The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	647492	684133	4733807	tRNA,capsid,portal,tail,terminase,head,holin,integrase	Cronobacter_phage(71.05%)	46	637361:637382	686442:686463
637361:637382	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
QAX34883.1|647492_648530_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
QAX34884.1|648516_649431_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34885.1|649438_650017_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
QAX34886.1|650136_650358_+	regulator	NA	NA	NA	NA	NA
QAX34887.1|650388_650892_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
QAX34888.1|650901_651129_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34889.1|651118_651544_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
QAX34890.1|651543_651945_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
QAX38649.1|652091_652268_+	DUF2732 family protein	NA	NA	NA	NA	NA
QAX34891.1|652258_652855_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
QAX34892.1|652851_653181_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
QAX34893.1|653170_654031_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
QAX34894.1|654027_656049_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
QAX34895.1|656168_656375_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34896.1|656348_656672_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
QAX34897.1|656668_657730_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
QAX34898.1|657726_659502_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
QAX34899.1|659662_660463_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
QAX34900.1|660524_661547_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
QAX34901.1|661550_662255_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
QAX34902.1|662258_662453_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
QAX34903.1|662498_663002_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	3.4e-63
QAX34904.1|662998_663505_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
QAX34905.1|663501_664209_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
QAX34906.1|664205_665333_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
QAX34907.1|665329_665785_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
QAX34908.1|665794_666088_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
QAX34909.1|666084_666426_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
QAX34910.1|666425_666758_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
QAX34911.1|666729_666918_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	79.0	1.5e-21
QAX34912.1|666895_667162_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.7e-21
QAX34913.1|667349_669320_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
QAX34914.1|669316_669646_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
QAX34915.1|669642_670827_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
QAX34916.1|670813_671407_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.4e-89
QAX34917.1|671416_673429_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
QAX34918.1|673431_673962_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
QAX34919.1|673951_674677_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
QAX34920.1|674648_675194_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
QAX34921.1|675193_676897_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
QAX34922.1|677054_677276_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34923.1|678068_678575_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
QAX38650.1|678698_680546_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
QAX34924.1|680695_682441_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
QAX34925.1|682676_682892_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
QAX34926.1|683119_684133_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
686442:686463	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	1180752	1242503	4733807	tRNA,capsid,portal,tail,terminase,head,holin,integrase	Cronobacter_phage(57.89%)	62	1188729:1188744	1216419:1216434
QAX35382.1|1180752_1181520_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
QAX35383.1|1181560_1181908_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
QAX35384.1|1182063_1183284_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
QAX35385.1|1183276_1183795_-	YfiR family protein	NA	NA	NA	NA	NA
QAX35386.1|1184234_1185305_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
QAX35387.1|1185314_1186436_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
QAX35388.1|1186493_1187402_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
QAX35389.1|1187362_1188523_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
QAX38669.1|1188622_1188670_-	hypothetical protein	NA	NA	NA	NA	NA
1188729:1188744	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
QAX35390.1|1188833_1189853_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.3e-109
QAX35391.1|1189892_1190192_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
QAX35392.1|1190300_1190639_+	hypothetical protein	NA	NA	NA	NA	NA
QAX35393.1|1190664_1190997_+	hypothetical protein	NA	NA	NA	NA	NA
QAX35394.1|1191006_1191576_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
QAX35395.1|1191578_1191797_+	hypothetical protein	NA	NA	NA	NA	NA
QAX35396.1|1191835_1194493_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
QAX35397.1|1194520_1194844_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
QAX35398.1|1194843_1195863_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
QAX35399.1|1195859_1197644_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
QAX35400.1|1197701_1198691_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
QAX35401.1|1198725_1199754_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
QAX35402.1|1199765_1200464_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
QAX35403.1|1200562_1201015_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
QAX35404.1|1201011_1201494_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
QAX35405.1|1201490_1202195_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
QAX35406.1|1202191_1203319_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
QAX35407.1|1203315_1203771_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
QAX35408.1|1203783_1204080_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
QAX35409.1|1204076_1204418_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
QAX35410.1|1204417_1204750_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
QAX35411.1|1204676_1204910_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
QAX35412.1|1204887_1205154_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.4e-20
QAX35413.1|1205341_1207309_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
QAX35414.1|1207305_1207635_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
QAX35415.1|1207631_1208816_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
QAX35416.1|1208802_1209396_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.4e-89
QAX35417.1|1209405_1211418_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
QAX35418.1|1211420_1211951_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
QAX35419.1|1211940_1212666_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
QAX35420.1|1212637_1213183_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
QAX35421.1|1213182_1214886_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.9e-223
QAX35422.1|1214784_1215138_-	hypothetical protein	NA	NA	NA	NA	NA
QAX35423.1|1215919_1216306_-	hypothetical protein	NA	NA	NA	NA	NA
QAX35424.1|1216463_1216802_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1216419:1216434	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
QAX35425.1|1217073_1217811_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
QAX35426.1|1217942_1218923_+	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
QAX35427.1|1218919_1219651_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
QAX35428.1|1219780_1222354_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
QAX35429.1|1228303_1228759_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
QAX35430.1|1228862_1230164_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
QAX35431.1|1230160_1230484_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
QAX35432.1|1230528_1231884_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
QAX35433.1|1231998_1234659_-	protein lysine acetyltransferase Pat	NA	NA	NA	NA	NA
QAX35434.1|1234712_1235393_-	DTW domain-containing protein	NA	NA	NA	NA	NA
QAX35435.1|1235465_1235885_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
QAX35436.1|1236088_1237126_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
QAX35437.1|1237241_1237931_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
QAX35438.1|1238249_1238633_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
QAX35439.1|1238694_1239282_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
QAX38670.1|1239384_1240284_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QAX35440.1|1240301_1241636_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
QAX35441.1|1241765_1242503_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	1473793	1480641	4733807	transposase	Salmonella_virus(42.86%)	7	NA	NA
QAX35633.1|1473793_1473940_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
QAX35634.1|1473955_1474099_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
QAX35635.1|1475088_1477011_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
QAX35636.1|1477017_1477284_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
QAX38678.1|1477252_1477642_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
QAX35637.1|1477740_1478445_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX35638.1|1479699_1480641_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 4
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	1712223	1721394	4733807	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
QAX35852.1|1712223_1713171_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
QAX35853.1|1713154_1713886_+	ABC transporter permease	NA	NA	NA	NA	NA
QAX35854.1|1713866_1713974_-	protein YohO	NA	NA	NA	NA	NA
QAX35855.1|1714033_1714765_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
QAX35856.1|1714987_1716673_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
QAX35857.1|1716669_1717389_+	DNA-binding response regulator	NA	NA	NA	NA	NA
QAX35858.1|1717435_1717903_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
QAX35859.1|1717959_1718490_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
QAX35860.1|1718661_1719120_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
QAX35861.1|1719360_1721394_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	1800426	1810933	4733807		Enterobacteria_phage(37.5%)	10	NA	NA
QAX35926.1|1800426_1801830_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
QAX35927.1|1802007_1802901_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
QAX35928.1|1803277_1804363_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
QAX35929.1|1804362_1805262_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
QAX38690.1|1805309_1806188_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
QAX35930.1|1806188_1806740_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
QAX35931.1|1806745_1807720_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
QAX35932.1|1807735_1808509_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
QAX35933.1|1808513_1809593_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
QAX35934.1|1809619_1810933_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	1921055	1932345	4733807	integrase	Burkholderia_phage(25.0%)	13	1915309:1915324	1929656:1929671
1915309:1915324	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
QAX36048.1|1921055_1922237_+	recombinase RecF	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
QAX36049.1|1922237_1922984_+	HNH endonuclease	NA	NA	NA	NA	NA
QAX36050.1|1923085_1924342_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
QAX36051.1|1924602_1924881_+	hypothetical protein	NA	NA	NA	NA	NA
QAX36052.1|1924822_1924984_+	hypothetical protein	NA	NA	NA	NA	NA
QAX36053.1|1925110_1925530_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
QAX36054.1|1925532_1926801_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
QAX36055.1|1927255_1927468_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
QAX38694.1|1927478_1927667_+	cold-shock protein	NA	NA	NA	NA	NA
QAX36056.1|1927925_1929104_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
QAX36057.1|1929754_1930066_+	hypothetical protein	NA	NA	NA	NA	NA
1929656:1929671	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
QAX36058.1|1930145_1930841_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
QAX36059.1|1930914_1932345_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	2113096	2152415	4733807	transposase,protease,integrase	Shigella_phage(28.57%)	31	2129533:2129549	2144120:2144136
QAX36248.1|2113096_2113693_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
QAX36249.1|2113689_2114421_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
QAX36250.1|2114439_2116233_-	hydrogenase 1 large subunit	NA	NA	NA	NA	NA
QAX36251.1|2116229_2117348_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
QAX36252.1|2117841_2119107_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
QAX36253.1|2121624_2122897_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
QAX36254.1|2124335_2126846_+	hypothetical protein	NA	NA	NA	NA	NA
QAX36255.1|2126849_2129414_+	hypothetical protein	NA	NA	NA	NA	NA
2129533:2129549	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
QAX36256.1|2129720_2130035_-	hypothetical protein	NA	NA	NA	NA	NA
QAX36257.1|2130046_2130565_-	hypothetical protein	NA	NA	NA	NA	NA
QAX36258.1|2130618_2131146_-	hypothetical protein	NA	NA	NA	NA	NA
QAX36259.1|2131158_2131428_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
QAX36260.1|2131548_2131929_+	hypothetical protein	NA	NA	NA	NA	NA
QAX36261.1|2132086_2132629_+	hypothetical protein	NA	NA	NA	NA	NA
QAX36262.1|2132651_2133140_+	DNA repair protein RadC	NA	NA	NA	NA	NA
QAX36263.1|2133231_2133663_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
QAX36264.1|2133723_2134083_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
QAX36265.1|2134192_2134810_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
QAX36266.1|2134886_2135834_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.2e-10
QAX36267.1|2136047_2136494_-	hypothetical protein	NA	NA	NA	NA	NA
QAX36268.1|2136758_2136953_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
QAX36269.1|2136954_2137827_+	hypothetical protein	NA	NA	NA	NA	NA
QAX36270.1|2138036_2139310_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.4e-176
QAX36271.1|2139521_2143424_+	hypothetical protein	NA	NA	NA	NA	NA
QAX36272.1|2143745_2145431_-	hypothetical protein	NA	NA	NA	NA	NA
2144120:2144136	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
QAX36273.1|2145440_2146106_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
QAX36274.1|2146106_2147504_-	helicase	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
QAX36275.1|2149418_2150201_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	1.4e-137
QAX36276.1|2150413_2150518_-	cell filamentation protein	NA	NA	NA	NA	NA
QAX36277.1|2151100_2152252_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
QAX36278.1|2152208_2152415_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	2246584	2252396	4733807		Escherichia_phage(33.33%)	8	NA	NA
QAX36364.1|2246584_2247391_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
QAX36365.1|2247392_2248385_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
QAX36366.1|2248384_2249275_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
QAX38709.1|2249398_2249800_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
QAX36367.1|2250099_2250987_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
QAX38710.1|2251293_2251563_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
QAX36368.1|2251917_2252058_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
QAX36369.1|2252096_2252396_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 9
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	2290343	2298947	4733807	tRNA,transposase	Escherichia_phage(33.33%)	9	NA	NA
QAX36410.1|2290343_2291717_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.8e-51
QAX36411.1|2291760_2292696_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	9.4e-144
QAX36412.1|2292790_2292928_-	hypothetical protein	NA	A0A0U2JGI6	Escherichia_phage	97.8	8.0e-20
QAX36413.1|2293371_2296794_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	50.6	0.0e+00
QAX36414.1|2297067_2297406_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
QAX36415.1|2297458_2297893_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
QAX36416.1|2298106_2298316_+	hypothetical protein	NA	NA	NA	NA	NA
QAX36417.1|2298349_2298532_+	hypothetical protein	NA	NA	NA	NA	NA
QAX36418.1|2298488_2298947_+|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 10
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	2708122	2715585	4733807	transposase	Escherichia_phage(42.86%)	8	NA	NA
QAX36814.1|2708122_2708362_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
QAX38729.1|2709235_2710045_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
QAX36815.1|2710117_2710495_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
QAX36816.1|2710642_2711185_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
QAX36817.1|2711376_2712105_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
QAX36818.1|2712121_2712535_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
QAX36819.1|2713485_2714610_-	DUF3626 domain-containing protein	NA	NA	NA	NA	NA
QAX36820.1|2715126_2715585_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 11
CP033356	Salmonella enterica subsp. enterica strain CFSA664 chromosome, complete genome	4733807	3543140	3586649	4733807	plate,terminase,lysis,integrase	Escherichia_phage(40.82%)	62	3539674:3539719	3582758:3582803
3539674:3539719	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
QAX37580.1|3543140_3544559_-|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	34.9	1.3e-59
QAX37581.1|3544555_3544888_-	hypothetical protein	NA	NA	NA	NA	NA
QAX37582.1|3544884_3545601_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	30.9	9.8e-24
QAX37583.1|3545597_3546617_-	hypothetical protein	NA	NA	NA	NA	NA
QAX37584.1|3546616_3546892_-	hypothetical protein	NA	NA	NA	NA	NA
QAX37585.1|3546888_3547605_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	37.1	6.5e-28
QAX37586.1|3547604_3549425_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	39.7	3.4e-20
QAX37587.1|3549548_3550127_-	hypothetical protein	NA	NA	NA	NA	NA
QAX37588.1|3550129_3550567_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	36.8	1.9e-22
QAX37589.1|3550570_3551965_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.4	9.7e-68
QAX37590.1|3551969_3552911_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.6	1.7e-52
QAX37591.1|3552894_3553329_-	hypothetical protein	NA	NA	NA	NA	NA
QAX37592.1|3553325_3553754_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	40.6	4.2e-22
QAX37593.1|3553750_3554233_-	hypothetical protein	NA	NA	NA	NA	NA
QAX37594.1|3554301_3555333_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.4	2.3e-74
QAX37595.1|3555349_3556210_-	hypothetical protein	NA	NA	NA	NA	NA
QAX37596.1|3556225_3557842_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
QAX37597.1|3557860_3558676_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.6	1.5e-52
QAX37598.1|3558672_3560094_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.5	1.2e-89
QAX37599.1|3560105_3561437_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.5	1.2e-152
QAX37600.1|3561438_3562482_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	50.6	7.5e-65
QAX37601.1|3562547_3563066_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	95.9	1.1e-90
QAX37602.1|3563088_3563295_+	hypothetical protein	NA	H6WRZ7	Salmonella_phage	93.5	4.8e-16
QAX37603.1|3563272_3563731_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	83.6	7.5e-62
QAX37604.1|3563727_3564216_-	lysozyme	NA	A0A2H4FND7	Salmonella_phage	87.0	5.5e-79
QAX37605.1|3564215_3564488_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	95.6	2.2e-40
QAX37606.1|3564950_3565640_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.7	8.7e-54
QAX37607.1|3565636_3565777_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	74.2	8.8e-06
QAX37608.1|3565773_3566385_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	73.9	1.3e-61
QAX37609.1|3566377_3566548_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	92.5	2.0e-20
QAX37610.1|3566547_3567003_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
QAX37611.1|3567371_3567809_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	41.1	2.8e-13
QAX37612.1|3567810_3568428_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	86.5	1.1e-68
QAX37613.1|3568427_3568628_-	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	98.5	3.7e-29
QAX37614.1|3568620_3569010_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	98.8	7.9e-36
QAX37615.1|3569006_3569204_-	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	100.0	2.6e-27
QAX37616.1|3569200_3569545_-	transcriptional regulator	NA	G8C7U7	Escherichia_phage	95.6	2.3e-55
QAX37617.1|3569544_3570978_-	helicase DnaB	NA	Q716D2	Shigella_phage	87.6	7.5e-233
QAX37618.1|3570967_3571867_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	55.7	1.9e-80
QAX37619.1|3572095_3572662_-	hypothetical protein	NA	NA	NA	NA	NA
QAX37620.1|3572679_3572913_-	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
QAX37621.1|3572954_3573707_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	64.4	5.4e-73
QAX37622.1|3574062_3574404_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	96.5	3.9e-55
QAX37623.1|3574674_3575106_+	hypothetical protein	NA	A0A0A0P241	Enterobacteria_phage	41.0	7.4e-11
QAX37624.1|3575267_3575537_+	hypothetical protein	NA	NA	NA	NA	NA
QAX37625.1|3575688_3575898_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	7.4e-33
QAX37626.1|3575968_3576940_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.4	2.5e-38
QAX37627.1|3576947_3577232_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	90.4	1.6e-46
QAX37628.1|3577250_3578096_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.7	1.3e-67
QAX37629.1|3578092_3578773_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	94.7	2.2e-126
QAX37630.1|3578769_3579198_+	regulator	NA	M9NYX4	Enterobacteria_phage	94.4	7.5e-72
QAX37631.1|3579194_3579347_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.6e-05
QAX37632.1|3579343_3580009_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	82.8	9.5e-106
QAX37633.1|3580008_3580233_+	hypothetical protein	NA	NA	NA	NA	NA
QAX37634.1|3580229_3580451_+	hypothetical protein	NA	NA	NA	NA	NA
QAX37635.1|3580454_3580676_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	54.3	1.5e-15
QAX37636.1|3580843_3581083_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	70.5	3.8e-25
QAX37637.1|3581111_3581312_+	hypothetical protein	NA	NA	NA	NA	NA
QAX37638.1|3581579_3582743_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	68.0	1.3e-153
QAX37639.1|3582948_3584199_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3582758:3582803	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
QAX37640.1|3584210_3585314_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
QAX37641.1|3585596_3586649_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 1
CP033353	Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence	255345	374	31620	255345	transposase	Escherichia_phage(57.14%)	27	NA	NA
QAX33934.1|374_1250_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
QAX33935.1|1329_2253_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
QAX33936.1|4003_4708_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX33937.1|5093_5510_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
QAX33938.1|5514_6033_-	hypothetical protein	NA	NA	NA	NA	NA
QAX33939.1|6098_6803_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX33940.1|6849_7251_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
QAX33941.1|7400_8261_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
QAX33942.1|8845_9550_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX33943.1|10305_11157_+	replication protein	NA	NA	NA	NA	NA
QAX33944.1|11464_12280_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
QAX33945.1|12340_13144_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
QAX33946.1|13143_13980_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
QAX33947.1|14040_14745_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX34173.1|15647_16121_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
QAX33948.1|16251_17040_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
QAX33949.1|17241_17946_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX33950.1|18037_18517_+	transcriptional regulator	NA	NA	NA	NA	NA
QAX33951.1|18586_21739_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
QAX33952.1|21762_22938_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
QAX33953.1|23257_23962_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX33954.1|24815_26357_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
QAX34174.1|27755_28529_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
QAX33955.1|28509_28791_-	hypothetical protein	NA	NA	NA	NA	NA
QAX33956.1|29177_29882_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QAX33957.1|29993_30152_-	Hok/Gef family protein	NA	NA	NA	NA	NA
QAX33958.1|30250_31620_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
>prophage 2
CP033353	Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence	255345	67619	109725	255345	transposase	Escherichia_phage(46.67%)	40	NA	NA
QAX33997.1|67619_68892_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
QAX33998.1|68946_69129_+	hypothetical protein	NA	NA	NA	NA	NA
QAX33999.1|69186_69468_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34000.1|69448_69910_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34001.1|70131_71823_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.0	7.6e-67
QAX34002.1|72070_73234_-	DNA-binding protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
QAX34003.1|74245_74950_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QAX34176.1|74979_75684_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
QAX34004.1|75808_76186_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34005.1|77695_78400_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QAX34006.1|79388_79640_+	plasmid stabilization protein	NA	NA	NA	NA	NA
QAX34007.1|79629_79911_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
QAX34177.1|80149_80338_-	hypothetical protein	NA	A0A077SL39	Escherichia_phage	96.7	8.8e-09
QAX34008.1|80407_81607_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
QAX34009.1|81616_81805_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34010.1|83383_84178_+	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
QAX34011.1|84484_85189_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QAX34012.1|85293_85650_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34013.1|85595_86180_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAX34014.1|86179_87418_-	MFS transporter	NA	NA	NA	NA	NA
QAX34015.1|87414_88320_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
QAX34016.1|88441_89146_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX34017.1|89344_89668_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
QAX34018.1|89772_90810_+	permease	NA	NA	NA	NA	NA
QAX34019.1|93745_94336_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34020.1|94335_94593_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34021.1|94946_97085_+	AAA family ATPase	NA	NA	NA	NA	NA
QAX34022.1|97662_97893_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
QAX34178.1|97834_98008_-	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
QAX34023.1|98188_98479_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34024.1|98468_99368_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34025.1|99417_101643_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
QAX34026.1|101644_102733_-	transcriptional regulator	NA	NA	NA	NA	NA
QAX34027.1|103284_103635_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34028.1|103855_104560_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QAX34029.1|106131_106311_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34030.1|106426_107071_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	28.3	9.8e-07
QAX34031.1|107365_107986_+	chromosome partitioning protein ParA	NA	A2I303	Vibrio_virus	33.8	6.3e-19
QAX34032.1|108037_108268_+	DNA partition complex ParG	NA	NA	NA	NA	NA
QAX34033.1|109020_109725_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 3
CP033353	Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence	255345	198822	246900	255345	transposase	Escherichia_phage(36.36%)	58	NA	NA
QAX34117.1|198822_199527_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX34118.1|201331_202009_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
QAX34119.1|202087_203287_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
QAX34120.1|203318_204203_-	EamA family transporter	NA	NA	NA	NA	NA
QAX34181.1|204340_204733_-	cysteine hydrolase	NA	NA	NA	NA	NA
QAX34182.1|206597_206948_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34183.1|207324_207642_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34121.1|207692_208100_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34122.1|208129_208591_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34123.1|208927_209158_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34124.1|209194_209482_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34125.1|209519_209774_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34184.1|209819_210053_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34126.1|210274_211171_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34127.1|211173_211689_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
QAX34128.1|211903_213331_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
QAX34129.1|213581_214901_+	DUF1173 family protein	NA	NA	NA	NA	NA
QAX34130.1|214913_215117_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34131.1|215180_216386_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
QAX34132.1|216382_217201_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
QAX34133.1|217843_218224_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34134.1|218281_218947_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34135.1|219006_219462_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34136.1|219503_219740_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34137.1|219775_220060_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34138.1|220237_220642_+	DNA-binding protein	NA	NA	NA	NA	NA
QAX34139.1|220717_220897_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34140.1|220983_221187_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34141.1|222217_223204_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34142.1|223200_225240_+	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
QAX34143.1|225242_225488_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34144.1|225552_225852_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34145.1|226600_227026_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34146.1|227279_228095_-	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
QAX34147.1|228107_228518_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34148.1|228619_228826_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34149.1|228886_230212_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
QAX34185.1|230216_230510_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAX34150.1|230809_231514_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX34151.1|231631_231835_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34152.1|231853_232033_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34153.1|231962_232802_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
QAX34154.1|232795_233143_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
QAX34155.1|233365_233818_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
QAX34156.1|233902_234535_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
QAX34186.1|234672_235503_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
QAX34187.1|235633_236188_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
QAX34157.1|236331_237036_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAX34158.1|237149_237926_+	AAC(3)-VI family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
QAX34159.1|237946_238168_+	hypothetical protein	NA	NA	NA	NA	NA
QAX34160.1|238154_239180_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
QAX34161.1|239601_240354_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
QAX34162.1|242164_242650_+	phenol hydroxylase	NA	NA	NA	NA	NA
QAX34163.1|242846_243937_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
QAX34164.1|244026_244842_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
QAX34165.1|244928_245231_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
QAX34166.1|245124_245376_-	hypothetical protein	NA	NA	NA	NA	NA
QAX34167.1|245406_246900_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
