The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035563	Lactobacillus paracasei strain SRCM103299 chromosome, complete genome	3081420	324498	374357	3081420	transposase,protease	Staphylococcus_phage(22.22%)	48	NA	NA
QBA73198.1|324498_325743_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	1.5e-11
QBA73199.1|326241_326448_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73200.1|326717_327284_+	cobalt ABC transporter permease	NA	NA	NA	NA	NA
QBA73201.1|327290_328634_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.1e-15
QBA73202.1|329373_330066_+	thiaminase II	NA	NA	NA	NA	NA
QBA73203.1|330046_330547_+	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
QBA73204.1|330559_331402_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
QBA73205.1|331398_332040_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
QBA73206.1|332029_332857_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
QBA73207.1|333241_334690_+	amino acid permease	NA	NA	NA	NA	NA
QBA73208.1|334997_335243_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73209.1|335623_336631_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
QBA73210.1|336691_337084_+	D-ribose pyranase	NA	NA	NA	NA	NA
QBA73211.1|337152_338655_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.3e-21
QBA73212.1|338638_339619_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
QBA73213.1|339675_340635_+	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBA73214.1|340774_341704_+	ribokinase	NA	NA	NA	NA	NA
QBA73215.1|342121_344113_-	cell division protein FtsI	NA	NA	NA	NA	NA
QBA73216.1|344287_345670_+	MFS transporter	NA	NA	NA	NA	NA
QBA73217.1|345650_346085_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QBA73218.1|346081_346645_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73219.1|346657_346873_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73220.1|347687_348377_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
QBA75699.1|348602_349127_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
QBA73221.1|349209_349599_-	YxeA family protein	NA	NA	NA	NA	NA
QBA73222.1|349630_350137_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73223.1|350164_351085_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA73224.1|351199_351835_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.3	8.7e-24
QBA73225.1|351848_352574_-	rhodopsin	NA	NA	NA	NA	NA
QBA73226.1|352573_353254_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73227.1|353243_354032_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73228.1|354634_356161_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	7.4e-53
QBA73229.1|356431_358528_+	PRD domain-containing protein	NA	NA	NA	NA	NA
QBA73230.1|358528_358840_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
QBA73231.1|358981_360268_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBA73232.1|360284_360707_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73233.1|360728_361589_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
QBA73234.1|361702_362344_+	kinase	NA	NA	NA	NA	NA
QBA73235.1|362630_363461_+	transcriptional regulator	NA	NA	NA	NA	NA
QBA73236.1|363453_364323_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
QBA73237.1|364362_365358_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
QBA73238.1|365912_366692_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	25.4	1.0e-05
QBA73239.1|366962_367217_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73240.1|369182_370103_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA73241.1|370216_370615_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
QBA73242.1|370727_371099_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73243.1|371987_372338_-	Pin-related site-specific recombinase/DNA invertase	NA	NA	NA	NA	NA
QBA73244.1|373340_374357_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	4.2e-36
>prophage 2
CP035563	Lactobacillus paracasei strain SRCM103299 chromosome, complete genome	3081420	527868	615219	3081420	integrase,transposase,holin	Lactobacillus_phage(38.1%)	80	527758:527817	560958:562012
527758:527817	attL	TCCTAGATTGCATAATTAAAGTTACCACCCAGAAAATGTGAAAAAAGACCTGTCCGTTCT	NA	NA	NA	NA
QBA73374.1|527868_528789_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA75709.1|528901_529441_+	ABC transporter permease	NA	NA	NA	NA	NA
QBA73375.1|529630_536350_-	peptidase S8	NA	NA	NA	NA	NA
QBA73376.1|536891_541943_-	peptidase S8	NA	NA	NA	NA	NA
QBA73377.1|542925_545460_+	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.3	1.5e-66
QBA73378.1|546066_547509_+	amino acid permease	NA	NA	NA	NA	NA
QBA73379.1|547618_548122_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
QBA73380.1|548300_549194_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	3.0e-06
QBA73381.1|549348_550215_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
QBA73382.1|550231_551065_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
QBA73383.1|551161_552052_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
QBA73384.1|552085_553303_+	MFS transporter	NA	NA	NA	NA	NA
QBA73385.1|553321_554221_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
QBA73386.1|554665_555481_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
QBA73387.1|555514_556444_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
QBA73388.1|556633_557179_-	hydrophobic protein	NA	NA	NA	NA	NA
QBA73389.1|557499_558669_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	97.9	4.3e-218
QBA73390.1|558781_559042_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
QBA73391.1|559131_559752_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73392.1|559735_559972_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73393.1|559972_560080_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73394.1|560164_560872_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
QBA73395.1|561068_561989_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA75710.1|561997_562330_+	hypothetical protein	NA	NA	NA	NA	NA
560958:562012	attR	TCCTAGATTGCATAATTAAAGTTACCACCCAGAAAATGTGAAAAAAGACCTGTCCGTTCTTGCTAAAATGGTGTTTGCATAACATACCATCTAGAGAGAAGGACAGGTCCCATGGCCATTATAACCTTAATTGAACGATCTCAGATAGAACTGATGCAACACCACACGATTCAATACATCGCCGCGACCTTAGGCCGCTCTCGTATTTCTATTAGGCATGAGCTTCACCGTTGCCCTGAAGGTGATTACTGCGCCATTATAGCTCAGGATCATGCCGATACTTGTCGGCATCGTTGTGGTCGGCACTCGATTTTAACGCCTAAGTTGAAGCGGATGGTAACTGAGAAGCTAAACCTAGGTTGGTCCCCTGAAATGGTCGGTTATGCCGTTCACTGTGCGCCACACACGATTTACCACTGGATTTATCAAAGACAAGTCGATTTTCAGCCAAGCCAACTCTTTGATCACGGTAAACGTCATAAAAGAAGACAAGACCTTCGGTCGCGCTATAACCAAGCAGTAGGCACCTCAATTGAGATTCGCAGTGAGTCAGCTAATCGGCGAACCGAAAAAGGACATTTAGAGATGGATACAGTTCGCGGTGGTCGCGGGTCAAAGGCTGCTGTTTTGACCATTGTCGATCGGGTGACACGTTTAATGGCGACAACTAAGCTTGAAAACTTATCACAAAATGCTGTTCTCAAGGGATTTGCAAGACTGATGGTGGACTTTCCGGGTCCGGTTCGATCAGTGACGGTTGATCACGGTAAAGAGTTTTCCTGCGATCAGGCGCTTACAAAGCGCTATCGGATACCGGTTTACTTTTGCCACGCCTATCACCCGAATGAACGGGGCACAAATGAACGGTTCAATCGAGAACTTCGCTACTATTTCCCGAAGGGAACACAGTTTGATCAGGTTTCAGAGACCGATATTCAACAAGCCACAGCGCTTATCAATAACAAACCTAGAAAATGTCTCCGTTGGCAAACCCCAGTTCAAGCAGTGAGCAAGCCTCTTTCTAGGTGGTAACTTTATTATTGCAATCTAGGTTA	NA	NA	NA	NA
QBA73396.1|562844_563288_+	transcriptional regulator	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
QBA73397.1|563632_563830_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73398.1|564195_565116_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA73399.1|565579_565798_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73400.1|565760_566759_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	2.0e-54
QBA73401.1|566954_567173_-	CsbD family protein	NA	NA	NA	NA	NA
QBA73402.1|568705_569041_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
QBA75711.1|569037_569148_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73403.1|569160_569493_+|transposase	transposase	transposase	NA	NA	NA	NA
QBA73404.1|569522_570251_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
QBA73405.1|570184_571126_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.2	4.0e-17
QBA73406.1|571171_572035_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	4.1e-24
QBA73407.1|572298_573085_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
QBA73408.1|573209_573368_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73409.1|573661_574651_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	40.5	9.9e-59
QBA73410.1|574682_574961_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73411.1|574972_575239_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73412.1|575257_575434_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73413.1|575435_575663_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73414.1|575705_576947_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73415.1|576924_578475_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
QBA73416.1|578484_578904_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
QBA73417.1|578912_579434_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73418.1|579439_580360_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA73419.1|580572_583029_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
QBA73420.1|583025_585083_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73421.1|585088_585424_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73422.1|585407_586004_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73423.1|585984_587913_+	ATP-binding protein	NA	NA	NA	NA	NA
QBA73424.1|587914_588925_+	hydrolase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	38.3	9.0e-15
QBA73425.1|588940_589585_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73426.1|589581_589989_+	thioredoxin	NA	NA	NA	NA	NA
QBA73427.1|589978_590800_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73428.1|591172_591373_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73429.1|591394_591595_+	plasmid replication protein	NA	NA	NA	NA	NA
QBA73430.1|591591_591849_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73431.1|591887_592325_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73432.1|592317_593562_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73433.1|593601_593850_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73434.1|593836_596383_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
QBA73435.1|596677_596782_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
QBA73436.1|597625_598507_+	endonuclease	NA	NA	NA	NA	NA
QBA73437.1|598523_598883_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBA73438.1|599189_599977_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
QBA73439.1|600026_600527_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73440.1|600586_601894_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73441.1|602029_602731_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	2.0e-130
QBA73442.1|603278_604844_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
QBA73443.1|604821_605580_+	AAA family ATPase	NA	NA	NA	NA	NA
QBA73444.1|605572_605770_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75712.1|606102_606678_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
QBA73445.1|606783_607704_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA73446.1|607796_608408_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
QBA73447.1|608370_609993_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.5	4.3e-128
QBA73448.1|610006_613174_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
QBA73449.1|614571_615219_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	50.9	6.3e-54
>prophage 3
CP035563	Lactobacillus paracasei strain SRCM103299 chromosome, complete genome	3081420	627312	677520	3081420	transposase	Lactobacillus_phage(31.58%)	47	NA	NA
QBA73460.1|627312_627780_-	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	29.2	1.6e-06
QBA75714.1|627993_628272_+	hypothetical protein	NA	Q6J1X3	Lactobacillus_phage	94.3	3.9e-29
QBA73461.1|628325_629168_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	97.9	3.1e-154
QBA73462.1|629395_629956_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75715.1|630190_630469_+	hypothetical protein	NA	Q6J1X3	Lactobacillus_phage	94.3	3.9e-29
QBA73463.1|630522_631365_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	4.3e-156
QBA75716.1|631482_631683_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73464.1|631676_632594_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
QBA73465.1|632740_633349_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.4e-50
QBA73466.1|633359_634628_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	48.2	2.2e-50
QBA73467.1|634896_635325_+	FMN-binding protein	NA	NA	NA	NA	NA
QBA73468.1|636498_637182_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.8e-59
QBA73469.1|638152_638569_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	56.9	3.9e-33
QBA73470.1|638591_638927_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
QBA73471.1|638963_640259_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	61.9	2.0e-144
QBA73472.1|640300_642034_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
QBA73473.1|642082_642406_-	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.7	5.2e-17
QBA73474.1|642528_643125_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	36.5	5.1e-26
QBA73475.1|644373_644649_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
QBA73476.1|644687_645474_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
QBA73477.1|646172_646916_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.5e-27
QBA73478.1|646893_648141_+	ABC transporter permease	NA	NA	NA	NA	NA
QBA73479.1|648145_648817_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBA73480.1|648908_649592_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	5.2e-59
QBA73481.1|649832_650753_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA73482.1|651200_651464_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73483.1|651424_652075_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	4.3e-18
QBA73484.1|652071_652842_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
QBA75717.1|652949_654272_-	MFS transporter	NA	NA	NA	NA	NA
QBA73485.1|656235_656325_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73486.1|656634_657418_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
QBA73487.1|657693_659226_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
QBA73488.1|659225_660185_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.9	8.8e-28
QBA73489.1|660190_661516_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
QBA73490.1|661566_662487_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA73491.1|663332_664121_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73492.1|664206_665343_-	PLP-dependent transferase	NA	NA	NA	NA	NA
QBA73493.1|665444_666257_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
QBA73494.1|666288_667002_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
QBA73495.1|667585_668497_+	FliK family flagellar hook-length control protein	NA	NA	NA	NA	NA
QBA73496.1|668769_670158_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
QBA73497.1|671248_671917_+	WxL domain-containing protein	NA	NA	NA	NA	NA
QBA73498.1|671984_673004_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
QBA73499.1|672984_673362_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
QBA73500.1|673358_675380_+	lectin	NA	NA	NA	NA	NA
QBA73501.1|675504_675621_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73502.1|676599_677520_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 4
CP035563	Lactobacillus paracasei strain SRCM103299 chromosome, complete genome	3081420	933255	974972	3081420	integrase,portal,capsid,head,tail,protease,tRNA,holin,terminase	Lactobacillus_phage(97.83%)	56	940273:940289	975217:975233
QBA73723.1|933255_935667_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
QBA73724.1|935735_935846_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73725.1|935932_937576_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
QBA73726.1|937580_938291_+	pseudouridine synthase	NA	NA	NA	NA	NA
QBA73727.1|938433_938649_+	DNA-binding protein	NA	NA	NA	NA	NA
QBA73728.1|938764_939586_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
QBA73729.1|939582_940086_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
940273:940289	attL	TTCCTGTTCGCGGCATT	NA	NA	NA	NA
QBA73730.1|940409_941549_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	98.7	6.6e-216
QBA73731.1|942877_943309_-	hypothetical protein	NA	A0A0P0IJV8	Lactobacillus_phage	100.0	6.8e-73
QBA73732.1|943378_943861_-	hypothetical protein	NA	A0A0P0IZP3	Lactobacillus_phage	100.0	2.1e-83
QBA73733.1|943864_944158_-	hypothetical protein	NA	A0A0P0HRW5	Lactobacillus_phage	100.0	5.7e-47
QBA73734.1|944336_945101_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	55.5	9.1e-44
QBA73735.1|945114_945525_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73736.1|945526_945856_-	XRE family transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	33.0	1.1e-09
QBA73737.1|946129_946327_+	XRE family transcriptional regulator	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
QBA73738.1|946323_947121_+	hypothetical protein	NA	A0A0P0IDD0	Lactobacillus_phage	59.4	4.1e-55
QBA73739.1|947128_947341_+	hypothetical protein	NA	A0A0N7IRA6	Lactobacillus_phage	100.0	7.8e-30
QBA73740.1|947449_947674_+	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
QBA73741.1|947673_947766_+	hypothetical protein	NA	A0A0P0I7S8	Lactobacillus_phage	96.7	5.9e-11
QBA73742.1|947762_947975_+	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	95.7	1.8e-34
QBA73743.1|947984_948860_+	hypothetical protein	NA	A0A0P0IJW5	Lactobacillus_phage	97.9	1.1e-167
QBA73744.1|948862_949057_+	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	98.4	5.5e-30
QBA73745.1|949056_949944_+	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	100.0	8.6e-163
QBA73746.1|949952_950198_+	XRE family transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	98.8	1.0e-36
QBA75727.1|950289_951036_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	45.2	5.4e-41
QBA73747.1|951073_951895_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	95.2	5.7e-145
QBA73748.1|951891_952074_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73749.1|952076_952295_+	XRE family transcriptional regulator	NA	U5U738	Lactobacillus_phage	45.8	8.1e-06
QBA73750.1|952684_952900_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73751.1|952896_953301_+	hypothetical protein	NA	A0A2D1GPA7	Lactobacillus_phage	61.5	5.0e-41
QBA73752.1|953377_953599_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75728.1|953675_954098_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	97.1	1.8e-73
QBA73753.1|954102_954366_+	hypothetical protein	NA	A0A0P0IJX1	Lactobacillus_phage	100.0	6.1e-40
QBA73754.1|954389_954713_+	hypothetical protein	NA	A0A0N7IRA8	Lactobacillus_phage	99.1	2.8e-55
QBA73755.1|954791_955241_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0P0IZR0	Lactobacillus_phage	93.3	1.7e-74
QBA75729.1|955914_956289_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	97.6	8.9e-61
QBA73756.1|956291_958022_+|terminase	terminase large subunit	terminase	A0A0P0IJU3	Lactobacillus_phage	99.1	0.0e+00
QBA73757.1|958040_959276_+|portal	phage portal protein	portal	A0A0P0IZM3	Lactobacillus_phage	99.0	2.5e-232
QBA73758.1|959253_959961_+|protease	Clp protease ClpP	protease	A0A1B0Y857	Lactobacillus_phage	99.1	4.6e-127
QBA73759.1|959965_961195_+|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	97.8	6.0e-223
QBA73760.1|961268_961517_+	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	96.3	1.3e-36
QBA73761.1|961530_961857_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	7.0e-54
QBA73762.1|961795_962134_+|head,tail	phage head-tail joining protein	head,tail	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
QBA73763.1|962117_962447_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	97.2	3.8e-55
QBA73764.1|962436_962820_+	hypothetical protein	NA	A0A0P0IQS9	Lactobacillus_phage	97.6	6.5e-67
QBA73765.1|962831_963479_+|tail	phage tail protein	tail	A0A0P0I7R6	Lactobacillus_phage	93.5	2.5e-111
QBA73766.1|963555_963921_+	hypothetical protein	NA	A0A0P0IXK4	Lactobacillus_phage	100.0	4.6e-62
QBA73767.1|964182_967353_+|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	98.8	0.0e+00
QBA73768.1|967359_968055_+|tail	phage tail protein	tail	A0A1B0Y2S2	Lactobacillus_phage	98.3	2.3e-126
QBA73769.1|968051_972335_+	hypothetical protein	NA	A0A1B0Y2S0	Lactobacillus_phage	75.1	0.0e+00
QBA73770.1|972363_972789_+	DUF1617 family protein	NA	A0A1B0Y2S1	Lactobacillus_phage	99.3	3.3e-72
QBA73771.1|972791_973061_+	hypothetical protein	NA	A0A0P0I3K6	Lactobacillus_phage	96.6	9.9e-38
QBA73772.1|973105_973399_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	84.4	1.2e-39
QBA73773.1|973388_973823_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	88.2	3.6e-45
QBA73774.1|973822_974011_+	hypothetical protein	NA	A0A0P0IQT6	Lactobacillus_phage	100.0	6.7e-25
QBA73775.1|973997_974972_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0P0I7S1	Lactobacillus_phage	99.7	2.0e-197
975217:975233	attR	TTCCTGTTCGCGGCATT	NA	NA	NA	NA
>prophage 5
CP035563	Lactobacillus paracasei strain SRCM103299 chromosome, complete genome	3081420	1088462	1142854	3081420	integrase,portal,head,capsid,tail,tRNA,terminase	Staphylococcus_phage(25.0%)	60	1101065:1101081	1146016:1146032
QBA73874.1|1088462_1088924_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
QBA73875.1|1089006_1089111_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73876.1|1089373_1090270_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	7.9e-23
QBA73877.1|1090262_1091522_+	ABC transporter permease	NA	NA	NA	NA	NA
QBA73878.1|1091655_1092198_-	exonuclease	NA	A0A1S5SFA9	Streptococcus_phage	41.0	4.8e-23
QBA73879.1|1092209_1092968_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.7	6.9e-60
QBA75737.1|1093151_1094021_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
QBA73880.1|1094042_1096151_+	sodium:proton antiporter	NA	NA	NA	NA	NA
QBA73881.1|1096456_1096996_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QBA73882.1|1097009_1098098_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.6	9.9e-36
QBA73883.1|1098197_1099022_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	25.9	1.3e-11
QBA73884.1|1099011_1099851_+	ABC transporter permease	NA	NA	NA	NA	NA
QBA73885.1|1099834_1100908_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1101065:1101081	attL	GGGAAAATGGCTTTAAA	NA	NA	NA	NA
QBA73886.1|1101248_1101443_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73887.1|1101512_1101707_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73888.1|1101925_1104718_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.0	1.6e-74
QBA73889.1|1104821_1105466_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QBA73890.1|1105503_1106643_-	ABC transporter permease	NA	NA	NA	NA	NA
QBA73891.1|1106632_1107367_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.8	2.5e-27
QBA73892.1|1107630_1108488_+	TIGR00159 family protein	NA	NA	NA	NA	NA
QBA73893.1|1108484_1109570_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73894.1|1109591_1110956_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
QBA73895.1|1111271_1113083_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1GV45	Paramecium_bursaria_Chlorella_virus	37.5	5.8e-89
QBA73896.1|1113290_1115096_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
QBA73897.1|1115170_1115662_+	VanZ family protein	NA	NA	NA	NA	NA
QBA73898.1|1115732_1116464_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
QBA73899.1|1116589_1117456_+	AAA family ATPase	NA	NA	NA	NA	NA
QBA73900.1|1117452_1118406_+	type II secretion system protein F	NA	NA	NA	NA	NA
QBA73901.1|1118408_1118732_+	type II secretion system protein	NA	NA	NA	NA	NA
QBA73902.1|1118728_1119169_+	competence protein ComGC	NA	NA	NA	NA	NA
QBA75738.1|1119213_1119450_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73903.1|1119409_1119871_+	type II secretion system protein	NA	NA	NA	NA	NA
QBA73904.1|1119854_1120187_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73905.1|1120289_1121300_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QBA73906.1|1121518_1121977_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73907.1|1122115_1123504_+	amino acid permease	NA	NA	NA	NA	NA
QBA73908.1|1123703_1124468_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
QBA73909.1|1124464_1125304_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
QBA73910.1|1125304_1126261_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
QBA73911.1|1126257_1127127_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
QBA73912.1|1127404_1129696_+	alpha-galactosidase	NA	NA	NA	NA	NA
QBA73913.1|1129828_1129951_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73914.1|1129966_1130275_-	hypothetical protein	NA	NA	NA	NA	NA
QBA73915.1|1130546_1131695_-|integrase	site-specific integrase	integrase	A0A097BYJ7	Leuconostoc_phage	28.9	1.0e-30
QBA73916.1|1131793_1132495_-	transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	38.0	4.0e-06
QBA73917.1|1132642_1132921_+	DNA-binding protein	NA	NA	NA	NA	NA
QBA73918.1|1132988_1133210_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73919.1|1133320_1133512_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73920.1|1133560_1133851_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73921.1|1133847_1134036_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73922.1|1134019_1134832_+	DNA replication protein	NA	Q854C1	Mycobacterium_phage	32.5	6.7e-13
QBA73923.1|1134835_1136428_+	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	27.6	1.0e-25
QBA73924.1|1136748_1137084_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
QBA73925.1|1137088_1137274_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73926.1|1137270_1137693_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	46.7	8.3e-23
QBA73927.1|1137809_1138280_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
QBA73928.1|1138276_1139980_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	42.3	1.2e-117
QBA73929.1|1139945_1140125_+	hypothetical protein	NA	NA	NA	NA	NA
QBA73930.1|1140129_1141308_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.3	2.2e-60
QBA73931.1|1141297_1142854_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.5	2.8e-39
1146016:1146032	attR	GGGAAAATGGCTTTAAA	NA	NA	NA	NA
>prophage 6
CP035563	Lactobacillus paracasei strain SRCM103299 chromosome, complete genome	3081420	1232126	1275045	3081420	portal,transposase,head,capsid,tail,holin,terminase	Lactobacillus_phage(87.27%)	63	NA	NA
QBA74009.1|1232126_1233143_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	4.2e-36
QBA74010.1|1233539_1233743_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	94.0	4.0e-31
QBA74011.1|1233766_1234192_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	86.5	2.7e-61
QBA74012.1|1234396_1235080_-	hypothetical protein	NA	NA	NA	NA	NA
QBA74013.1|1235156_1235858_-	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	36.9	2.2e-20
QBA74014.1|1235921_1236341_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	92.8	5.6e-72
QBA74015.1|1236330_1236669_-	XRE family transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	99.1	1.0e-55
QBA74016.1|1236803_1237046_+	XRE family transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	92.5	1.3e-33
QBA74017.1|1237042_1237354_+	hypothetical protein	NA	A0A1B0Y2Q8	Lactobacillus_phage	100.0	2.2e-52
QBA74018.1|1237350_1237560_-	hypothetical protein	NA	A0A1B0Y3M6	Lactobacillus_phage	98.6	1.1e-31
QBA75746.1|1237859_1238408_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	97.8	6.0e-98
QBA74019.1|1238386_1238608_+	DNA-binding protein	NA	A0A0P0ID64	Lactobacillus_phage	98.6	2.6e-36
QBA74020.1|1238620_1238749_+	hypothetical protein	NA	A0A0P0IQL2	Lactobacillus_phage	90.5	7.3e-15
QBA74021.1|1238736_1238979_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74022.1|1238980_1239151_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74023.1|1239164_1240031_+	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	53.3	2.3e-59
QBA75747.1|1240050_1240815_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	55.2	2.3e-79
QBA74024.1|1240826_1241744_+	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	57.5	2.9e-89
QBA74025.1|1241755_1242241_+	single-stranded DNA-binding protein	NA	A0A0P0IJE0	Lactobacillus_phage	86.3	1.2e-52
QBA74026.1|1242555_1242771_+	XRE family transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	100.0	1.3e-32
QBA74027.1|1242767_1243217_+	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	85.2	2.2e-61
QBA74028.1|1243263_1243518_+	hypothetical protein	NA	U5U728	Lactobacillus_phage	95.2	1.2e-37
QBA74029.1|1243514_1243880_+	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	99.2	6.9e-66
QBA74030.1|1243893_1244004_+	acetyltransferase	NA	A0A2D1GP93	Lactobacillus_phage	91.7	9.3e-11
QBA74031.1|1244510_1244780_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74032.1|1244769_1245096_+	hypothetical protein	NA	Q6J1U7	Lactobacillus_phage	44.5	8.1e-18
QBA74033.1|1245092_1245446_+	hypothetical protein	NA	A0A2D1GPL5	Lactobacillus_phage	81.2	6.3e-32
QBA74034.1|1245432_1245831_+	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	56.1	5.1e-30
QBA74035.1|1245827_1246037_+	hypothetical protein	NA	A0A2D1GPJ8	Lactobacillus_phage	88.4	4.5e-30
QBA74036.1|1246073_1246361_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	94.7	8.3e-51
QBA75748.1|1246357_1246429_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74037.1|1246830_1247820_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	40.5	9.9e-59
QBA74038.1|1247909_1248353_+	transcriptional regulator	NA	A0A0P0IZI6	Lactobacillus_phage	95.9	1.0e-76
QBA74039.1|1248984_1249608_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74040.1|1249637_1250855_+	hypothetical protein	NA	A0A2D1GPQ9	Lactobacillus_phage	96.8	1.8e-235
QBA74041.1|1250841_1251171_+	ribonucleoside-diphosphate reductase	NA	A0A0P0IJY9	Lactobacillus_phage	87.7	1.1e-49
QBA74042.1|1251207_1251780_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	95.8	6.9e-81
QBA75749.1|1251763_1253017_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	99.0	1.1e-248
QBA74043.1|1253021_1254449_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	97.7	4.6e-259
QBA74044.1|1254414_1255401_+|head	phage head morphogenesis protein	head	A0A0P0ID43	Lactobacillus_phage	95.4	1.8e-177
QBA74045.1|1255410_1255737_+	hypothetical protein	NA	A0A0P0IJR5	Lactobacillus_phage	91.7	4.7e-50
QBA74046.1|1255733_1256168_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74047.1|1256309_1256951_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	85.0	4.7e-78
QBA74048.1|1256963_1257278_+	hypothetical protein	NA	A0A0N7IR89	Lactobacillus_phage	100.0	2.7e-50
QBA74049.1|1257291_1258332_+|capsid	major capsid protein	capsid	A0A0P0I7J2	Lactobacillus_phage	99.1	9.7e-190
QBA74050.1|1258595_1258781_-	hypothetical protein	NA	NA	NA	NA	NA
QBA74051.1|1258812_1259691_+	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	99.7	7.7e-180
QBA74052.1|1259690_1260065_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	98.4	4.3e-63
QBA74053.1|1260069_1260372_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	89.0	2.6e-47
QBA74054.1|1260368_1260734_+|tail	phage tail protein	tail	A0A0P0I3G7	Lactobacillus_phage	94.2	2.2e-56
QBA74055.1|1260734_1261139_+	DUF3168 domain-containing protein	NA	A0A0P0IQB5	Lactobacillus_phage	98.5	1.0e-70
QBA74056.1|1261150_1261753_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	94.0	6.4e-101
QBA74057.1|1261839_1262172_+	hypothetical protein	NA	A0A0P0IQQ6	Lactobacillus_phage	95.5	3.7e-50
QBA74058.1|1262276_1262630_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	97.4	2.4e-55
QBA74059.1|1262622_1265712_+|tail	phage tail tape measure protein	tail	A0A0P0IJD2	Lactobacillus_phage	93.9	3.9e-279
QBA74060.1|1265809_1266730_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA74061.1|1270869_1271790_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA74062.1|1272421_1272697_+	hypothetical protein	NA	A0A0P0IZK1	Lactobacillus_phage	41.2	5.2e-10
QBA74063.1|1272689_1272821_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	95.3	7.2e-18
QBA74064.1|1272851_1273238_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	98.4	2.1e-65
QBA74065.1|1273218_1273425_+	hypothetical protein	NA	A0A2D1GPJ3	Lactobacillus_phage	97.4	5.5e-12
QBA74066.1|1273421_1273868_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	95.9	9.3e-65
QBA75750.1|1273980_1275045_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	74.4	5.0e-149
>prophage 7
CP035563	Lactobacillus paracasei strain SRCM103299 chromosome, complete genome	3081420	2043650	2105676	3081420	tail,transposase,protease	unidentified_phage(16.67%)	55	NA	NA
QBA74768.1|2043650_2044412_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	51.0	3.7e-05
QBA74769.1|2044398_2044605_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74770.1|2044586_2045354_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
QBA74771.1|2045703_2046624_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA74772.1|2046721_2048317_+	surface protein, LPXTG-anchored	NA	NA	NA	NA	NA
QBA74773.1|2048441_2049086_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
QBA74774.1|2049209_2050067_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
QBA74775.1|2050063_2050657_-	abortive infection protein	NA	NA	NA	NA	NA
QBA74776.1|2050891_2051101_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74777.1|2051106_2051637_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75772.1|2051839_2052040_+	KTSC domain-containing protein	NA	A0A1S5S8T9	Streptococcus_phage	54.5	8.2e-13
QBA75773.1|2052182_2052422_-	hypothetical protein	NA	NA	NA	NA	NA
QBA74778.1|2052580_2053030_+	XRE family transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	37.8	1.1e-20
QBA75774.1|2053176_2054244_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
QBA74779.1|2055758_2056679_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA74780.1|2056705_2057023_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74781.1|2057231_2057969_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	47.1	1.0e-55
QBA74782.1|2059503_2059731_-	hypothetical protein	NA	NA	NA	NA	NA
QBA74783.1|2059821_2060046_-	hypothetical protein	NA	NA	NA	NA	NA
QBA74784.1|2060093_2060345_-	hypothetical protein	NA	NA	NA	NA	NA
QBA74785.1|2060372_2060564_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75775.1|2060701_2060881_-	hypothetical protein	NA	NA	NA	NA	NA
QBA74786.1|2060918_2061191_-	hypothetical protein	NA	NA	NA	NA	NA
QBA74787.1|2061552_2062263_-	DNA methyltransferase	NA	NA	NA	NA	NA
QBA74788.1|2062262_2066660_-	restriction endonuclease	NA	A0A1V0SEE0	Indivirus	25.4	1.1e-13
QBA75776.1|2066739_2068281_-	RNA-directed DNA polymerase	NA	Q2P9X6	Enterobacteria_phage	30.1	1.1e-67
QBA74789.1|2068496_2070050_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
QBA74790.1|2070222_2071149_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	4.1e-30
QBA74791.1|2071304_2071667_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74792.1|2071713_2072004_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74793.1|2072081_2073491_-	C69 family dipeptidase	NA	NA	NA	NA	NA
QBA74794.1|2073823_2074300_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
QBA74795.1|2074304_2076596_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
QBA74796.1|2077027_2077222_-	Tat pathway signal protein	NA	NA	NA	NA	NA
QBA74797.1|2077293_2079123_+	potassium transporter	NA	NA	NA	NA	NA
QBA74798.1|2079178_2080084_+	proline-specific peptidase family protein	NA	NA	NA	NA	NA
QBA74799.1|2080141_2080603_+|tail	phage tail protein	tail	NA	NA	NA	NA
QBA74800.1|2080714_2082067_-	divalent metal cation transporter MntH	NA	NA	NA	NA	NA
QBA74801.1|2082053_2083019_-	ferrochelatase	NA	NA	NA	NA	NA
QBA75777.1|2083176_2083836_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
QBA74802.1|2084189_2085998_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
QBA74803.1|2086010_2086769_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	5.5e-33
QBA74804.1|2087069_2088725_+	amino acid permease	NA	NA	NA	NA	NA
QBA74805.1|2088860_2089742_+	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
QBA74806.1|2089879_2091175_+	GTPase HflX	NA	NA	NA	NA	NA
QBA74807.1|2091312_2092311_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
QBA74808.1|2092620_2094945_-	hypothetical protein	NA	NA	NA	NA	NA
QBA74809.1|2095232_2096282_-	EpsG family protein	NA	NA	NA	NA	NA
QBA74810.1|2096360_2096996_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
QBA74811.1|2097053_2097746_-	tyrosine protein kinase	NA	NA	NA	NA	NA
QBA74812.1|2097989_2099429_-	histidine kinase	NA	NA	NA	NA	NA
QBA74813.1|2099443_2100580_-	glycosyltransferase	NA	NA	NA	NA	NA
QBA74814.1|2100634_2101600_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.8	3.9e-07
QBA74815.1|2102009_2103683_+	hypothetical protein	NA	NA	NA	NA	NA
QBA74816.1|2104110_2105676_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP035563	Lactobacillus paracasei strain SRCM103299 chromosome, complete genome	3081420	2458604	2566109	3081420	bacteriocin,transposase,protease	Staphylococcus_phage(13.33%)	112	NA	NA
QBA75124.1|2458604_2459444_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBA75125.1|2459456_2460473_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75126.1|2460479_2460854_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QBA75127.1|2461018_2462290_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
QBA75128.1|2462607_2463384_-	ABC transporter permease	NA	NA	NA	NA	NA
QBA75129.1|2463401_2464289_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	4.0e-35
QBA75130.1|2464591_2465707_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
QBA75131.1|2465728_2467093_-	DNA repair protein RadA	NA	NA	NA	NA	NA
QBA75132.1|2467109_2467652_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
QBA75133.1|2467872_2468163_+	N-acetyltransferase	NA	NA	NA	NA	NA
QBA75134.1|2468278_2468656_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
QBA75135.1|2468900_2470220_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	9.2e-60
QBA75136.1|2470542_2471889_+	aminopeptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
QBA75137.1|2472116_2473217_+	ABC transporter permease	NA	NA	NA	NA	NA
QBA75138.1|2473216_2474410_+	ABC transporter permease	NA	NA	NA	NA	NA
QBA75139.1|2474472_2475351_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
QBA75140.1|2475512_2477567_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.5e-64
QBA75141.1|2477723_2480354_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.3	1.9e-88
QBA75142.1|2480515_2481139_-	CBS domain-containing protein	NA	NA	NA	NA	NA
QBA75143.1|2481639_2482311_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
QBA75144.1|2482821_2483943_+	bacitracin ABC transporter permease	NA	NA	NA	NA	NA
QBA75145.1|2483956_2484241_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
QBA75146.1|2484565_2484763_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75147.1|2484755_2485514_-	AAA family ATPase	NA	NA	NA	NA	NA
QBA75148.1|2485491_2487057_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
QBA75149.1|2487238_2488354_-	lactate oxidase	NA	NA	NA	NA	NA
QBA75150.1|2488541_2488748_-	CsbD family protein	NA	NA	NA	NA	NA
QBA75151.1|2488897_2490088_-	phosphopentomutase	NA	NA	NA	NA	NA
QBA75152.1|2490107_2491340_-	MFS transporter	NA	NA	NA	NA	NA
QBA75153.1|2491384_2492128_-	uridine phosphorylase	NA	NA	NA	NA	NA
QBA75154.1|2492124_2493339_-	MFS transporter	NA	NA	NA	NA	NA
QBA75155.1|2493532_2494717_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
QBA75156.1|2494799_2495057_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75157.1|2495127_2495334_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75158.1|2495558_2495810_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75159.1|2495932_2496112_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75160.1|2496136_2497369_+	MFS transporter	NA	NA	NA	NA	NA
QBA75161.1|2497447_2498704_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	54.0	3.6e-106
QBA75162.1|2498792_2499626_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	9.6e-47
QBA75163.1|2499942_2500137_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75164.1|2500390_2500927_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75165.1|2501115_2502339_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75166.1|2502574_2503402_-	class C sortase	NA	NA	NA	NA	NA
QBA75167.1|2503408_2504968_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
QBA75168.1|2504964_2506287_-	pilus assembly protein	NA	NA	NA	NA	NA
QBA75169.1|2506288_2509294_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
QBA75170.1|2509571_2510129_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75171.1|2510223_2511420_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
QBA75172.1|2511628_2512684_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
QBA75173.1|2512934_2513564_+	XRE family transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
QBA75174.1|2513699_2514029_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
QBA75175.1|2514025_2514814_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75176.1|2514866_2515655_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75177.1|2515699_2515978_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
QBA75178.1|2516001_2516286_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
QBA75179.1|2516479_2516776_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
QBA75180.1|2516877_2518233_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
QBA75796.1|2518538_2518832_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75181.1|2518922_2519273_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75182.1|2519446_2520826_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
QBA75183.1|2522084_2523005_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA75184.1|2524549_2524687_-|bacteriocin	bacteriocin prepeptide or inducing factor for bacteriocin synthesis	bacteriocin	NA	NA	NA	NA
QBA75185.1|2524876_2526175_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
QBA75186.1|2526179_2526986_+	response regulator transcription factor	NA	NA	NA	NA	NA
QBA75187.1|2527347_2527545_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75188.1|2528091_2528331_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75189.1|2528590_2528773_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
QBA75190.1|2528802_2528976_-|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
QBA75191.1|2529297_2529522_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75192.1|2529553_2529724_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75193.1|2529942_2530212_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75194.1|2530322_2531180_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QBA75195.1|2531692_2532025_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75196.1|2532276_2532468_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75197.1|2532783_2533119_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
QBA75198.1|2533237_2533834_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
QBA75199.1|2533926_2534115_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75200.1|2534104_2534413_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75201.1|2534548_2534764_-|bacteriocin	class IIb bacteriocin	bacteriocin	NA	NA	NA	NA
QBA75797.1|2534760_2534994_-|bacteriocin	class IIb bacteriocin	bacteriocin	NA	NA	NA	NA
QBA75202.1|2535265_2536219_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.9	2.8e-10
QBA75203.1|2536423_2537158_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
QBA75204.1|2537183_2538347_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
QBA75205.1|2538608_2539985_-	class II fumarate hydratase	NA	NA	NA	NA	NA
QBA75206.1|2540117_2540876_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75207.1|2541040_2541184_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75208.1|2541167_2542775_-	divalent metal cation transporter	NA	NA	NA	NA	NA
QBA75209.1|2543162_2545880_+	HAD family hydrolase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	29.1	6.9e-62
QBA75210.1|2546179_2546545_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75211.1|2546698_2548072_-	MFS transporter	NA	NA	NA	NA	NA
QBA75212.1|2548111_2549641_-	copper oxidase	NA	NA	NA	NA	NA
QBA75213.1|2549642_2549822_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75214.1|2549886_2550078_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75215.1|2550206_2550845_+	cation transporter	NA	NA	NA	NA	NA
QBA75216.1|2550865_2551198_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
QBA75217.1|2551318_2552260_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBA75218.1|2552256_2553153_-	metal ABC transporter permease	NA	NA	NA	NA	NA
QBA75219.1|2553149_2553893_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.1e-12
QBA75220.1|2554168_2555635_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
QBA75221.1|2555835_2556105_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
QBA75222.1|2556193_2556313_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75223.1|2556513_2557431_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBA75224.1|2557670_2558312_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
QBA75225.1|2559217_2559742_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75226.1|2560004_2561762_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75227.1|2561755_2561914_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75228.1|2561912_2562815_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QBA75229.1|2562776_2563064_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75230.1|2563057_2563207_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75231.1|2563470_2563632_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75798.1|2563812_2563959_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
QBA75232.1|2565188_2566109_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 9
CP035563	Lactobacillus paracasei strain SRCM103299 chromosome, complete genome	3081420	2784202	2852457	3081420	transposase,holin	Burkholderia_virus(14.29%)	59	NA	NA
QBA75430.1|2784202_2784322_-|holin	holin	holin	NA	NA	NA	NA
QBA75431.1|2784542_2785280_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QBA75432.1|2785340_2786585_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
QBA75433.1|2786803_2787742_+	PTS mannose/fructose/sorbose transporter subunit IIAB	NA	NA	NA	NA	NA
QBA75434.1|2787837_2788644_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBA75435.1|2788618_2789443_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
QBA75436.1|2789618_2789936_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
QBA75437.1|2790019_2790334_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
QBA75438.1|2790326_2791757_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
QBA75439.1|2791831_2792707_-	ROK family protein	NA	NA	NA	NA	NA
QBA75440.1|2792703_2793999_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
QBA75441.1|2793995_2796635_-	alpha-mannosidase	NA	NA	NA	NA	NA
QBA75442.1|2796683_2798009_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBA75443.1|2798234_2798960_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QBA75444.1|2799391_2800120_-	sugar aldolase	NA	NA	NA	NA	NA
QBA75445.1|2800116_2800353_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75446.1|2800345_2801938_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
QBA75447.1|2801969_2802290_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
QBA75448.1|2802321_2802801_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
QBA75449.1|2803006_2803804_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
QBA75450.1|2804059_2804908_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QBA75451.1|2805208_2805463_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75452.1|2805414_2807097_+	alpha-glucosidase	NA	NA	NA	NA	NA
QBA75453.1|2807246_2807432_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75454.1|2807557_2808307_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75455.1|2809041_2809200_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
QBA75456.1|2811529_2812774_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	4.3e-11
QBA75457.1|2813353_2814337_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75458.1|2814406_2816332_-	alginate lyase family protein	NA	NA	NA	NA	NA
QBA75459.1|2816270_2816618_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
QBA75460.1|2816617_2817088_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
QBA75461.1|2817207_2818023_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
QBA75462.1|2818012_2818825_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QBA75463.1|2818977_2819478_-	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
QBA75464.1|2819577_2820756_-	glucuronyl hydrolase	NA	NA	NA	NA	NA
QBA75465.1|2820752_2821583_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75466.1|2821797_2822565_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
QBA75467.1|2822826_2823672_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
QBA75468.1|2823706_2824531_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	3.0e-16
QBA75469.1|2824641_2825295_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
QBA75470.1|2825299_2826319_+	sugar kinase	NA	NA	NA	NA	NA
QBA75471.1|2826421_2827066_-	6-O-methylguanine DNA methyltransferase	NA	NA	NA	NA	NA
QBA75472.1|2827134_2827824_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
QBA75473.1|2827981_2829946_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75474.1|2829957_2830899_-	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	38.9	1.0e-49
QBA75475.1|2830900_2831572_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
QBA75476.1|2832426_2833818_-	HAMP domain-containing histidine kinase	NA	Q6XLV6	Feldmannia_irregularis_virus	21.9	1.5e-07
QBA75477.1|2833833_2834535_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	3.5e-34
QBA75478.1|2834818_2836204_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
QBA75479.1|2836343_2837948_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
QBA75480.1|2840958_2841975_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	4.2e-36
QBA75481.1|2843700_2844621_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
QBA75482.1|2847190_2847562_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75483.1|2847567_2848188_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75484.1|2848230_2848743_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75485.1|2848898_2850386_+	transcriptional antiterminator	NA	NA	NA	NA	NA
QBA75810.1|2850531_2851272_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
QBA75486.1|2851355_2851841_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
QBA75487.1|2852337_2852457_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 1
CP035564	Lactobacillus paracasei strain SRCM103299 plasmid unnamed1	67627	29052	60245	67627	holin,transposase	Staphylococcus_phage(40.0%)	22	NA	NA
QBA75860.1|29052_29196_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
QBA75888.1|29396_30602_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	44.5	2.4e-91
QBA75861.1|31111_31330_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75862.1|31468_31918_-	nitroreductase	NA	NA	NA	NA	NA
QBA75863.1|31931_32222_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75864.1|32231_32678_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75889.1|32677_32884_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75865.1|33180_34074_+	endonuclease	NA	NA	NA	NA	NA
QBA75866.1|34079_34439_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75867.1|34446_35234_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
QBA75868.1|35301_35904_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	28.5	1.4e-10
QBA75869.1|35893_37516_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.1	3.7e-127
QBA75870.1|37529_40697_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.6	1.4e-21
QBA75890.1|40860_41223_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75871.1|42053_42335_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
QBA75872.1|42324_42681_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75873.1|42786_43707_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	3.4e-37
QBA75874.1|54182_54932_-	hypothetical protein	NA	NA	NA	NA	NA
QBA75875.1|56428_57216_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
QBA75876.1|57387_58662_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75877.1|58988_59078_+	hypothetical protein	NA	NA	NA	NA	NA
QBA75878.1|59457_60245_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
