The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	1157656	1167411	4810141	integrase	Enterobacteria_phage(83.33%)	11	1157222:1157239	1167427:1167444
1157222:1157239	attL	TAAACGTGTACCAATTAT	NA	NA	NA	NA
QAZ32584.1|1157656_1159990_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
QAZ32585.1|1160004_1160325_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ32586.1|1160321_1160549_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ32587.1|1160545_1161094_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	9.7e-32
QAZ32588.1|1161894_1162632_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	66.1	1.4e-81
QAZ32589.1|1162628_1162874_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	77.8	3.7e-31
QAZ32590.1|1162890_1163457_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	2.0e-56
QAZ32591.1|1163498_1163606_-	acetyl xylan esterase	NA	NA	NA	NA	NA
QAZ32592.1|1163734_1165348_+	calcineurin phosphoesterase	NA	NA	NA	NA	NA
QAZ32593.1|1165350_1166190_+	HAD family hydrolase	NA	NA	NA	NA	NA
QAZ32594.1|1166217_1167411_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	5.3e-107
1167427:1167444	attR	ATAATTGGTACACGTTTA	NA	NA	NA	NA
>prophage 2
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	1235064	1280987	4810141	holin,tail,integrase,head,lysis,protease	Salmonella_phage(51.92%)	59	1230815:1230829	1250210:1250224
1230815:1230829	attL	TATATTGATAAACCT	NA	NA	NA	NA
QAZ32642.1|1235064_1236294_+|integrase	integrase	integrase	H6WRW7	Salmonella_phage	94.1	6.4e-233
QAZ32643.1|1236271_1236556_-	excisionase	NA	H6WRW8	Salmonella_phage	87.2	1.1e-42
QAZ32644.1|1236596_1236836_-	DUF4060 domain-containing protein	NA	H6WRW9	Salmonella_phage	97.5	2.2e-36
QAZ36025.1|1236878_1238036_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.5	1.8e-216
QAZ32645.1|1237998_1240926_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	95.8	0.0e+00
QAZ32646.1|1241052_1241403_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	94.8	7.8e-59
QAZ32647.1|1241424_1241595_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	80.0	4.3e-15
QAZ32648.1|1241896_1242307_-	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
QAZ32649.1|1242426_1242666_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	44.0	3.2e-11
QAZ32650.1|1242631_1243006_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.2e-62
QAZ32651.1|1243090_1244074_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	98.4	5.8e-160
QAZ32652.1|1244076_1244826_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
QAZ32653.1|1244836_1245184_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	99.1	1.3e-58
QAZ32654.1|1245180_1245699_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	89.8	1.4e-40
QAZ32655.1|1245725_1246718_-	peptidase M85	NA	NA	NA	NA	NA
QAZ32656.1|1246987_1247221_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
QAZ32657.1|1247332_1247554_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ32658.1|1247636_1248239_+	hypothetical protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
QAZ32659.1|1248238_1248445_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	98.5	2.3e-34
QAZ32660.1|1248447_1249059_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	96.1	1.8e-90
QAZ32661.1|1249055_1249196_+	hypothetical protein	NA	A0A0M5M7B2	Salmonella_phage	70.7	6.1e-07
QAZ32662.1|1249192_1249720_+	endonuclease	NA	Q5DMP6	Escherichia_phage	42.0	1.2e-23
QAZ32663.1|1249716_1250394_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	1.9e-61
1250210:1250224	attR	AGGTTTATCAATATA	NA	NA	NA	NA
QAZ32664.1|1250390_1250576_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ32665.1|1250666_1251230_+	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
QAZ32666.1|1251736_1251925_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ32667.1|1252139_1252826_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	3.6e-132
QAZ36026.1|1253101_1253431_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
QAZ32668.1|1253414_1253867_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
QAZ32669.1|1253863_1254334_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	73.9	2.7e-54
QAZ32670.1|1254777_1255404_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	97.6	2.0e-105
QAZ32671.1|1255406_1257026_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	7.3e-261
QAZ32672.1|1257025_1258546_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	5.2e-107
QAZ32673.1|1258586_1259276_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	48.7	1.0e-57
QAZ32674.1|1259272_1260619_+	hypothetical protein	NA	A0A219YCD3	Aeromonas_phage	36.5	4.2e-68
QAZ32675.1|1260620_1261103_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	41.2	2.6e-20
QAZ32676.1|1261102_1262131_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
QAZ32677.1|1262134_1262482_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
QAZ32678.1|1262488_1262935_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	2.3e-15
QAZ32679.1|1262928_1263513_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.3	2.1e-16
QAZ32680.1|1263509_1263875_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
QAZ32681.1|1263859_1264405_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ32682.1|1264385_1265870_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	5.2e-96
QAZ32683.1|1265870_1266317_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
QAZ32684.1|1266316_1266721_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
QAZ32685.1|1266762_1266945_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
QAZ32686.1|1266928_1269100_+	transglycosylase	NA	A0A0M4REK7	Salmonella_phage	67.1	1.1e-49
QAZ32687.1|1269096_1269807_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.3	4.7e-26
QAZ32688.1|1269806_1270109_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
QAZ32689.1|1270105_1270975_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
QAZ32690.1|1270955_1271633_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	5.4e-32
QAZ32691.1|1271645_1272002_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
QAZ32692.1|1271998_1273240_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
QAZ32693.1|1273241_1273844_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
QAZ32694.1|1273833_1275285_+	short-chain dehydrogenase	NA	E5G6P0	Salmonella_phage	72.8	1.7e-46
QAZ32695.1|1275281_1276106_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	95.3	2.0e-153
QAZ32696.1|1276095_1276674_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.7e-95
QAZ32697.1|1276770_1276971_-	phage virulence factor	NA	NA	NA	NA	NA
QAZ32698.1|1277621_1280987_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	50.5	7.4e-311
>prophage 3
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	1743402	1752573	4810141	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
QAZ33108.1|1743402_1744350_+	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
QAZ33109.1|1744333_1745065_+	ABC transporter permease	NA	NA	NA	NA	NA
QAZ33110.1|1745045_1745153_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ33111.1|1745212_1745944_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
QAZ33112.1|1746166_1747852_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
QAZ33113.1|1747848_1748568_+	DNA-binding response regulator	NA	NA	NA	NA	NA
QAZ33114.1|1748614_1749082_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
QAZ33115.1|1749138_1749669_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
QAZ33116.1|1749840_1750299_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
QAZ33117.1|1750539_1752573_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	1827071	1837578	4810141		Enterobacteria_phage(37.5%)	10	NA	NA
QAZ33177.1|1827071_1828475_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
QAZ33178.1|1828652_1829546_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
QAZ33179.1|1829922_1831008_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
QAZ33180.1|1831007_1831907_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
QAZ36042.1|1831954_1832833_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
QAZ33181.1|1832833_1833385_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
QAZ33182.1|1833390_1834365_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
QAZ33183.1|1834380_1835154_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
QAZ33184.1|1835158_1836238_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
QAZ33185.1|1836264_1837578_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	1930727	1941393	4810141		Morganella_phage(25.0%)	12	NA	NA
QAZ33275.1|1930727_1931252_-	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
QAZ33276.1|1931899_1932190_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	50.9	2.3e-08
QAZ33277.1|1932561_1933359_-	protein MtfA	NA	NA	NA	NA	NA
QAZ33278.1|1933839_1934001_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33279.1|1934127_1934547_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
QAZ33280.1|1934549_1935818_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.7	1.3e-225
QAZ33281.1|1936272_1936485_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	5.1e-21
QAZ36048.1|1936495_1936684_+	cold-shock protein	NA	NA	NA	NA	NA
QAZ33282.1|1936941_1938153_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.0	1.3e-108
QAZ33283.1|1938802_1939102_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33284.1|1939193_1939889_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.1e-07
QAZ33285.1|1939962_1941393_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	2046051	2054649	4810141	integrase	Salmonella_phage(28.57%)	13	2040496:2040510	2050759:2050773
2040496:2040510	attL	AATGACGTGTGAACG	NA	NA	NA	NA
QAZ33393.1|2046051_2046282_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
QAZ33394.1|2046419_2046794_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
QAZ33395.1|2046794_2047670_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33396.1|2047686_2048040_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
QAZ36054.1|2048097_2048217_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ36053.1|2048403_2049258_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
QAZ36055.1|2049317_2049812_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
QAZ33397.1|2050001_2050232_+	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
QAZ33398.1|2050285_2050819_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
2050759:2050773	attR	AATGACGTGTGAACG	NA	NA	NA	NA
QAZ33399.1|2051075_2051243_-	lytic enzyme	NA	NA	NA	NA	NA
QAZ33400.1|2051307_2051496_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ33401.1|2051550_2052042_+	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	57.5	5.8e-44
QAZ33402.1|2052594_2054649_+	shikimate transporter	NA	E5G6P0	Salmonella_phage	47.5	1.3e-73
>prophage 7
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	2400074	2416270	4810141	plate,tail,terminase,integrase	Salmonella_phage(37.5%)	22	2398888:2398902	2414676:2414690
2398888:2398902	attL	AGCTGGAGCATTACA	NA	NA	NA	NA
QAZ33728.1|2400074_2400953_+|integrase	integrase	integrase	NA	NA	NA	NA
QAZ33729.1|2400956_2401214_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33730.1|2402294_2403248_+	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	26.1	1.0e-07
QAZ33731.1|2403244_2403955_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
QAZ33732.1|2403964_2404342_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33733.1|2404338_2404557_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33734.1|2404556_2404904_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33735.1|2404890_2406300_+|plate	baseplate protein	plate	A0A2D0YGH8	Vibrio_phage	24.1	5.1e-16
QAZ33736.1|2406299_2407055_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33737.1|2407047_2407278_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
QAZ36072.1|2407277_2407514_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33738.1|2407513_2408146_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33739.1|2408230_2408500_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	62.5	4.6e-27
QAZ33740.1|2408512_2409112_-|tail	phage tail protein	tail	Q8HAB3	Salmonella_phage	94.7	1.4e-100
QAZ33741.1|2409081_2410566_-|tail	phage tail protein	tail	A0A192Y7M1	Salmonella_phage	84.5	4.1e-210
QAZ33742.1|2410678_2411194_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	45.9	4.4e-34
QAZ33743.1|2411211_2412744_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ33744.1|2413047_2413446_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ33745.1|2413505_2413847_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
QAZ33746.1|2413843_2414098_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	42.9	4.2e-14
QAZ33747.1|2414406_2414955_+	hypothetical protein	NA	NA	NA	NA	NA
2414676:2414690	attR	TGTAATGCTCCAGCT	NA	NA	NA	NA
QAZ33748.1|2414911_2416270_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	35.1	1.9e-68
>prophage 8
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	2737356	2788750	4810141	tail,integrase,head,capsid,terminase,tRNA,transposase,portal,lysis	Enterobacteria_phage(37.21%)	67	2770182:2770196	2795219:2795233
QAZ34079.1|2737356_2737473_+|tail	phage tail protein	tail	NA	NA	NA	NA
QAZ34080.1|2737663_2737864_+	phage virulence factor	NA	NA	NA	NA	NA
QAZ34081.1|2737961_2738546_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
QAZ34082.1|2738545_2740987_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.0	7.3e-87
QAZ34083.1|2741040_2741283_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34084.1|2741321_2744684_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.0	0.0e+00
QAZ34085.1|2744745_2745393_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
QAZ34086.1|2745290_2746028_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
QAZ34087.1|2746034_2746733_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	7.9e-103
QAZ34088.1|2746742_2747072_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
QAZ34089.1|2747074_2750170_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.4e-276
QAZ34090.1|2750141_2750480_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
QAZ34091.1|2750476_2750872_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
QAZ34092.1|2750922_2751669_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
QAZ34093.1|2751676_2752078_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
QAZ34094.1|2752066_2753317_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	99.2	1.6e-215
QAZ34095.1|2753365_2753944_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
QAZ34096.1|2753971_2754355_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
QAZ34097.1|2754365_2754731_-	DNA packaging protein	NA	NA	NA	NA	NA
QAZ34098.1|2754788_2755817_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
QAZ34099.1|2755871_2756219_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
QAZ34100.1|2756231_2757728_-	scaffolding protein	NA	A0A0K2FI53	Enterobacteria_phage	52.7	4.3e-98
QAZ34101.1|2757717_2759298_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
QAZ34102.1|2759294_2759498_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	72.3	9.5e-17
QAZ34103.1|2759481_2761413_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	65.6	1.2e-257
QAZ34104.1|2761384_2761930_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
QAZ34105.1|2761974_2762181_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34106.1|2762215_2762617_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
QAZ36090.1|2762843_2763299_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.8	8.0e-56
QAZ34107.1|2763616_2764156_-	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	5.7e-77
QAZ36091.1|2764133_2764436_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
QAZ36092.1|2764685_2765153_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
QAZ34108.1|2765164_2765383_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34109.1|2765536_2765725_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34110.1|2765859_2766048_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ34111.1|2765967_2766528_-	hypothetical protein	NA	A0A2R2Z302	Escherichia_phage	71.1	1.1e-41
QAZ34112.1|2766609_2766798_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34113.1|2766794_2767349_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
QAZ34114.1|2767345_2767642_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
QAZ34115.1|2767623_2767818_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
QAZ34116.1|2767814_2768414_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	82.9	3.3e-97
QAZ34117.1|2768477_2768783_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34118.1|2769205_2769397_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ34119.1|2769414_2771394_-	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
2770182:2770196	attL	TTGCCAGGCTATCCG	NA	NA	NA	NA
QAZ34120.1|2771790_2772921_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
QAZ34121.1|2773207_2773603_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
QAZ34122.1|2773616_2774078_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
QAZ34123.1|2774070_2775078_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	7.6e-123
QAZ34124.1|2775124_2775619_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34125.1|2775605_2775860_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
QAZ34126.1|2775956_2776382_+	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
QAZ36093.1|2776836_2777151_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34127.1|2777412_2777688_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ34128.1|2777691_2777898_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	47.1	1.3e-10
QAZ34129.1|2777973_2778309_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ34130.1|2778449_2781140_+	exonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.3	1.4e-115
QAZ34131.1|2781132_2781963_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
QAZ34132.1|2782026_2782347_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
QAZ34133.1|2782339_2782672_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	63.6	4.9e-10
QAZ34134.1|2782668_2783172_+	Eaa protein	NA	A0A075B8H2	Enterobacteria_phage	91.0	6.6e-35
QAZ34135.1|2783221_2783458_+	excisionase	NA	NA	NA	NA	NA
QAZ34136.1|2783447_2784590_+|integrase	integrase	integrase	O21929	Phage_21	80.0	1.8e-173
QAZ34137.1|2784703_2785954_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
QAZ34138.1|2786125_2786791_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
QAZ34139.1|2786787_2787117_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
QAZ34140.1|2787128_2787590_+	NUDIX hydrolase	NA	NA	NA	NA	NA
QAZ34141.1|2787643_2788750_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2795219:2795233	attR	TTGCCAGGCTATCCG	NA	NA	NA	NA
>prophage 9
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	3037279	3044592	4810141	integrase,protease	Ralstonia_phage(16.67%)	8	3032148:3032162	3043328:3043342
3032148:3032162	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
QAZ34373.1|3037279_3037657_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
QAZ34374.1|3037818_3038016_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ34375.1|3038228_3040505_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
QAZ34376.1|3040535_3040856_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
QAZ34377.1|3041179_3041401_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
QAZ34378.1|3041355_3041550_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34379.1|3041530_3043477_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
3043328:3043342	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
QAZ34380.1|3043473_3044592_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 10
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	3407429	3446918	4810141	tail,coat,integrase,terminase,portal,lysis	Salmonella_phage(50.0%)	66	3407121:3407166	3446933:3446978
3407121:3407166	attL	ATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
QAZ34707.1|3407429_3409283_-|tail	phage tail protein	tail	I6S5Y0	Salmonella_phage	57.8	9.8e-185
QAZ34708.1|3409320_3409551_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34709.1|3409567_3411478_-	DNA transfer protein	NA	I1TEJ6	Salmonella_phage	90.5	0.0e+00
QAZ36120.1|3411477_3412794_-	DNA transfer protein	NA	B9UDL0	Salmonella_phage	97.0	1.8e-233
QAZ34710.1|3412836_3413526_-	DNA transfer protein	NA	B9UDK9	Salmonella_phage	91.3	8.9e-91
QAZ34711.1|3413528_3413984_-	hypothetical protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
QAZ34712.1|3413983_3414685_-|tail	phage tail protein	tail	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
QAZ34713.1|3414688_3416107_-	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	97.9	1.1e-273
QAZ34714.1|3416066_3416567_-	hypothetical protein	NA	Q76H19	Enterobacteria_phage	98.8	5.5e-90
QAZ34715.1|3416550_3416760_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
QAZ34716.1|3416798_3418091_-|coat	coat protein	coat	I1TEI8	Salmonella_phage	99.8	9.4e-243
QAZ34717.1|3418090_3419002_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	98.7	2.7e-159
QAZ34718.1|3419013_3421191_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.4	0.0e+00
QAZ34719.1|3421190_3422690_-|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
QAZ34720.1|3422667_3423156_-	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
QAZ34721.1|3423159_3423564_-	Decoration protein	NA	C6ZR73	Salmonella_phage	98.5	1.5e-66
QAZ34722.1|3423563_3423953_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	97.7	2.8e-73
QAZ34723.1|3423956_3424199_-	hypothetical protein	NA	A0A192Y6S9	Salmonella_phage	100.0	3.0e-33
QAZ34724.1|3424421_3424952_-	hypothetical protein	NA	A0A2H4FQV0	Salmonella_phage	96.0	1.5e-90
QAZ34725.1|3425164_3425632_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	89.7	1.7e-69
QAZ36121.1|3425720_3426218_-	lysozyme	NA	I6R0P2	Salmonella_phage	98.2	4.2e-90
QAZ34726.1|3426195_3426399_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	98.5	1.5e-33
QAZ34727.1|3427074_3427698_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	2.0e-113
QAZ34728.1|3427694_3427883_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
QAZ34729.1|3427879_3428242_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
QAZ34730.1|3428238_3428529_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	99.0	7.6e-52
QAZ34731.1|3428521_3428914_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	36.1	1.3e-14
QAZ34732.1|3428903_3429083_-	protein ninF	NA	G9L691	Escherichia_phage	94.7	1.4e-24
QAZ34733.1|3429075_3429477_-	hypothetical protein	NA	G9L690	Escherichia_phage	82.0	3.3e-61
QAZ34734.1|3429479_3429656_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	98.3	1.8e-27
QAZ34735.1|3429622_3429796_-	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
QAZ34736.1|3429792_3430239_-	recombination protein NinB	NA	A0A1R3Y605	Salmonella_virus	98.6	7.8e-80
QAZ34737.1|3430195_3430384_-	hypothetical protein	NA	A0A1R3Y6Z7	Salmonella_virus	93.5	1.5e-24
QAZ34738.1|3430386_3430629_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34739.1|3430640_3430841_-	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
QAZ34740.1|3430837_3431164_-	hypothetical protein	NA	Q716D0	Shigella_phage	99.1	7.2e-59
QAZ34741.1|3431239_3432691_-	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	99.8	1.7e-277
QAZ34742.1|3432665_3433565_-	DNA replication protein	NA	A0A220NQX5	Salmonella_phage	99.3	1.5e-154
QAZ34743.1|3433557_3433704_-	hypothetical protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
QAZ34744.1|3433738_3434020_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
QAZ34745.1|3434130_3434346_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
QAZ34746.1|3434456_3435146_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
QAZ34747.1|3435234_3436158_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	99.7	4.3e-181
QAZ34748.1|3436193_3436397_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	97.0	2.3e-26
QAZ34749.1|3436775_3437108_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	95.5	1.1e-51
QAZ34750.1|3437186_3437381_+	restriction endonuclease	NA	A0A2H4FS18	Salmonella_phage	100.0	2.5e-30
QAZ36122.1|3437464_3438607_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	69.6	1.4e-64
QAZ34751.1|3438758_3439073_+	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	100.0	1.9e-56
QAZ34752.1|3438972_3439191_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ34753.1|3439275_3439428_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
QAZ34754.1|3439512_3439821_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	98.0	4.3e-53
QAZ34755.1|3439817_3440720_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	87.1	4.8e-145
QAZ34756.1|3440703_3441186_+	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	95.6	1.9e-76
QAZ34757.1|3441197_3441512_+	hypothetical protein	NA	A0A0M4R304	Salmonella_phage	94.2	8.0e-47
QAZ34758.1|3441528_3441693_+	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	98.1	2.5e-23
QAZ34759.1|3441689_3442163_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	90.1	3.9e-61
QAZ34760.1|3442159_3442390_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	92.1	3.4e-31
QAZ34761.1|3442386_3442632_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	92.4	1.0e-33
QAZ34762.1|3442628_3443156_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	70.6	3.1e-43
QAZ34763.1|3443155_3443335_+	hypothetical protein	NA	A0A2H4FQT4	Salmonella_phage	98.3	8.9e-27
QAZ34764.1|3443334_3443559_+	hypothetical protein	NA	A0A220NQV0	Salmonella_phage	89.3	3.6e-33
QAZ34765.1|3443567_3444008_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	76.6	4.4e-19
QAZ34766.1|3444004_3445102_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	61.7	9.5e-111
QAZ34767.1|3445174_3445525_+	hypothetical protein	NA	A0A192Y649	Salmonella_phage	95.7	2.3e-58
QAZ34768.1|3445527_3445899_+	DNA-binding protein	NA	B9UDM0	Salmonella_phage	96.7	1.0e-61
QAZ34769.1|3445754_3446918_+|integrase	integrase	integrase	B9UDL9	Salmonella_phage	97.2	4.4e-223
3446933:3446978	attR	ATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 11
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	4174771	4185447	4810141	integrase	Enterobacteria_phage(55.56%)	13	4180343:4180359	4189011:4189027
QAZ35414.1|4174771_4177105_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
QAZ35415.1|4177119_4177440_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ35416.1|4177436_4177664_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ35417.1|4177660_4178212_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
QAZ35418.1|4179014_4179752_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	64.0	4.4e-80
QAZ35419.1|4179748_4179994_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
QAZ35420.1|4180010_4180577_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	5.9e-56
4180343:4180359	attL	GCCCGCGATGATAAAAA	NA	NA	NA	NA
QAZ35421.1|4180540_4180726_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ35422.1|4180796_4181360_-	restriction endonuclease	NA	A0A1B0UXL9	Roseobacter_phage	42.9	4.2e-30
QAZ35423.1|4181356_4181593_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAZ35424.1|4181648_4182644_+	site-specific DNA-methyltransferase	NA	S0A236	Cellulophaga_phage	24.2	7.7e-19
QAZ35425.1|4182697_4183957_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.2	4.8e-74
QAZ35426.1|4184427_4185447_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	7.9e-43
4189011:4189027	attR	TTTTTATCATCGCGGGC	NA	NA	NA	NA
>prophage 12
CP025246	Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 chromosome, complete genome	4810141	4429770	4474545	4810141	plate,tail,tRNA	Burkholderia_phage(36.36%)	47	NA	NA
QAZ35641.1|4429770_4430769_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
QAZ35642.1|4430856_4432167_-	conjugal transfer protein	NA	NA	NA	NA	NA
QAZ35643.1|4432413_4432929_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
QAZ35644.1|4433028_4433238_-	CsbD family protein	NA	NA	NA	NA	NA
QAZ36159.1|4433259_4433373_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ35645.1|4433369_4434695_-	MATE family efflux transporter	NA	NA	NA	NA	NA
QAZ35646.1|4434873_4435482_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
QAZ35647.1|4435590_4435959_-	diacylglycerol kinase	NA	NA	NA	NA	NA
QAZ35648.1|4436129_4438550_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
QAZ35649.1|4438648_4439521_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
QAZ35650.1|4439534_4440032_-	chorismate lyase	NA	NA	NA	NA	NA
QAZ35651.1|4440212_4441130_-	maltose operon protein MalM	NA	NA	NA	NA	NA
QAZ35652.1|4441293_4442652_-	maltoporin	NA	NA	NA	NA	NA
QAZ35653.1|4442740_4443850_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
QAZ35654.1|4444210_4445401_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
QAZ35655.1|4445532_4447077_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
QAZ35656.1|4447091_4447982_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
QAZ35657.1|4448147_4448558_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
QAZ35658.1|4448700_4450797_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
QAZ35659.1|4450796_4451534_-	hypothetical protein	NA	NA	NA	NA	NA
QAZ35660.1|4451530_4452169_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
QAZ35661.1|4452232_4452475_-	outer membrane protein	NA	NA	NA	NA	NA
QAZ35662.1|4452918_4454568_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
QAZ35663.1|4454912_4456262_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
QAZ35664.1|4456392_4456740_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
QAZ35665.1|4457316_4457604_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
QAZ35666.1|4457606_4458212_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	9.3e-60
QAZ35667.1|4458224_4458539_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
QAZ35668.1|4458698_4459154_+	hypothetical protein	NA	NA	NA	NA	NA
QAZ35669.1|4459150_4459348_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
QAZ35670.1|4459337_4460765_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
QAZ35671.1|4460764_4461289_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
QAZ35672.1|4461340_4461658_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
QAZ35673.1|4461617_4461746_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
QAZ35674.1|4461842_4464194_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.3	3.4e-65
QAZ35675.1|4464193_4465147_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
QAZ35676.1|4465146_4465356_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
QAZ35677.1|4465343_4466387_+	phage protein D	NA	A4JWL3	Burkholderia_virus	45.9	3.8e-77
QAZ35678.1|4466396_4467119_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
QAZ35679.1|4467446_4467809_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
QAZ35680.1|4467805_4468735_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
QAZ35681.1|4468734_4470282_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.5e-48
QAZ35682.1|4470445_4470805_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
QAZ35683.1|4470795_4471911_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
QAZ35684.1|4471903_4472536_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
QAZ35685.1|4472538_4474020_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
QAZ35686.1|4474029_4474545_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
