporter permease	NA	NA	NA	NA	NA
QBJ57005.1|2827481_2828573_+	teichoic acids export ATP-binding protein TagH	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	7.2e-18
QBJ57006.1|2829944_2830217_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57007.1|2830443_2830986_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ57008.1|2830982_2832428_+	MFS transporter	NA	NA	NA	NA	NA
QBJ57009.1|2832532_2833240_+|transposase	transposase	transposase	NA	NA	NA	NA
QBJ57010.1|2833287_2834124_+|transposase	transposase	transposase	U5P429	Shigella_phage	28.5	2.2e-19
QBJ57011.1|2834461_2835778_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.6	1.9e-33
QBJ57012.1|2836273_2837233_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
QBJ57013.1|2837335_2837605_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57014.1|2837834_2838398_-	peptidase M10	NA	NA	NA	NA	NA
QBJ57015.1|2838591_2839260_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
QBJ57016.1|2839417_2840923_+	copper oxidase	NA	NA	NA	NA	NA
QBJ57017.1|2841187_2841556_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
QBJ57018.1|2841660_2842170_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
QBJ57019.1|2842200_2843397_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
QBJ57020.1|2843506_2843977_+	transcriptional regulator	NA	NA	NA	NA	NA
QBJ57021.1|2844037_2844967_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
>prophage 12
CP026505	Lactobacillus plantarum strain NCIMB700965.EF.A chromosome, complete genome	3015457	2861616	2895652	3015457	tRNA,bacteriocin,protease,transposase	Bacillus_phage(28.57%)	30	NA	NA
QBJ57034.1|2861616_2862546_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
QBJ57035.1|2862770_2862929_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
QBJ57036.1|2862953_2863124_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
QBJ57037.1|2863390_2865541_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.2	2.1e-45
QBJ57038.1|2865556_2866933_+	HlyD family secretion protein	NA	NA	NA	NA	NA
QBJ57039.1|2867576_2868646_-|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
QBJ57040.1|2869086_2869767_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBJ57041.1|2869860_2870547_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBJ57216.1|2870697_2870985_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57042.1|2870995_2871289_+	addiction module antidote protein, HigA family	NA	M9MUN2	Rhodococcus_phage	48.3	9.9e-07
QBJ57043.1|2871578_2873888_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
QBJ57044.1|2874146_2874923_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
QBJ57045.1|2875362_2876379_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
QBJ57046.1|2876786_2877497_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ57047.1|2878938_2879127_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57048.1|2879116_2879539_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
QBJ57217.1|2879761_2881117_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBJ57049.1|2881134_2882571_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
QBJ57050.1|2882691_2883588_+	ROK family protein	NA	NA	NA	NA	NA
QBJ57051.1|2883737_2884484_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
QBJ57218.1|2884596_2885610_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
QBJ57052.1|2886051_2886969_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
QBJ57053.1|2887014_2888289_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
QBJ57054.1|2888281_2889241_+	IpaB/EvcA family protein	NA	NA	NA	NA	NA
QBJ57055.1|2889262_2889967_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
QBJ57056.1|2889966_2890809_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
QBJ57057.1|2891405_2891795_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
QBJ57058.1|2892116_2894168_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
QBJ57059.1|2894243_2894870_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	44.7	1.4e-37
QBJ57060.1|2895124_2895652_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP026506	Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed1, complete sequence	66437	18952	61855	66437	protease,transposase	Streptococcus_phage(16.67%)	38	NA	NA
QBJ57240.1|18952_19588_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBJ57241.1|19868_19973_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57242.1|20413_20551_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57243.1|23395_23698_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57244.1|23728_24358_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57245.1|24433_25399_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
QBJ57246.1|25395_25590_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57247.1|25592_26198_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57248.1|26200_27985_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.7	6.8e-82
QBJ57249.1|28051_28366_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57250.1|30584_31373_+	sortase	NA	NA	NA	NA	NA
QBJ57251.1|31401_34344_+	cell surface protein	NA	NA	NA	NA	NA
QBJ57252.1|34420_34717_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57253.1|35029_35959_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	27.4	4.1e-22
QBJ57254.1|36275_37451_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	5.3e-27
QBJ57255.1|37648_38428_+	chain-length determining protein	NA	NA	NA	NA	NA
QBJ57256.1|38439_39168_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
QBJ57257.1|39154_39928_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
QBJ57258.1|40170_40740_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.7	7.0e-33
QBJ57259.1|41227_41659_-	universal stress protein	NA	NA	NA	NA	NA
QBJ57260.1|41658_43251_-	divalent metal cation transporter	NA	NA	NA	NA	NA
QBJ57261.1|43374_44028_+	Mn-dependent transcriptional regulator	NA	NA	NA	NA	NA
QBJ57262.1|45368_47498_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	91.0	0.0e+00
QBJ57263.1|47490_47859_-	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	77.9	4.5e-49
QBJ57264.1|48064_49081_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.2	3.3e-33
QBJ57265.1|49319_50627_-	Uric acid permease PucJ	NA	NA	NA	NA	NA
QBJ57266.1|51049_51964_-	hypothetical protein	NA	S5VTD3	Leptospira_phage	37.3	3.4e-37
QBJ57267.1|51957_52757_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
QBJ57268.1|53212_54103_-	DDE domain-containing protein	NA	Q6J1X2	Lactobacillus_phage	99.3	4.2e-157
QBJ57269.1|54108_54360_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
QBJ57270.1|54717_54960_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
QBJ57271.1|55362_57102_-	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	26.8	3.3e-33
QBJ57272.1|57506_57857_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ57273.1|59104_59311_-	hypothetical protein	NA	NA	NA	NA	NA
QBJ57274.1|59523_59802_+	hypothetical protein	NA	NA	NA	NA	NA
QBJ57275.1|60105_60414_+	replication protein	NA	NA	NA	NA	NA
QBJ57276.1|60672_60954_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	NA	NA	NA	NA
QBJ57277.1|61079_61855_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
