The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP036202	Escherichia coli strain L725 chromosome, complete genome	4834354	339008	418895	4834354	plate,integrase,protease,capsid,holin,portal,terminase,tail,head	Shigella_phage(58.33%)	94	375696:375751	414984:415039
QBG59790.1|339008_341042_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
QBG59791.1|341170_341758_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
QBG59792.1|341771_343244_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
QBG59793.1|343257_344928_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
QBG59794.1|345140_345806_+	hypothetical protein	NA	NA	NA	NA	NA
QBG59795.1|346051_346747_-	lactate utilization protein C	NA	NA	NA	NA	NA
QBG59796.1|346739_348167_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
QBG59797.1|348177_348897_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
QBG59798.1|349426_350281_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QBG59799.1|350506_351832_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
QBG59800.1|351940_352177_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
QBG59801.1|352188_352782_+	DUF417 domain-containing protein	NA	NA	NA	NA	NA
QBG59802.1|353371_354229_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QBG59803.1|354350_358604_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
QBG59804.1|359719_359821_+	hypothetical protein	NA	NA	NA	NA	NA
QBG63812.1|360183_360447_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
QBG59805.1|360446_360587_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
QBG59806.1|360621_360849_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63813.1|361671_362214_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
QBG59807.1|362288_362876_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
QBG59808.1|362933_363602_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
QBG59809.1|363627_366153_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
QBG59810.1|366142_367786_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
QBG59811.1|367754_368465_+	hypothetical protein	NA	NA	NA	NA	NA
QBG59812.1|368777_369107_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
QBG59813.1|369354_369969_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
QBG59814.1|370386_371076_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
QBG59815.1|371072_372029_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
QBG59816.1|372025_374224_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
QBG59817.1|374233_375190_+	XdhC family protein	NA	NA	NA	NA	NA
QBG59818.1|375168_375579_+	transcriptional regulator	NA	NA	NA	NA	NA
375696:375751	attL	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
QBG59819.1|376166_377861_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
QBG59820.1|377908_378193_-	hypothetical protein	NA	NA	NA	NA	NA
QBG59821.1|378664_379438_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
QBG63814.1|379495_380050_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.4	1.3e-87
QBG59822.1|380076_380472_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	37.5	1.2e-12
QBG59823.1|380473_380917_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.6	7.3e-46
QBG59824.1|380888_381491_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	1.1e-97
QBG59825.1|381490_382231_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	88.2	2.8e-74
QBG59826.1|382234_382819_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.5	2.4e-113
QBG59827.1|382809_383868_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.1	5.6e-201
QBG63815.1|383854_384280_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	96.5	2.4e-78
QBG59828.1|384279_384828_-|plate	phage baseplate assembly protein V	plate	Q8SBG6	Shigella_phage	99.5	8.7e-97
QBG59829.1|384827_385907_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
QBG59830.1|385903_387232_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.4	3.0e-244
QBG59831.1|387342_387789_+	hypothetical protein	NA	NA	NA	NA	NA
QBG59832.1|387821_389654_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.4	5.1e-303
QBG59833.1|389646_389829_-	hypothetical protein	NA	NA	NA	NA	NA
QBG59834.1|389795_390065_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
QBG59835.1|390064_390421_-|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
QBG59836.1|390420_391917_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.8	2.5e-271
QBG59837.1|391900_392071_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
QBG59838.1|392079_392640_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
QBG59839.1|392636_393143_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
QBG59840.1|393117_393528_-|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
QBG59841.1|393524_393848_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
QBG59842.1|393850_394051_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	2.2e-26
QBG59843.1|394100_395306_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	5.3e-224
QBG59844.1|395320_395971_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	98.6	3.6e-118
QBG59845.1|395948_397190_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
QBG59846.1|397189_397372_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
QBG63816.1|397383_398880_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.2	3.7e-299
QBG59847.1|399113_399608_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
QBG59848.1|399733_400084_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	92.2	2.4e-60
QBG59849.1|400211_400586_+	hypothetical protein	NA	NA	NA	NA	NA
QBG59850.1|400664_400913_-	peptidase	NA	Q8SBD8	Shigella_phage	75.6	3.0e-25
QBG59851.1|400797_401190_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	82.3	5.1e-51
QBG59852.1|401173_401650_-	lysozyme	NA	Q8SBE0	Shigella_phage	98.1	1.4e-87
QBG59853.1|401653_401980_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	97.2	1.7e-55
QBG59854.1|402069_402855_-	hypothetical protein	NA	NA	NA	NA	NA
QBG59855.1|403057_403810_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	1.2e-136
QBG59856.1|403823_404813_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	2.5e-195
QBG59857.1|404820_405630_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
QBG59858.1|405649_406039_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.1e-68
QBG59859.1|406035_406362_-	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	99.1	2.7e-53
QBG59860.1|406361_406856_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	4.3e-87
QBG59861.1|406852_407794_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.1	1.8e-150
QBG59862.1|407783_407963_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
QBG59863.1|408138_408690_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
QBG59864.1|408733_408934_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.8e-31
QBG59865.1|409024_409699_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
QBG59866.1|409933_410140_+	hypothetical protein	NA	NA	NA	NA	NA
QBG59867.1|410111_410546_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
QBG59868.1|410464_410668_-	hypothetical protein	NA	U5P0J5	Shigella_phage	97.0	1.0e-31
QBG59869.1|411014_411377_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
QBG59870.1|411442_412267_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
QBG59871.1|412394_412931_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
QBG59872.1|412921_413284_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
QBG59873.1|413283_413589_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
QBG59874.1|413504_413939_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
QBG59875.1|413815_414979_+|integrase	integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
QBG59876.1|415183_416437_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
414984:415039	attR	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
QBG59877.1|416448_417552_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
QBG59878.1|417839_418895_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 2
CP036202	Escherichia coli strain L725 chromosome, complete genome	4834354	480454	515690	4834354	transposase,plate,integrase	Vibrio_phage(100.0%)	31	473016:473075	519458:519534
473016:473075	attL	TGGCGGAACGGACGGGACTCGAACCCGCGACCCCCTGCGTGACAGGCAGGTATTCTAACC	NA	NA	NA	NA
QBG59947.1|480454_481591_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
QBG59948.1|481698_482016_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63819.1|482409_482793_-	hypothetical protein	NA	NA	NA	NA	NA
QBG59949.1|482952_487464_-	sugar-binding protein	NA	NA	NA	NA	NA
QBG59950.1|487494_487926_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
QBG59951.1|487953_490173_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
QBG63820.1|490197_490545_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63821.1|490565_491132_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63822.1|491348_492125_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
QBG59952.1|492124_495991_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
QBG59953.1|495990_496236_-	hypothetical protein	NA	NA	NA	NA	NA
QBG59954.1|496286_496961_-	hypothetical protein	NA	NA	NA	NA	NA
QBG59955.1|496966_498283_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
QBG59956.1|498279_499623_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
QBG59957.1|499626_500160_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
QBG59958.1|500227_500713_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
QBG59959.1|500826_501198_-	hypothetical protein	NA	NA	NA	NA	NA
QBG59960.1|501194_501680_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63823.1|501732_503229_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
QBG59961.1|503271_503817_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
QBG59962.1|503878_504169_-	hypothetical protein	NA	NA	NA	NA	NA
QBG59963.1|504171_504735_-	peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
QBG59964.1|504747_507381_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
QBG59965.1|507713_508628_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
QBG59966.1|508614_509445_+	impE family protein	NA	NA	NA	NA	NA
QBG59967.1|509441_509936_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
QBG59968.1|509951_511835_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
QBG59969.1|511831_512827_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
QBG59970.1|512837_513884_+	cytoplasmic protein	NA	NA	NA	NA	NA
QBG59971.1|513883_514159_+	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
QBG59972.1|515324_515690_+|integrase	integrase	integrase	NA	NA	NA	NA
519458:519534	attR	TGGCGGAACGGACGGGACTCGAACCCGCGACCCCCTGCGTGACAGGCAGGTATTCTAACCGACTGAACTACCGCTCC	NA	NA	NA	NA
>prophage 3
CP036202	Escherichia coli strain L725 chromosome, complete genome	4834354	2562887	2570027	4834354		Escherichia_phage(83.33%)	6	NA	NA
QBG61754.1|2562887_2563526_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
QBG61755.1|2563522_2564785_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
QBG61756.1|2564781_2565690_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
QBG61757.1|2565885_2566653_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
QBG61758.1|2566703_2567360_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
QBG61759.1|2567465_2570027_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 4
CP036202	Escherichia coli strain L725 chromosome, complete genome	4834354	2744368	2825330	4834354	plate,integrase,tRNA,protease,tail,capsid,portal,terminase,holin,head	Salmonella_phage(15.22%)	83	2757488:2757507	2836251:2836270
QBG61910.1|2744368_2745109_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
QBG61911.1|2745378_2745867_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
QBG61912.1|2745978_2747193_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
QBG61913.1|2747220_2747607_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.1	2.4e-53
QBG61914.1|2747623_2747947_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
QBG61915.1|2748042_2748558_+	co-chaperone HscB	NA	NA	NA	NA	NA
QBG61916.1|2748574_2750425_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
QBG61917.1|2750426_2750762_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
QBG61918.1|2750773_2750974_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
QBG61919.1|2751151_2752435_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
QBG61920.1|2752576_2753353_+	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
QBG61921.1|2753845_2754691_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
QBG61922.1|2754897_2759859_+	alpha2-macroglobulin	NA	NA	NA	NA	NA
2757488:2757507	attL	AAACACCAGCAAAAATGCGT	NA	NA	NA	NA
QBG61923.1|2759859_2762172_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
QBG61924.1|2762320_2762752_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
QBG61925.1|2762901_2764056_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
QBG61926.1|2764340_2765339_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
QBG61927.1|2765380_2766499_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
QBG61928.1|2766609_2767884_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
QBG61929.1|2767901_2768522_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
QBG61930.1|2768532_2769711_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
QBG61931.1|2769827_2771300_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
QBG61932.1|2771369_2771585_+	hypothetical protein	NA	NA	NA	NA	NA
QBG61933.1|2771581_2772952_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	6.8e-42
QBG61934.1|2773113_2774580_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
QBG61935.1|2774648_2776226_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
QBG61936.1|2776450_2777650_+|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	62.5	1.9e-133
QBG61937.1|2777653_2777908_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	53.6	2.2e-07
QBG61938.1|2777891_2778269_-	hypothetical protein	NA	NA	NA	NA	NA
QBG61939.1|2778278_2780933_-	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	57.5	1.2e-308
QBG61940.1|2781021_2781252_-	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	38.6	2.2e-06
QBG61941.1|2781575_2781911_+	XRE family transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	51.4	2.6e-19
QBG61942.1|2781942_2783031_+	hypothetical protein	NA	NA	NA	NA	NA
QBG63901.1|2783030_2784029_+	hypothetical protein	NA	NA	NA	NA	NA
QBG61943.1|2784025_2785132_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	51.4	1.7e-99
QBG61944.1|2785128_2785557_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	58.4	3.8e-39
QBG61945.1|2785567_2788417_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	33.6	1.8e-116
QBG63902.1|2788413_2788542_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
QBG61946.1|2788538_2788835_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	51.6	2.0e-15
QBG61947.1|2788844_2789360_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	61.6	5.5e-53
QBG61948.1|2789374_2790553_-|tail	phage tail sheath protein	tail	A4PE49	Ralstonia_virus	69.6	2.9e-158
QBG61949.1|2790672_2791416_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	68.3	2.4e-102
QBG61950.1|2791412_2791871_-	hypothetical protein	NA	A0A0R6PFI9	Moraxella_phage	44.0	3.0e-26
QBG61951.1|2791867_2792575_-	DUF4376 domain-containing protein	NA	X2KPE1	Enterobacteria_phage	37.1	1.3e-25
QBG61952.1|2792571_2794215_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	43.6	1.3e-87
QBG61953.1|2794211_2794826_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	56.4	1.4e-66
QBG61954.1|2794818_2795730_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	65.8	1.3e-108
QBG61955.1|2795726_2796077_-	hypothetical protein	NA	E5E3R0	Burkholderia_phage	54.5	2.5e-25
QBG61956.1|2796076_2796676_-|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	52.4	4.3e-49
QBG61957.1|2796800_2797706_-	abortive phage resistance protein	NA	NA	NA	NA	NA
QBG61958.1|2797779_2798235_-	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	53.1	4.3e-33
QBG61959.1|2798234_2798693_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	50.4	1.4e-31
QBG61960.1|2798788_2799238_-|holin	holin	holin	A0A1S6KZX8	Salmonella_phage	35.4	4.7e-08
QBG61961.1|2799234_2799825_-	N-acetylmuramidase family protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	54.6	7.5e-54
QBG61962.1|2799802_2800117_-|holin	phage holin family protein	holin	A0A0U2JTZ0	Escherichia_phage	38.8	7.6e-05
QBG61963.1|2800113_2800491_-	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	44.9	3.9e-16
QBG61964.1|2800493_2800697_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	56.5	1.7e-13
QBG61965.1|2800811_2801132_-	hypothetical protein	NA	NA	NA	NA	NA
QBG61966.1|2801121_2801328_-	hypothetical protein	NA	NA	NA	NA	NA
QBG61967.1|2801688_2802222_+	hypothetical protein	NA	NA	NA	NA	NA
QBG61968.1|2802315_2802633_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBG61969.1|2802634_2802979_-	addiction module toxin RelE	NA	NA	NA	NA	NA
QBG61970.1|2803074_2803281_-	hypothetical protein	NA	NA	NA	NA	NA
QBG61971.1|2803280_2803517_-	hypothetical protein	NA	NA	NA	NA	NA
QBG61972.1|2803632_2804100_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	46.2	4.1e-31
QBG61973.1|2804185_2804848_-|terminase	terminase	terminase	A0A077K804	Ralstonia_phage	46.8	4.5e-47
QBG61974.1|2804844_2805864_-|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	57.7	2.6e-110
QBG61975.1|2805874_2806702_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	56.7	5.5e-63
QBG61976.1|2806857_2808642_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	64.0	2.1e-224
QBG61977.1|2808638_2809619_+|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	62.3	1.0e-119
QBG61978.1|2810559_2811099_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.3	4.1e-43
QBG61979.1|2811114_2811630_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
QBG61980.1|2811943_2812117_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
QBG61981.1|2812486_2814730_+	cyclic-guanylate-specific phosphodiesterase PdeF	NA	NA	NA	NA	NA
QBG61982.1|2814768_2816310_-	exopolyphosphatase	NA	NA	NA	NA	NA
QBG61983.1|2816314_2818381_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
QBG61984.1|2818551_2819190_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
QBG61985.1|2819189_2820227_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
QBG61986.1|2820551_2821178_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
QBG61987.1|2821263_2822553_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
QBG61988.1|2822602_2823349_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
QBG61989.1|2823486_2823846_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
QBG61990.1|2823866_2825330_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
2836251:2836270	attR	AAACACCAGCAAAAATGCGT	NA	NA	NA	NA
>prophage 5
CP036202	Escherichia coli strain L725 chromosome, complete genome	4834354	3203210	3212652	4834354		Enterobacteria_phage(85.71%)	10	NA	NA
QBG62313.1|3203210_3204137_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
QBG62314.1|3204141_3204873_+	ABC transporter permease	NA	NA	NA	NA	NA
QBG62315.1|3204853_3204961_-	protein YohO	NA	NA	NA	NA	NA
QBG62316.1|3205020_3205752_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
QBG62317.1|3205973_3207659_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
QBG62318.1|3207655_3208375_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
QBG62319.1|3208421_3208892_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
QBG63915.1|3208932_3209394_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
QBG62320.1|3209518_3211519_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
QBG62321.1|3211515_3212652_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 6
CP036202	Escherichia coli strain L725 chromosome, complete genome	4834354	3225163	3311383	4834354	transposase,plate,lysis,integrase,tRNA,capsid,holin,portal,terminase,tail,head	Escherichia_phage(40.68%)	91	3224414:3224431	3316761:3316778
3224414:3224431	attL	CAGCCATTACTGGTGATG	NA	NA	NA	NA
QBG62327.1|3225163_3227197_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
QBG62328.1|3227328_3228438_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
QBG62329.1|3228700_3228982_+	DUF2574 family protein	NA	NA	NA	NA	NA
QBG62330.1|3229274_3229817_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
QBG62331.1|3229897_3230572_+	fimbrial assembly protein	NA	NA	NA	NA	NA
QBG62332.1|3230587_3233068_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
QBG63916.1|3233081_3234116_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
QBG62333.1|3234197_3234536_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
QBG62334.1|3234754_3235579_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
QBG62335.1|3235699_3235972_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
QBG62336.1|3236194_3236983_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
QBG62337.1|3236979_3237780_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
QBG62338.1|3237844_3238663_+	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
QBG62339.1|3238714_3239461_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QBG62340.1|3239434_3240400_-	sugar kinase	NA	NA	NA	NA	NA
QBG62341.1|3240396_3241401_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
QBG62342.1|3241397_3242675_-	MFS transporter	NA	NA	NA	NA	NA
QBG62343.1|3242931_3243984_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
QBG62344.1|3244213_3245068_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
QBG62345.1|3245096_3246359_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
QBG62346.1|3246368_3246821_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
QBG62347.1|3246851_3247136_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
QBG62348.1|3247139_3248495_+	galactitol permease IIC component	NA	NA	NA	NA	NA
QBG62349.1|3248542_3249583_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
QBG62350.1|3249682_3250462_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
QBG62351.1|3250543_3251443_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
QBG62352.1|3251857_3252175_+	hypothetical protein	NA	NA	NA	NA	NA
QBG62353.1|3252439_3253453_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.4e-193
QBG62354.1|3253568_3253868_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
QBG62355.1|3253982_3254258_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
QBG63917.1|3254435_3254936_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
QBG62356.1|3254999_3255224_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
QBG62357.1|3255223_3255526_+	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
QBG62358.1|3255525_3255750_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	97.3	2.5e-34
QBG62359.1|3255746_3256022_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
QBG62360.1|3256011_3258183_+	replication endonuclease	NA	A0A0F7LA09	Escherichia_phage	99.2	0.0e+00
QBG62361.1|3258286_3259216_+	DUF4238 domain-containing protein	NA	A0A0F7LBR6	Escherichia_phage	99.4	3.2e-176
QBG62362.1|3259619_3260654_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	5.5e-201
QBG62363.1|3260653_3262426_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
QBG62364.1|3262599_3263454_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
QBG62365.1|3263508_3264582_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	2.5e-201
QBG62366.1|3264585_3265329_+|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	98.8	6.0e-125
QBG62367.1|3265428_3265938_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
QBG62368.1|3265937_3266141_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
QBG62369.1|3266144_3266426_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
QBG62370.1|3266425_3266923_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
QBG62371.1|3266937_3267363_+	protein lysA	NA	U5N096	Enterobacteria_phage	97.2	1.1e-59
QBG62372.1|3267350_3267776_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	94.3	5.2e-65
QBG62373.1|3267747_3267921_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
QBG62374.1|3267883_3268351_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	3.3e-81
QBG62375.1|3268343_3268796_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
QBG62376.1|3268898_3269972_-	hypothetical protein	NA	NA	NA	NA	NA
QBG62377.1|3270058_3270688_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	95.2	1.8e-106
QBG62378.1|3270684_3271032_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
QBG62379.1|3271036_3271945_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
QBG62380.1|3271937_3272468_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	3.9e-102
QBG62381.1|3272478_3274500_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.2	6.6e-259
QBG62382.1|3274501_3275029_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	8.3e-89
QBG63918.1|3275355_3276546_+	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	99.7	5.4e-176
QBG62383.1|3276832_3278023_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
QBG62384.1|3278035_3278554_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
QBG62385.1|3278610_3278886_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
QBG63919.1|3278918_3279038_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
QBG62386.1|3279030_3281478_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.4	0.0e+00
QBG62387.1|3281492_3281972_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.7	1.9e-84
QBG62388.1|3281971_3283135_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.7	8.3e-206
QBG62389.1|3283215_3283434_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
QBG62390.1|3283706_3285068_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.7	4.2e-217
QBG62391.1|3285170_3285467_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
QBG62392.1|3285468_3285765_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
QBG62393.1|3285973_3286306_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
QBG62394.1|3286496_3287219_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
QBG62395.1|3287215_3288619_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	1.6e-33
QBG62396.1|3288615_3290031_-	MFS transporter	NA	NA	NA	NA	NA
QBG62397.1|3290031_3293109_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
QBG62398.1|3293109_3296232_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
QBG62399.1|3296231_3297479_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
QBG62400.1|3297822_3298896_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	96.6	3.9e-194
QBG62401.1|3298873_3299092_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
QBG62402.1|3299541_3300240_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	83.2	3.9e-102
QBG62403.1|3300370_3300538_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	92.7	1.8e-21
QBG62404.1|3300534_3300816_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	97.8	1.3e-43
QBG62405.1|3300832_3301147_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	5.9e-50
QBG62406.1|3301158_3301641_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
QBG62407.1|3302306_3302750_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	96.6	2.4e-73
QBG62408.1|3302788_3303163_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	81.5	4.6e-49
QBG62409.1|3303261_3303444_-	hypothetical protein	NA	NA	NA	NA	NA
QBG62410.1|3303787_3304522_+	hypothetical protein	NA	A0A0K2FIG2	Enterobacteria_phage	94.4	1.7e-87
QBG62411.1|3304586_3307937_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
QBG62412.1|3307936_3308521_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	97.4	2.9e-106
QBG62413.1|3310110_3311383_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
3316761:3316778	attR	CAGCCATTACTGGTGATG	NA	NA	NA	NA
>prophage 7
CP036202	Escherichia coli strain L725 chromosome, complete genome	4834354	3352893	3360542	4834354		Enterobacteria_phage(42.86%)	7	NA	NA
QBG62443.1|3352893_3354288_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
QBG62444.1|3354462_3355356_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
QBG62445.1|3355728_3356814_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	6.7e-101
QBG62446.1|3356813_3357713_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	5.7e-29
QBG62447.1|3357770_3358649_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	2.5e-106
QBG62448.1|3358653_3359193_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.4	1.1e-51
QBG62449.1|3359237_3360542_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	28.3	2.5e-25
>prophage 8
CP036202	Escherichia coli strain L725 chromosome, complete genome	4834354	3806536	3904202	4834354	transposase,lysis,protease,portal,terminase,tail	Enterobacteria_phage(37.04%)	109	NA	NA
QBG62875.1|3806536_3808963_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
QBG63943.1|3809161_3809467_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
QBG62876.1|3809574_3810285_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
QBG62877.1|3810287_3810848_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
QBG62878.1|3810882_3811224_-	DUF1283 family protein	NA	NA	NA	NA	NA
QBG63944.1|3811358_3811685_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
QBG62879.1|3811890_3813105_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
QBG62880.1|3813116_3814136_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
QBG62881.1|3814193_3814298_+	transporter	NA	NA	NA	NA	NA
QBG62882.1|3814323_3815604_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	8.6e-156
QBG63945.1|3815638_3815875_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
QBG62883.1|3815962_3818434_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
QBG62884.1|3818527_3818719_-	DUF1482 family protein	NA	NA	NA	NA	NA
QBG62885.1|3818715_3818904_-	division inhibition protein DicB	NA	NA	NA	NA	NA
QBG62886.1|3819406_3819607_+	hypothetical protein	NA	NA	NA	NA	NA
QBG62887.1|3819575_3819941_-	hypothetical protein	NA	NA	NA	NA	NA
QBG62888.1|3819952_3820105_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
QBG62889.1|3820273_3820681_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
QBG62890.1|3820761_3820989_+	transcriptional regulator	NA	NA	NA	NA	NA
QBG62891.1|3820972_3821494_+	hypothetical protein	NA	NA	NA	NA	NA
QBG62892.1|3821474_3822440_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
QBG62893.1|3822480_3822882_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
QBG62894.1|3823253_3824708_+	hypothetical protein	NA	NA	NA	NA	NA
QBG62895.1|3825538_3825742_+	hypothetical protein	NA	NA	NA	NA	NA
QBG62896.1|3825748_3825856_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
QBG62897.1|3825900_3826113_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
QBG63946.1|3826341_3826593_+	hypothetical protein	NA	NA	NA	NA	NA
QBG62898.1|3826659_3826938_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
QBG62899.1|3826939_3827989_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	3.3e-113
QBG62900.1|3828006_3828384_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
QBG62901.1|3828539_3829064_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
QBG62902.1|3829256_3830216_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
QBG62903.1|3830622_3831336_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QBG62904.1|3831526_3831742_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
QBG62905.1|3831746_3832058_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	61.6	3.2e-24
QBG62906.1|3832054_3832588_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
QBG62907.1|3832584_3833082_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
QBG63947.1|3833445_3833658_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
QBG63948.1|3833668_3833857_+	cold-shock protein	NA	NA	NA	NA	NA
QBG63949.1|3834004_3834160_+	hypothetical protein	NA	NA	NA	NA	NA
QBG63950.1|3834332_3834506_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
QBG62908.1|3834801_3835008_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
QBG62909.1|3835560_3836055_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
QBG62910.1|3836054_3838157_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
QBG62911.1|3838153_3838366_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	3.2e-31
QBG62912.1|3838293_3839874_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
QBG62913.1|3839818_3841846_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
QBG62914.1|3841932_3842256_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
QBG62915.1|3842248_3842524_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
QBG62916.1|3842535_3843114_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
QBG62917.1|3843110_3843512_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
QBG62918.1|3843523_3844267_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
QBG63951.1|3844327_3844714_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
QBG62919.1|3844722_3845052_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
QBG62920.1|3845023_3848089_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
QBG62921.1|3848088_3848418_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	6.6e-60
QBG62922.1|3848427_3849126_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.8	5.2e-131
QBG62923.1|3849131_3849875_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	7.7e-149
QBG62924.1|3849772_3850420_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
QBG62925.1|3850480_3853894_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.3	0.0e+00
QBG62926.1|3853964_3854564_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
QBG62927.1|3854628_3857589_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	2.4e-55
QBG62928.1|3857588_3858164_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
QBG62929.1|3858261_3858852_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
QBG62930.1|3859168_3859402_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
QBG62931.1|3859470_3859584_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
QBG62932.1|3860188_3861472_+	MFS transporter	NA	NA	NA	NA	NA
QBG62933.1|3861560_3863021_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	8.6e-43
QBG62934.1|3863056_3863260_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
QBG62935.1|3863437_3864124_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QBG62936.1|3864212_3864959_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
QBG62937.1|3865095_3867141_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
QBG62938.1|3867185_3867704_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
QBG62939.1|3867979_3868372_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
QBG62940.1|3868626_3869517_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
QBG62941.1|3869735_3869831_-	protein MgtS	NA	NA	NA	NA	NA
QBG62942.1|3869957_3871145_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
QBG62943.1|3871339_3872239_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
QBG62944.1|3872283_3872982_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QBG62945.1|3873180_3873492_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
QBG62946.1|3873606_3874929_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBG62947.1|3874956_3875268_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
QBG62948.1|3875323_3876997_+	carbohydrate porin	NA	NA	NA	NA	NA
QBG62949.1|3877021_3878461_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	2.4e-29
QBG62950.1|3878517_3878736_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
QBG62951.1|3878767_3879151_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
QBG62952.1|3879170_3879605_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
QBG62953.1|3879816_3880482_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
QBG62954.1|3880506_3881697_-	L-arabinose transporter	NA	NA	NA	NA	NA
QBG62955.1|3881846_3882554_-	putative protein YneK	NA	NA	NA	NA	NA
QBG62956.1|3882502_3882961_-	putative protein YneK	NA	NA	NA	NA	NA
QBG62957.1|3883038_3883920_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBG62958.1|3884020_3885409_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
QBG62959.1|3885472_3886399_+	glutaminase 2	NA	NA	NA	NA	NA
QBG62960.1|3886398_3886758_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
QBG62961.1|3886896_3888315_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
QBG62962.1|3888541_3889993_+	tagaturonate reductase	NA	NA	NA	NA	NA
QBG62963.1|3890199_3891114_+	hypothetical protein	NA	NA	NA	NA	NA
QBG62964.1|3891117_3891876_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
QBG62965.1|3891932_3892223_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
QBG62966.1|3892246_3893122_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
QBG62967.1|3893148_3894171_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
QBG62968.1|3894182_3895175_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
QBG62969.1|3895174_3896203_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
QBG62970.1|3896196_3897732_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	5.5e-16
QBG62971.1|3897980_3898934_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
QBG62972.1|3899012_3900605_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
QBG62973.1|3901135_3902899_+	transporter	NA	NA	NA	NA	NA
QBG62974.1|3902929_3904202_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 9
CP036202	Escherichia coli strain L725 chromosome, complete genome	4834354	4001903	4123190	4834354	transposase,coat,tRNA,tail,terminase,lysis	Escherichia_phage(38.89%)	118	NA	NA
QBG63050.1|4001903_4003112_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.3	4.1e-208
QBG63051.1|4003638_4004307_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
QBG63052.1|4004609_4005203_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
QBG63053.1|4005199_4006192_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
QBG63054.1|4006315_4007296_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
QBG63055.1|4007290_4007827_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
QBG63056.1|4007889_4008114_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
QBG63057.1|4008253_4009909_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
QBG63058.1|4010133_4011477_-	VOC family protein	NA	NA	NA	NA	NA
QBG63059.1|4011693_4012617_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBG63060.1|4012654_4014295_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
QBG63061.1|4014693_4014843_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
QBG63062.1|4014914_4015088_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
QBG63063.1|4015332_4015863_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	2.4e-19
QBG63064.1|4016051_4017053_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
QBG63065.1|4017094_4018534_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
QBG63066.1|4018730_4019531_-	YdcF family protein	NA	NA	NA	NA	NA
QBG63067.1|4019802_4023705_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
QBG63068.1|4023905_4024511_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
QBG63069.1|4024561_4025878_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63070.1|4025867_4027625_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
QBG63071.1|4027640_4028537_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63072.1|4028536_4029142_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
QBG63073.1|4029312_4031619_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
QBG63074.1|4031682_4032543_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
QBG63075.1|4032772_4033363_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
QBG63076.1|4033344_4034295_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
QBG63077.1|4034395_4035709_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
QBG63078.1|4035735_4036941_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
QBG63079.1|4036940_4037363_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
QBG63080.1|4037352_4038780_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
QBG63081.1|4038781_4039570_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
QBG63082.1|4039569_4040337_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
QBG63083.1|4040333_4041404_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
QBG63084.1|4041411_4041909_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
QBG63085.1|4041923_4042670_-	phenylacetate-CoA oxygenase subunit PaaI	NA	NA	NA	NA	NA
QBG63086.1|4042678_4042966_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
QBG63087.1|4042977_4043907_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
QBG63088.1|4044191_4046237_+	bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase	NA	NA	NA	NA	NA
QBG63089.1|4046484_4048758_+	primary-amine oxidase	NA	NA	NA	NA	NA
QBG63090.1|4048815_4050315_-	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
QBG63091.1|4050550_4051456_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
QBG63957.1|4051627_4051954_-	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
QBG63092.1|4051961_4052147_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
QBG63093.1|4052143_4054783_-	YdbH family protein	NA	NA	NA	NA	NA
QBG63094.1|4054990_4055980_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
QBG63095.1|4056090_4056513_+	heat shock protein HslJ	NA	NA	NA	NA	NA
QBG63096.1|4056509_4056776_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
QBG63097.1|4057049_4060574_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
QBG63098.1|4060941_4062075_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	5.4e-117
QBG63099.1|4062215_4062650_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
QBG63100.1|4063426_4063540_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
QBG63101.1|4063608_4063842_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
QBG63102.1|4064158_4064749_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
QBG63103.1|4064846_4065422_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.9e-103
QBG63104.1|4065421_4068493_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	79.2	2.2e-64
QBG63105.1|4068557_4069157_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
QBG63106.1|4070463_4071677_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
QBG63107.1|4073962_4074571_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	7.6e-102
QBG63108.1|4074507_4075251_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.2e-146
QBG63109.1|4075256_4075955_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
QBG63110.1|4075954_4076293_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
QBG63111.1|4076285_4079519_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.3	4.6e-105
QBG63112.1|4079682_4079883_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63958.1|4079990_4080350_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63113.1|4080500_4081463_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
QBG63114.1|4081489_4081882_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
QBG63115.1|4081878_4082259_-	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
QBG63116.1|4082259_4082643_-	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
QBG63117.1|4082642_4083038_-	protein singed	NA	NA	NA	NA	NA
QBG63118.1|4083260_4084400_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	5.7e-159
QBG63119.1|4084498_4085263_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	65.0	4.8e-85
QBG63959.1|4085367_4086480_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
QBG63120.1|4086463_4087870_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	6.7e-186
QBG63960.1|4087872_4089174_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
QBG63121.1|4089154_4090249_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
QBG63122.1|4090252_4090462_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63123.1|4090439_4091372_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
QBG63124.1|4091364_4092156_-	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
QBG63961.1|4092293_4093751_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
QBG63125.1|4093947_4094133_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
QBG63126.1|4094349_4094847_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
QBG63127.1|4094846_4095062_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
QBG63962.1|4095313_4095688_-	tolA family protein	NA	NA	NA	NA	NA
QBG63128.1|4095859_4096288_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
QBG63129.1|4096574_4096856_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63130.1|4097331_4097874_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	4.9e-76
QBG63131.1|4097870_4098161_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
QBG63132.1|4098160_4098760_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
QBG63133.1|4098662_4098860_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63134.1|4099573_4099912_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
QBG63135.1|4100130_4100355_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63136.1|4100635_4101835_+	MFS transporter	NA	NA	NA	NA	NA
QBG63137.1|4101846_4102539_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
QBG63138.1|4102535_4103417_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QBG63139.1|4103547_4104825_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
QBG63140.1|4104888_4106886_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
QBG63141.1|4107226_4107649_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
QBG63142.1|4107689_4108760_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	7.2e-63
QBG63143.1|4108831_4109257_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
QBG63144.1|4109240_4109522_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
QBG63145.1|4109622_4110042_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
QBG63146.1|4110296_4110431_+	hypothetical protein	NA	NA	NA	NA	NA
QBG63147.1|4110441_4110597_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
QBG63963.1|4110593_4111082_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
QBG63148.1|4111523_4111745_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
QBG63149.1|4111744_4111915_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
QBG63150.1|4111989_4112265_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
QBG63151.1|4112366_4114967_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
QBG63152.1|4114959_4115769_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
QBG63153.1|4115825_4116020_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.3	7.6e-32
QBG63154.1|4116012_4116222_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
QBG63155.1|4116300_4116516_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
QBG63156.1|4116517_4117753_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
QBG63157.1|4117804_4118740_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
QBG63158.1|4118868_4120242_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
QBG63159.1|4120719_4121703_-	zinc transporter ZntB	NA	NA	NA	NA	NA
QBG63160.1|4121957_4123190_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 10
CP036202	Escherichia coli strain L725 chromosome, complete genome	4834354	4559078	4646872	4834354	plate,tRNA,integrase,protease,tail,capsid,portal,terminase,lysis,head	Salmonella_phage(57.63%)	94	4637913:4637928	4652635:4652650
QBG63560.1|4559078_4560371_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
QBG63561.1|4560461_4561805_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
QBG63983.1|4561815_4562427_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
QBG63562.1|4562581_4566688_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
QBG63563.1|4566822_4567317_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
QBG63564.1|4567861_4568827_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
QBG63565.1|4568949_4570716_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
QBG63566.1|4570716_4572438_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
QBG63567.1|4572479_4573184_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
QBG63568.1|4573468_4573687_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
QBG63569.1|4574609_4576886_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
QBG63570.1|4576916_4577237_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
QBG63571.1|4577559_4577784_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
QBG63572.1|4577856_4579803_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
QBG63573.1|4579799_4580915_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
QBG63574.1|4581065_4582022_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
QBG63575.1|4582018_4583677_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
QBG63576.1|4584102_4584798_+	aquaporin Z	NA	NA	NA	NA	NA
QBG63577.1|4585292_4586192_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
QBG63578.1|4586335_4587988_+	hydroxylamine reductase	NA	NA	NA	NA	NA
QBG63579.1|4587999_4588968_+	NADH oxidoreductase	NA	NA	NA	NA	NA
QBG63580.1|4589100_4590819_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
QBG63581.1|4590855_4591857_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
QBG63582.1|4591867_4593298_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
QBG63984.1|4593396_4594410_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
QBG63583.1|4594406_4595237_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
QBG63584.1|4595233_4595557_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
QBG63585.1|4595682_4596198_+	lipoprotein	NA	NA	NA	NA	NA
QBG63586.1|4596415_4597144_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
QBG63587.1|4597161_4597893_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBG63588.1|4597899_4598616_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
QBG63589.1|4598615_4599284_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
QBG63590.1|4599575_4600307_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBG63591.1|4600481_4601609_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
QBG63592.1|4601649_4602138_-	DUF2593 family protein	NA	NA	NA	NA	NA
QBG63593.1|4602197_4603043_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
QBG63594.1|4603039_4603993_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
QBG63595.1|4604002_4605136_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
QBG63596.1|4605230_4606343_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
QBG63597.1|4606694_4607171_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
QBG63598.1|4607258_4608161_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
QBG63599.1|4608221_4608944_-	nitroreductase NfsA	NA	NA	NA	NA	NA
QBG63600.1|4608927_4609215_-	DUF1418 family protein	NA	NA	NA	NA	NA
QBG63601.1|4609374_4609632_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
QBG63602.1|4609661_4610039_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63603.1|4610308_4611994_+	transporter	NA	NA	NA	NA	NA
QBG63985.1|4612229_4612448_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
QBG63604.1|4612538_4613639_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	6.5e-176
QBG63605.1|4613635_4614121_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
QBG63606.1|4614117_4617195_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
QBG63607.1|4617187_4617307_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
QBG63608.1|4617321_4617624_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
QBG63609.1|4617678_4618194_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
QBG63610.1|4618203_4619376_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
QBG63611.1|4619518_4620085_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	2.2e-87
QBG63612.1|4620112_4620526_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	35.6	1.3e-09
QBG63613.1|4620527_4620968_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.4	1.1e-38
QBG63614.1|4620939_4621542_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.9	5.0e-98
QBG63615.1|4621541_4623041_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	83.0	1.1e-234
QBG63616.1|4623037_4623643_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	2.6e-110
QBG63617.1|4623635_4624544_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
QBG63618.1|4624530_4624890_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
QBG63619.1|4624886_4625465_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	1.2e-93
QBG63620.1|4625533_4625980_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
QBG63621.1|4625972_4626404_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
QBG63622.1|4626366_4626570_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	3.0e-23
QBG63623.1|4626499_4626928_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.1e-46
QBG63624.1|4626924_4627302_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	8.8e-16
QBG63986.1|4627303_4627777_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
QBG63625.1|4627796_4628012_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
QBG63626.1|4628015_4628219_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
QBG63627.1|4628218_4628683_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
QBG63628.1|4628778_4629429_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.8	1.5e-111
QBG63629.1|4629432_4630491_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
QBG63630.1|4630507_4631341_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
QBG63631.1|4631483_4633250_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
QBG63632.1|4633249_4634275_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.2	1.4e-172
QBG63633.1|4634359_4634848_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63987.1|4634853_4635168_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
QBG63634.1|4635170_4636238_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63635.1|4636305_4636512_-	hypothetical protein	NA	NA	NA	NA	NA
QBG63636.1|4636604_4637765_-	hypothetical protein	NA	NA	NA	NA	NA
4637913:4637928	attL	TCACGCCAGCAACGCC	NA	NA	NA	NA
QBG63988.1|4637935_4638124_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	93.4	5.1e-25
QBG63637.1|4638277_4640692_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
QBG63638.1|4640688_4641546_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
QBG63639.1|4641542_4641770_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
QBG63640.1|4641769_4642003_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
QBG63641.1|4642070_4642412_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
QBG63642.1|4642375_4642576_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
QBG63643.1|4642583_4643093_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
QBG63644.1|4643125_4643347_-	regulator	NA	NA	NA	NA	NA
QBG63645.1|4643442_4644039_+	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
QBG63646.1|4644059_4645736_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
QBG63647.1|4645819_4646872_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
4652635:4652650	attR	TCACGCCAGCAACGCC	NA	NA	NA	NA
>prophage 1
CP036205	Escherichia coli strain L725 plasmid pNDM5-L725, complete sequence	51321	140	47865	51321	coat,transposase	Escherichia_phage(30.77%)	60	NA	NA
QBG64160.1|140_845_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QBG64161.1|946_1426_+	transcriptional regulator	NA	NA	NA	NA	NA
QBG64162.1|2233_5251_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
QBG64163.1|6915_7101_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64217.1|7058_7271_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64164.1|7333_7609_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64165.1|7626_7881_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64166.1|7990_8812_-	sprT domain-containing protein	NA	NA	NA	NA	NA
QBG64167.1|8808_8988_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64168.1|9004_9271_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64169.1|9260_9911_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
QBG64170.1|9948_10404_-	DNA-binding protein	NA	NA	NA	NA	NA
QBG64171.1|10415_12743_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
QBG64172.1|12746_14009_-	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
QBG64173.1|14091_14586_-	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
QBG64174.1|14582_14909_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64175.1|14994_15309_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64176.1|15396_15789_-	conjugal transfer protein	NA	NA	NA	NA	NA
QBG64177.1|15785_17621_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
QBG64178.1|17623_18658_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
QBG64179.1|18654_18852_-	DNA-binding protein	NA	NA	NA	NA	NA
QBG64180.1|18853_20068_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
QBG64181.1|20064_20994_-	conjugal transfer protein	NA	NA	NA	NA	NA
QBG64182.1|20999_21728_-	type IV secretion system protein	NA	NA	NA	NA	NA
QBG64183.1|21922_22978_-	type IV secretion system protein	NA	NA	NA	NA	NA
QBG64184.1|22989_23247_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64185.1|23256_24027_-	pilus assembly protein	NA	NA	NA	NA	NA
QBG64186.1|24036_26790_-	conjugal transfer protein	NA	NA	NA	NA	NA
QBG64187.1|26814_27105_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64188.1|27088_27733_-	transglycosylase	NA	NA	NA	NA	NA
QBG64189.1|27778_28015_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64190.1|27965_28475_-	transcription termination factor NusG	NA	NA	NA	NA	NA
QBG64191.1|28827_29988_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
QBG64218.1|29990_30536_-	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
QBG64192.1|30753_30996_+	hypothetical protein	NA	NA	NA	NA	NA
QBG64193.1|30876_31134_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64194.1|31369_31708_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64195.1|31801_32044_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64219.1|32033_32246_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64196.1|32311_32863_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64197.1|32922_33159_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64198.1|33217_33733_-	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
QBG64199.1|35225_36098_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
QBG64200.1|36106_36550_+	hypothetical protein	NA	NA	NA	NA	NA
QBG64220.1|36737_37091_+	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
QBG64201.1|37111_37396_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64202.1|37431_37743_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64203.1|37948_38233_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
QBG64204.1|38332_38995_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
QBG64205.1|39375_40038_+	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
QBG64206.1|40126_41347_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
QBG64207.1|41448_41688_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
QBG64208.1|41690_42047_+	sOS mutagenesis and repair protein UmuD	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
QBG64209.1|42080_42785_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QBG64210.1|42982_44014_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
QBG64211.1|44024_44663_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
QBG64212.1|44667_45033_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
QBG64213.1|45036_45849_-	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
QBG64214.1|46047_46755_+|transposase	transposase	transposase	Q38213	Escherichia_phage	68.1	1.1e-112
QBG64215.1|46863_47865_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	2.6e-51
>prophage 1
CP036204	Escherichia coli strain L725 plasmid punnamed2, complete sequence	65959	11152	22432	65959		Escherichia_phage(61.11%)	19	NA	NA
QBG64108.1|11152_11248_+	peptidase	NA	Q38402	Escherichia_phage	100.0	8.0e-11
QBG64109.1|11213_11423_+	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
QBG64110.1|11533_12385_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	98.9	6.8e-157
QBG64111.1|13456_13636_-	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	1.0e-22
QBG64112.1|13640_14021_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.8e-62
QBG64113.1|14020_14242_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
QBG64114.1|14314_14704_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
QBG64115.1|14878_15454_+	DNA-binding protein	NA	Q71TH9	Escherichia_phage	80.6	7.2e-86
QBG64116.1|15460_15712_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	91.6	6.6e-36
QBG64154.1|16501_16717_-	hypothetical protein	NA	NA	NA	NA	NA
QBG64155.1|16837_17572_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	71.1	2.0e-112
QBG64117.1|17568_17943_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	91.1	6.8e-61
QBG64118.1|18173_18467_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	90.7	2.0e-44
QBG64156.1|18645_18879_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	95.2	1.5e-26
QBG64119.1|18988_19570_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	98.4	8.5e-111
QBG64120.1|19764_20271_-	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.4e-93
QBG64121.1|20343_21606_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	100.0	5.4e-235
QBG64122.1|21607_21826_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
QBG64123.1|21907_22432_-	hypothetical protein	NA	Q71TJ0	Escherichia_phage	89.9	7.5e-90
