The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035566	Lactobacillus plantarum strain SRCM103300 chromosome, complete genome	3179169	796570	805084	3179169		Synechococcus_phage(33.33%)	9	NA	NA
QBA76580.1|796570_797056_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
QBA76581.1|797039_798170_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
QBA76582.1|798172_798904_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
QBA76583.1|798905_799160_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
QBA76584.1|799159_799840_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
QBA76585.1|799832_802052_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
QBA76586.1|802036_803491_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
QBA76587.1|803487_804513_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	3.2e-60
QBA76588.1|804505_805084_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 2
CP035566	Lactobacillus plantarum strain SRCM103300 chromosome, complete genome	3179169	1000139	1050360	3179169	capsid,integrase,tail,terminase,holin,portal,head	Lactobacillus_phage(52.94%)	62	1010947:1010967	1051090:1051110
QBA76753.1|1000139_1001534_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.2	1.3e-69
QBA76754.1|1001678_1002098_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76755.1|1002121_1002304_+	sporulation protein Cse60	NA	NA	NA	NA	NA
QBA76756.1|1002313_1002652_+|head,tail	head-tail adaptor protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	33.6	1.0e-07
QBA76757.1|1002644_1003034_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.6	8.8e-19
QBA76758.1|1003649_1004123_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
QBA76759.1|1004119_1005823_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.1	9.2e-121
QBA76760.1|1005776_1005977_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76761.1|1005977_1007078_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.0	3.9e-48
QBA76762.1|1007074_1008616_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.8	3.3e-45
QBA76763.1|1009025_1009295_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
QBA76764.1|1009443_1009824_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76765.1|1009906_1010212_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76766.1|1010629_1010836_+	hypothetical protein	NA	NA	NA	NA	NA
1010947:1010967	attL	CCGTGCGGGTGATAAGTCGAC	NA	NA	NA	NA
QBA76767.1|1011187_1012309_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	31.8	3.2e-45
QBA76768.1|1012573_1014193_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	47.9	1.2e-93
QBA76769.1|1014803_1015139_-	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	52.2	4.1e-25
QBA76770.1|1015661_1017158_-	hypothetical protein	NA	NA	NA	NA	NA
QBA76771.1|1017188_1017602_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	4.5e-05
QBA76772.1|1017613_1017976_-	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
QBA76773.1|1018148_1018379_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBA76774.1|1018573_1018879_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
QBA76775.1|1018946_1019459_+	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	44.7	3.2e-29
QBA76776.1|1019526_1019697_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76777.1|1019829_1019943_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76778.1|1019963_1020494_+	hypothetical protein	NA	E9LUU0	Lactobacillus_phage	59.2	4.6e-55
QBA76779.1|1020505_1021471_+	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	5.3e-65
QBA76780.1|1021550_1022459_+	DnaD domain protein	NA	NA	NA	NA	NA
QBA76781.1|1022455_1022743_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76782.1|1022739_1023258_+	hypothetical protein	NA	O03915	Lactobacillus_phage	68.4	1.7e-54
QBA76783.1|1023254_1023635_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76784.1|1023937_1024339_+	hypothetical protein	NA	A0A2K9VC36	Lactobacillus_phage	35.2	1.2e-10
QBA76785.1|1024335_1024626_+	hypothetical protein	NA	A0A2K9VCZ2	Lactobacillus_phage	70.8	2.0e-28
QBA78710.1|1024591_1025020_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	56.6	3.1e-33
QBA76786.1|1025092_1025545_+	DUF1642 domain-containing protein	NA	A0A2K9VCG9	Lactobacillus_phage	50.0	3.5e-35
QBA76787.1|1025541_1025709_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	82.6	2.6e-12
QBA76788.1|1025836_1026298_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
QBA76789.1|1027314_1028073_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76790.1|1028112_1028292_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	50.9	1.0e-06
QBA76791.1|1028260_1028524_+	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	58.6	2.6e-22
QBA76792.1|1028747_1029068_+	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	47.1	1.2e-18
QBA76793.1|1029126_1029987_+|terminase	terminase	terminase	V5URT8	Oenococcus_phage	48.9	1.5e-55
QBA76794.1|1030191_1031490_+|terminase	PBSX family phage terminase large subunit	terminase	B7T0C6	Staphylococcus_virus	50.4	1.3e-114
QBA76795.1|1031479_1033156_+|portal	phage portal protein	portal	D2IYW2	Enterococcus_phage	32.2	6.6e-63
QBA76796.1|1033169_1034114_+|head	phage head morphogenesis protein	head	NA	NA	NA	NA
QBA76797.1|1034222_1034870_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
QBA76798.1|1034883_1035966_+|capsid	phage capsid protein	capsid	A0A0P0HSG2	Acinetobacter_phage	33.2	2.3e-40
QBA76799.1|1035980_1036331_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
QBA78711.1|1036335_1036659_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76800.1|1036648_1037200_+|tail	phage tail protein	tail	NA	NA	NA	NA
QBA76801.1|1037205_1037592_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
QBA76802.1|1037603_1038179_+|tail	phage tail protein	tail	NA	NA	NA	NA
QBA76803.1|1038196_1038709_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76804.1|1038777_1039014_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76805.1|1039013_1043090_+	tape measure protein	NA	E9LUR1	Lactobacillus_phage	43.9	2.6e-81
QBA76806.1|1043099_1043996_+|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	28.5	2.4e-19
QBA76807.1|1043992_1045174_+	hypothetical protein	NA	Q9T1A5	Listeria_phage	24.4	7.8e-18
QBA76808.1|1045170_1045437_+	hypothetical protein	NA	NA	NA	NA	NA
QBA76809.1|1045426_1047613_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
QBA76810.1|1048527_1049706_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	87.5	1.9e-194
QBA76811.1|1049705_1049969_+|holin	holin	holin	E9LUR9	Lactobacillus_phage	94.3	6.9e-36
QBA78712.1|1049982_1050360_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	67.5	6.7e-16
1051090:1051110	attR	CCGTGCGGGTGATAAGTCGAC	NA	NA	NA	NA
>prophage 3
CP035566	Lactobacillus plantarum strain SRCM103300 chromosome, complete genome	3179169	1878004	1886697	3179169	transposase	Staphylococcus_phage(50.0%)	10	NA	NA
QBA77558.1|1878004_1879321_-	NADH peroxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.0	6.6e-10
QBA77559.1|1879474_1880101_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBA77560.1|1880236_1880878_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
QBA77561.1|1880966_1881530_+	hypothetical protein	NA	NA	NA	NA	NA
QBA77562.1|1881833_1882754_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.9	2.1e-50
QBA77563.1|1882794_1883304_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
QBA77564.1|1883334_1883814_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.0e-32
QBA77565.1|1883810_1885025_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.9	3.1e-86
QBA77566.1|1885026_1885629_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.9	3.1e-23
QBA77567.1|1885629_1886697_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.9	1.6e-38
>prophage 4
CP035566	Lactobacillus plantarum strain SRCM103300 chromosome, complete genome	3179169	1892402	1964744	3179169	transposase,tail,tRNA,holin	Lactobacillus_phage(70.83%)	58	NA	NA
QBA77568.1|1892402_1893398_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
QBA77569.1|1894024_1895944_-	hypothetical protein	NA	A0A2P0ZL91	Lactobacillus_phage	72.2	1.7e-54
QBA77570.1|1896334_1896775_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	95.9	4.4e-75
QBA77571.1|1896946_1897721_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
QBA78739.1|1897693_1898662_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.8e-20
QBA77572.1|1898747_1899308_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.9	2.2e-100
QBA77573.1|1899395_1901834_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.3	0.0e+00
QBA77574.1|1901836_1902451_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	99.0	3.1e-111
QBA77575.1|1902794_1903742_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	99.4	2.9e-177
QBA77576.1|1903927_1904899_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	97.5	1.9e-179
QBA77577.1|1904989_1906219_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.2	1.5e-213
QBA77578.1|1906536_1907517_-	HD domain-containing protein	NA	NA	NA	NA	NA
QBA77579.1|1907527_1910005_-	hypothetical protein	NA	NA	NA	NA	NA
QBA77580.1|1909994_1911215_-	DNA repair exonuclease	NA	NA	NA	NA	NA
QBA77581.1|1911284_1911629_-	YlbF family regulator	NA	NA	NA	NA	NA
QBA77582.1|1911719_1913849_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
QBA77583.1|1914142_1914265_-	hypothetical protein	NA	NA	NA	NA	NA
QBA77584.1|1914342_1914804_-	arginine repressor	NA	NA	NA	NA	NA
QBA77585.1|1914981_1916103_-	aminotransferase	NA	NA	NA	NA	NA
QBA77586.1|1916168_1916777_-	amino acid transporter	NA	NA	NA	NA	NA
QBA77587.1|1917010_1918462_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
QBA77588.1|1918564_1918807_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
QBA77589.1|1919077_1919689_+	L,D-transpeptidase	NA	NA	NA	NA	NA
QBA77590.1|1920885_1922358_-	glycosyl hydrolase family protein	NA	NA	NA	NA	NA
QBA77591.1|1922360_1923716_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBA77592.1|1923749_1924049_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
QBA77593.1|1924045_1924384_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
QBA77594.1|1924668_1925139_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
QBA77595.1|1928038_1928695_-	hypothetical protein	NA	NA	NA	NA	NA
QBA77596.1|1929379_1931374_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.4	3.1e-35
QBA77597.1|1931643_1932120_+	hypothetical protein	NA	NA	NA	NA	NA
QBA77598.1|1932325_1934014_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	2.0e-75
QBA77599.1|1934285_1934732_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QBA77600.1|1935120_1935366_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
QBA77601.1|1935492_1936884_-	MATE family efflux transporter	NA	NA	NA	NA	NA
QBA77602.1|1937159_1938935_-	SLC13 family permease	NA	NA	NA	NA	NA
QBA77603.1|1939367_1941107_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
QBA77604.1|1941328_1942285_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
QBA77605.1|1942274_1942898_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.6	4.8e-27
QBA77606.1|1942900_1944076_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.9	2.9e-49
QBA77607.1|1944053_1945691_-	hypothetical protein	NA	NA	NA	NA	NA
QBA77608.1|1946579_1948886_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
QBA77609.1|1948899_1949121_+	hypothetical protein	NA	NA	NA	NA	NA
QBA77610.1|1949014_1950757_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
QBA77611.1|1950829_1951189_+	DUF1516 family protein	NA	NA	NA	NA	NA
QBA78740.1|1951288_1951804_-	GtrA family protein	NA	NA	NA	NA	NA
QBA77612.1|1951858_1952929_+	hypothetical protein	NA	NA	NA	NA	NA
QBA77613.1|1952961_1953081_+	hypothetical protein	NA	NA	NA	NA	NA
QBA77614.1|1953093_1953519_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78741.1|1954093_1954468_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	71.2	2.4e-18
QBA77615.1|1954481_1954745_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	94.3	6.9e-36
QBA77616.1|1954744_1955917_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	89.2	6.6e-195
QBA77617.1|1955928_1956174_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	80.0	3.6e-18
QBA77618.1|1956163_1957291_-	collagen-like protein	NA	E9LUR7	Lactobacillus_phage	93.4	1.7e-54
QBA77619.1|1957439_1957688_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	95.9	2.4e-30
QBA77620.1|1957680_1960533_-|tail	phage tail protein	tail	E9LUR4	Lactobacillus_phage	53.7	1.6e-138
QBA77621.1|1960550_1962908_-	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	91.5	0.0e+00
QBA77622.1|1962974_1964744_-|tail	phage tail protein	tail	E9LUR2	Lactobacillus_phage	91.3	0.0e+00
>prophage 5
CP035566	Lactobacillus plantarum strain SRCM103300 chromosome, complete genome	3179169	1970004	2002745	3179169	capsid,integrase,protease,tail,terminase,portal,head	Lactobacillus_phage(94.12%)	44	1966055:1966070	2000470:2000485
1966055:1966070	attL	GTTGACCACCACGTCT	NA	NA	NA	NA
QBA77624.1|1970004_1970379_-	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	94.4	4.6e-57
QBA77625.1|1970453_1971119_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	90.4	9.5e-106
QBA77626.1|1971134_1971515_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	88.9	1.2e-57
QBA77627.1|1971514_1971922_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	89.4	1.8e-62
QBA77628.1|1971924_1972272_-|head,tail	head-tail adaptor protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	73.9	7.0e-44
QBA77629.1|1972261_1972594_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	80.0	7.4e-43
QBA77630.1|1972666_1973899_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	93.4	3.7e-212
QBA77631.1|1973898_1974654_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	92.4	1.3e-122
QBA77632.1|1974631_1975825_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	3.1e-224
QBA77633.1|1975827_1976022_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	95.3	1.8e-25
QBA77634.1|1977952_1978408_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.0	1.0e-79
QBA77635.1|1978539_1979070_-	endonuclease	NA	U5U4N5	Lactobacillus_phage	43.7	7.2e-32
QBA77636.1|1979047_1979575_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	89.7	9.6e-77
QBA77637.1|1979640_1980306_-	hypothetical protein	NA	NA	NA	NA	NA
QBA77638.1|1980373_1980751_-	hypothetical protein	NA	NA	NA	NA	NA
QBA77639.1|1980770_1981646_-	hypothetical protein	NA	NA	NA	NA	NA
QBA77640.1|1982487_1982658_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	91.1	2.9e-19
QBA78742.1|1983169_1983550_-	hypothetical protein	NA	K4I239	Lactobacillus_phage	53.4	1.8e-32
QBA77641.1|1983791_1984283_-	methyltransferase domain-containing protein	NA	O03918	Lactobacillus_phage	91.8	1.0e-85
QBA77642.1|1984367_1984676_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	93.1	3.5e-47
QBA77643.1|1984753_1985440_-	AP2 domain-containing protein	NA	A0A060QSU6	Streptococcus_phage	49.3	5.3e-11
QBA77644.1|1985602_1986388_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.8	3.1e-132
QBA77645.1|1987213_1987906_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	98.7	4.7e-132
QBA77646.1|1987952_1988612_-	DUF669 domain-containing protein	NA	E9LUU2	Lactobacillus_phage	95.4	4.5e-92
QBA77647.1|1988613_1989276_-	nucleotide-binding protein	NA	E9LUU1	Lactobacillus_phage	99.5	2.7e-121
QBA77648.1|1989276_1990137_-	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	34.0	1.2e-36
QBA77649.1|1990331_1990556_-	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	82.4	2.2e-27
QBA77650.1|1990558_1990813_-	hypothetical protein	NA	NA	NA	NA	NA
QBA77651.1|1990902_1991232_-	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	82.6	5.8e-48
QBA77652.1|1991324_1991516_+	hypothetical protein	NA	NA	NA	NA	NA
QBA77653.1|1991700_1992453_-	phage repressor protein/antirepressor Ant	NA	E9LUT0	Lactobacillus_phage	96.5	2.2e-58
QBA77654.1|1992465_1992681_-	hypothetical protein	NA	NA	NA	NA	NA
QBA77655.1|1992937_1993264_+	XRE family transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	44.1	6.9e-17
QBA77656.1|1993294_1993684_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	54.3	4.6e-36
QBA77657.1|1993748_1993949_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	97.0	3.2e-25
QBA77658.1|1994279_1994693_+	hypothetical protein	NA	E9LUS4	Lactobacillus_phage	98.5	2.8e-71
QBA77659.1|1994685_1995000_+	hypothetical protein	NA	E9LUS3	Lactobacillus_phage	100.0	7.7e-50
QBA77660.1|1995142_1995325_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	64.9	1.5e-13
QBA77661.1|1995769_1996906_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	98.9	1.5e-212
QBA77662.1|1997547_1999818_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.5	8.8e-119
QBA77663.1|1999879_2000167_-	hypothetical protein	NA	NA	NA	NA	NA
QBA77664.1|2000281_2000794_+	hypothetical protein	NA	NA	NA	NA	NA
2000470:2000485	attR	GTTGACCACCACGTCT	NA	NA	NA	NA
QBA77665.1|2000907_2001387_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QBA78743.1|2002079_2002745_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
CP035566	Lactobacillus plantarum strain SRCM103300 chromosome, complete genome	3179169	2153700	2160767	3179169	transposase,integrase	Escherichia_phage(50.0%)	7	2144784:2144796	2155779:2155791
2144784:2144796	attL	GAGTCATCCAATG	NA	NA	NA	NA
QBA77782.1|2153700_2154288_+|integrase	integrase	integrase	D2XR58	Bacillus_phage	42.5	3.6e-32
QBA77783.1|2154350_2154845_+|transposase	transposase	transposase	NA	NA	NA	NA
QBA77784.1|2156000_2156843_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	1.9e-34
2155779:2155791	attR	GAGTCATCCAATG	NA	NA	NA	NA
QBA77785.1|2156912_2157941_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.4	2.2e-69
QBA77786.1|2157950_2158532_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	3.3e-38
QBA77787.1|2158591_2159881_-	hypothetical protein	NA	A0A2K9VCN9	Lactobacillus_phage	24.1	4.5e-27
QBA77788.1|2159903_2160767_-	glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	62.1	4.2e-98
>prophage 7
CP035566	Lactobacillus plantarum strain SRCM103300 chromosome, complete genome	3179169	2755259	2808639	3179169	protease,tRNA,bacteriocin	uncultured_Mediterranean_phage(28.57%)	49	NA	NA
QBA78289.1|2755259_2756531_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	4.5e-96
QBA78290.1|2756997_2758611_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
QBA78291.1|2758783_2759392_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
QBA78292.1|2759436_2759877_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
QBA78293.1|2760239_2761172_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
QBA78294.1|2761186_2762539_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
QBA78295.1|2762558_2763368_+	sugar-phosphatase	NA	NA	NA	NA	NA
QBA78296.1|2763537_2764524_-	lipoprotein	NA	NA	NA	NA	NA
QBA78297.1|2764606_2765629_-	YdcF family protein	NA	NA	NA	NA	NA
QBA78298.1|2765917_2766898_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
QBA78299.1|2767263_2768088_-	serine hydrolase	NA	NA	NA	NA	NA
QBA78300.1|2768323_2769706_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
QBA78301.1|2769774_2770611_-	pur operon repressor	NA	NA	NA	NA	NA
QBA78302.1|2770967_2771771_-	metal ABC transporter permease	NA	NA	NA	NA	NA
QBA78303.1|2771757_2772456_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
QBA78304.1|2772724_2773669_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
QBA78305.1|2773714_2773897_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78306.1|2773978_2774845_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
QBA78307.1|2774977_2775229_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78308.1|2775333_2776224_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
QBA78309.1|2776220_2776784_-	ribonuclease M5	NA	NA	NA	NA	NA
QBA78310.1|2776770_2777547_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
QBA78311.1|2777798_2778287_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78312.1|2778849_2779740_+	transcriptional regulator	NA	NA	NA	NA	NA
QBA78313.1|2779773_2780958_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
QBA78314.1|2781238_2781613_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78315.1|2782099_2784151_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.6	2.3e-89
QBA78316.1|2784472_2784862_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
QBA78317.1|2785456_2786299_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
QBA78318.1|2786298_2787003_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
QBA78319.1|2787024_2787984_-	IpaB/EvcA family protein	NA	NA	NA	NA	NA
QBA78320.1|2787976_2789251_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
QBA78321.1|2789296_2790214_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
QBA78322.1|2790613_2791627_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
QBA78323.1|2792185_2792608_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
QBA78324.1|2792597_2792786_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78325.1|2792792_2794154_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBA78326.1|2794226_2794937_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QBA78327.1|2795344_2796361_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
QBA78328.1|2796800_2797577_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
QBA78329.1|2797835_2800145_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
QBA78330.1|2800239_2800443_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78331.1|2801322_2802003_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBA78332.1|2802089_2802758_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBA78333.1|2802825_2803515_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBA78334.1|2803604_2804981_-	HlyD family secretion protein	NA	NA	NA	NA	NA
QBA78335.1|2807413_2807584_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
QBA78336.1|2807608_2807767_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
QBA78337.1|2807865_2808639_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 8
CP035566	Lactobacillus plantarum strain SRCM103300 chromosome, complete genome	3179169	3124395	3135605	3179169	capsid,tail,terminase,portal,head	Bacillus_phage(25.0%)	13	NA	NA
QBA78619.1|3124395_3126270_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.8	5.5e-34
QBA78620.1|3126283_3126991_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.1	1.3e-44
QBA78621.1|3127593_3127824_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78622.1|3127910_3128111_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	1.4e-20
QBA78623.1|3128234_3128612_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78624.1|3128761_3129031_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
QBA78625.1|3129146_3130676_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.0	2.1e-44
QBA78626.1|3130672_3131773_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.6	4.6e-49
QBA78627.1|3131773_3131974_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78628.1|3131927_3133631_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.5	2.4e-121
QBA78629.1|3133627_3134101_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
QBA78630.1|3134884_3135274_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	46.5	6.1e-20
QBA78631.1|3135266_3135605_-|head,tail	head-tail adaptor protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	36.6	3.2e-09
>prophage 1
CP035567	Lactobacillus plantarum strain SRCM103300 plasmid unnamed1	73692	8678	68061	73692	integrase,transposase	Staphylococcus_phage(21.05%)	52	NA	NA
QBA78780.1|8678_9748_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
QBA78781.1|9889_10312_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
QBA78782.1|10841_12101_-	cytochrome P450	NA	NA	NA	NA	NA
QBA78833.1|12533_12587_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78783.1|12792_13716_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	41.2	1.0e-49
QBA78784.1|14255_14873_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	36.5	1.8e-18
QBA78785.1|15258_15510_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78786.1|15416_17156_+	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	27.4	1.5e-33
QBA78787.1|18619_19315_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.3	2.7e-18
QBA78788.1|19381_20746_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBA78789.1|20742_21573_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
QBA78790.1|21572_22526_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
QBA78791.1|22526_23615_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.3	2.6e-28
QBA78792.1|25240_25795_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	8.9e-33
QBA78793.1|27119_27209_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78794.1|28225_30394_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.3	6.2e-255
QBA78795.1|30500_31427_+	ribonucleoside-diphosphate reductase	NA	A0A2H4P8A9	Corynebacterium_phage	31.4	1.9e-35
QBA78796.1|31441_32392_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.6	7.2e-99
QBA78797.1|32519_33335_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	28.5	8.0e-14
QBA78798.1|33424_33823_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
QBA78799.1|34067_35177_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78800.1|35178_36621_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78801.1|36835_37375_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
QBA78802.1|37496_38036_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
QBA78834.1|38065_38317_+	PspC domain-containing protein	NA	NA	NA	NA	NA
QBA78803.1|38498_39056_+	DUF1541 domain-containing protein	NA	NA	NA	NA	NA
QBA78804.1|39160_40159_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	1.9e-49
QBA78805.1|40382_41552_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
QBA78806.1|42042_42306_+	ribonuclease G	NA	NA	NA	NA	NA
QBA78807.1|42378_42777_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78808.1|42769_43090_-	acetyl-CoA carboxylase	NA	NA	NA	NA	NA
QBA78809.1|43082_44384_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	40.0	1.1e-81
QBA78810.1|44497_44809_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78811.1|45030_45300_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78812.1|45286_46189_-	chromosome partitioning protein ParA	NA	F0PIG8	Enterococcus_phage	32.1	4.1e-27
QBA78813.1|47048_48581_+	plasmid replication protein	NA	NA	NA	NA	NA
QBA78814.1|49188_49986_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
QBA78835.1|50621_50921_+	replication protein	NA	NA	NA	NA	NA
QBA78815.1|52025_52304_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78816.1|52325_52535_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78817.1|52805_54866_+	nickase	NA	NA	NA	NA	NA
QBA78818.1|55124_55280_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78819.1|60776_62021_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	3.2e-46
QBA78820.1|62223_62460_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78821.1|62389_62677_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78822.1|62783_63080_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78823.1|63160_63286_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
QBA78824.1|63312_64158_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	29.7	2.6e-23
QBA78825.1|64298_64790_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
QBA78826.1|64817_65666_-	DegV family EDD domain-containing protein	NA	A0A0N9SI50	Staphylococcus_phage	39.2	6.2e-09
QBA78827.1|66142_67318_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	28.8	4.1e-27
QBA78828.1|67458_68061_-|integrase	integrase	integrase	D2XR58	Bacillus_phage	42.5	2.2e-32
>prophage 1
CP035568	Lactobacillus plantarum strain SRCM103300 plasmid unnamed2	77412	5405	71365	77412	transposase	unidentified_phage(16.67%)	59	NA	NA
QBA78839.1|5405_6335_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.7	4.4e-24
QBA78840.1|7063_7879_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.7	5.4e-10
QBA78841.1|7865_8708_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	8.8e-16
QBA78842.1|8680_9475_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
QBA78843.1|9474_10077_-	ECF transporter S component	NA	NA	NA	NA	NA
QBA78844.1|10650_11235_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	6.5e-18
QBA78845.1|11283_12147_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	5.7e-18
QBA78846.1|12148_13009_+	ABC transporter permease	NA	NA	NA	NA	NA
QBA78847.1|13254_13797_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
QBA78848.1|13879_14074_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78899.1|14093_15872_-	oleate hydratase	NA	NA	NA	NA	NA
QBA78849.1|16296_16515_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78850.1|17409_17541_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
QBA78851.1|17680_18631_+	LysM domain-containing protein	NA	K4ID66	Lactobacillus_phage	55.7	4.8e-10
QBA78852.1|19366_20141_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
QBA78853.1|20729_21905_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.8e-27
QBA78854.1|22305_22407_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
QBA78855.1|22493_22841_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78856.1|22842_23643_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	50.6	2.1e-67
QBA78857.1|24082_24289_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78858.1|24501_24780_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78859.1|25169_25433_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78860.1|26143_26919_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
QBA78861.1|27312_28689_-	MFS transporter	NA	NA	NA	NA	NA
QBA78862.1|28956_29247_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78863.1|29399_29609_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78864.1|29880_31944_+	nickase	NA	NA	NA	NA	NA
QBA78865.1|32040_34176_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	46.2	1.1e-107
QBA78866.1|34839_36003_+	glycosyltransferase	NA	NA	NA	NA	NA
QBA78867.1|39144_39408_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78868.1|39521_41294_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
QBA78869.1|41342_43424_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	28.3	2.3e-33
QBA78870.1|43442_44042_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
QBA78871.1|44258_46943_+	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
QBA78872.1|46932_47634_+	response regulator transcription factor	NA	NA	NA	NA	NA
QBA78873.1|47799_49836_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.4	1.8e-62
QBA78874.1|50219_50657_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QBA78875.1|51033_51588_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	8.9e-33
QBA78876.1|52118_53048_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.7	1.7e-23
QBA78877.1|53074_53263_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78878.1|53326_53749_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78879.1|53769_54624_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78880.1|54685_54928_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78881.1|55176_55485_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78882.1|55477_56344_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	44.4	3.4e-55
QBA78883.1|56878_57061_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78884.1|57962_59630_-	alpha-glucosidase	NA	NA	NA	NA	NA
QBA78900.1|59591_59786_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78885.1|59775_61167_-	MFS transporter	NA	NA	NA	NA	NA
QBA78886.1|61616_62603_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
QBA78887.1|63242_63440_+	hypothetical protein	NA	NA	NA	NA	NA
QBA78888.1|63490_64312_+	filamentation induced by cAMP protein fic	NA	NA	NA	NA	NA
QBA78889.1|64301_64580_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78890.1|64602_64812_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78891.1|65082_67143_+	nickase	NA	NA	NA	NA	NA
QBA78892.1|67171_68737_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	48.4	1.0e-105
QBA78893.1|68922_69501_-	hypothetical protein	NA	NA	NA	NA	NA
QBA78894.1|69594_70152_+	biotin transporter BioY	NA	NA	NA	NA	NA
QBA78895.1|70435_71365_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.7	4.4e-24
