The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026164	Klebsiella pneumoniae strain F81 chromosome, complete genome	5164372	1620947	1627852	5164372		Planktothrix_phage(33.33%)	6	NA	NA
QAX23410.1|1620947_1621811_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
QAX20179.1|1621821_1622595_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
QAX23411.1|1622835_1623729_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
QAX20180.1|1623974_1625336_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
QAX20181.1|1625654_1626377_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
QAX20182.1|1626373_1627852_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
CP026164	Klebsiella pneumoniae strain F81 chromosome, complete genome	5164372	1671197	1684515	5164372		Enterobacteria_phage(22.22%)	12	NA	NA
QAX20211.1|1671197_1672604_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
QAX20212.1|1672830_1674246_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
QAX20213.1|1674267_1675638_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
QAX23414.1|1675792_1676857_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
QAX20214.1|1676870_1677740_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
QAX20215.1|1677771_1678662_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
QAX20216.1|1678676_1679231_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
QAX20217.1|1679410_1680577_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
QAX20218.1|1680969_1681977_+	acyltransferase	NA	NA	NA	NA	NA
QAX23415.1|1682191_1682296_-	hypothetical protein	NA	NA	NA	NA	NA
QAX20219.1|1683246_1683441_-	hypothetical protein	NA	NA	NA	NA	NA
QAX20220.1|1683510_1684515_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.0e-31
>prophage 3
CP026164	Klebsiella pneumoniae strain F81 chromosome, complete genome	5164372	2607028	2617915	5164372		Escherichia_phage(87.5%)	9	NA	NA
QAX21079.1|2607028_2610136_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
QAX21080.1|2610190_2611456_+	MFS transporter	NA	NA	NA	NA	NA
QAX21081.1|2611486_2612575_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
QAX21082.1|2612661_2612922_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
QAX21083.1|2613219_2614080_+	class A broad-spectrum beta-lactamase SHV-71	NA	A0A077SL40	Escherichia_phage	99.0	4.9e-155
QAX21084.1|2614100_2614862_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
QAX21085.1|2615122_2616025_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
QAX21086.1|2616036_2617302_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	1.7e-233
QAX21087.1|2617294_2617915_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
CP026164	Klebsiella pneumoniae strain F81 chromosome, complete genome	5164372	3281144	3290608	5164372	protease,tRNA	Brazilian_cedratvirus(16.67%)	9	NA	NA
QAX21695.1|3281144_3282866_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
QAX23488.1|3282910_3283612_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
QAX21696.1|3283965_3284184_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
QAX21697.1|3284304_3286584_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
QAX21698.1|3286614_3286932_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
QAX21699.1|3287257_3287479_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
QAX21700.1|3287433_3287616_-	hypothetical protein	NA	NA	NA	NA	NA
QAX21701.1|3287555_3289496_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
QAX21702.1|3289492_3290608_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	9.9e-07
>prophage 5
CP026164	Klebsiella pneumoniae strain F81 chromosome, complete genome	5164372	3771706	3817198	5164372	terminase,tail,integrase,holin,tRNA	Klebsiella_phage(22.22%)	66	3762773:3762818	3814271:3814316
3762773:3762818	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
QAX22109.1|3771706_3774775_-	kinase	NA	A0A286S259	Klebsiella_phage	97.8	0.0e+00
QAX22110.1|3774771_3775152_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
QAX22111.1|3775161_3775644_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	93.8	3.8e-80
QAX22112.1|3775824_3776289_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
QAX22113.1|3776603_3776939_-	hypothetical protein	NA	NA	NA	NA	NA
QAX22114.1|3777022_3779677_-|tail	phage tail protein	tail	A0A2D1GPC9	Escherichia_phage	34.5	3.0e-86
QAX23515.1|3779750_3780119_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	3.3e-15
QAX22115.1|3780229_3780586_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
QAX22116.1|3780662_3780839_-	hypothetical protein	NA	NA	NA	NA	NA
QAX22117.1|3781006_3781489_-	hypothetical protein	NA	NA	NA	NA	NA
QAX22118.1|3781542_3782715_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	7.2e-24
QAX22119.1|3782738_3783131_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
QAX22120.1|3783127_3783679_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
QAX22121.1|3783680_3784064_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
QAX22122.1|3784050_3784284_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	1.3e-09
QAX22123.1|3784293_3784548_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
QAX22124.1|3784549_3784945_-	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
QAX22125.1|3785266_3786220_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
QAX22126.1|3786230_3787016_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.7e-66
QAX22127.1|3787546_3788659_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.3	3.3e-111
QAX22128.1|3788642_3790043_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	9.2e-127
QAX22129.1|3790044_3791358_-|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.6	2.2e-183
QAX22130.1|3791341_3792337_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.1e-38
QAX22131.1|3792884_3793070_-	hypothetical protein	NA	NA	NA	NA	NA
QAX22132.1|3793198_3793444_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
QAX22133.1|3794257_3794452_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.5	3.1e-25
QAX22134.1|3794402_3794678_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	71.4	4.9e-08
QAX22135.1|3794674_3795019_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
QAX22136.1|3795015_3795555_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
QAX22137.1|3795551_3795863_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
QAX22138.1|3796503_3796980_-	endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	51.9	5.1e-37
QAX22139.1|3796979_3797663_-	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	2.6e-58
QAX22140.1|3797796_3798432_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	78.4	3.1e-82
QAX23516.1|3798424_3798595_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
QAX22141.1|3798600_3799197_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
QAX22142.1|3799303_3799561_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	71.2	4.9e-26
QAX23517.1|3800343_3800814_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	59.2	5.0e-45
QAX22143.1|3800900_3801194_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	82.5	1.2e-41
QAX22144.1|3801193_3801727_-	hypothetical protein	NA	NA	NA	NA	NA
QAX22145.1|3801719_3801983_-	DUF4752 domain-containing protein	NA	T1S9K2	Salmonella_phage	75.6	2.2e-29
QAX23518.1|3801979_3802465_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	33.3	3.3e-07
QAX22146.1|3802467_3802692_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	48.5	2.0e-12
QAX22147.1|3802688_3802991_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QAX22148.1|3802990_3803767_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	8.8e-95
QAX23519.1|3803763_3804492_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
QAX22149.1|3804625_3804847_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
QAX22150.1|3804886_3805120_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
QAX22151.1|3805224_3805914_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.3e-86
QAX23520.1|3805936_3806056_+	hypothetical protein	NA	NA	NA	NA	NA
QAX22152.1|3806254_3806971_+	hypothetical protein	NA	NA	NA	NA	NA
QAX22153.1|3806961_3807507_+	PIN domain-containing protein	NA	NA	NA	NA	NA
QAX22154.1|3807555_3807759_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.0e-18
QAX22155.1|3808005_3808194_+	hypothetical protein	NA	NA	NA	NA	NA
QAX22156.1|3808186_3808393_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
QAX22157.1|3808473_3808758_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	61.7	8.9e-29
QAX22158.1|3808773_3809619_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
QAX22159.1|3809615_3810296_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.9	3.9e-123
QAX22160.1|3810292_3810721_+	regulator	NA	M9NYX4	Enterobacteria_phage	81.0	4.4e-64
QAX22161.1|3810717_3811374_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	85.6	6.3e-110
QAX22162.1|3811370_3812447_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	66.2	6.2e-139
QAX22163.1|3812443_3812662_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
QAX22164.1|3812663_3812879_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	51.4	2.6e-12
QAX22165.1|3813092_3814256_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.8	1.1e-202
QAX22166.1|3814686_3815553_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3814271:3814316	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
QAX22167.1|3815554_3815767_+	ribosome-associated protein	NA	NA	NA	NA	NA
QAX22168.1|3815812_3817198_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
CP026165	Klebsiella pneumoniae strain F81 plasmid pF81_1, complete sequence	111252	68	110667	111252	tail,integrase,capsid,terminase	Salmonella_phage(89.0%)	117	45728:45743	57041:57056
QAX23583.1|68_380_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	67.0	1.8e-30
QAX23584.1|516_729_-	hypothetical protein	NA	J9Q804	Salmonella_phage	72.9	9.9e-25
QAX23585.1|741_960_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
QAX23586.1|975_1236_-	hypothetical protein	NA	NA	NA	NA	NA
QAX23587.1|1824_2046_+	hypothetical protein	NA	NA	NA	NA	NA
QAX23588.1|2504_3731_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.5	9.6e-120
QAX23589.1|3901_4219_-	hypothetical protein	NA	J9Q750	Salmonella_phage	75.2	4.1e-43
QAX23590.1|4417_4846_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
QAX23591.1|5119_5479_-	hypothetical protein	NA	NA	NA	NA	NA
QAX23698.1|5725_5989_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	1.7e-29
QAX23592.1|6140_6842_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	69.7	6.8e-78
QAX23593.1|6930_8634_-	DNA modification methylase	NA	J9Q747	Salmonella_phage	97.9	0.0e+00
QAX23594.1|9005_11075_+	HypX	NA	NA	NA	NA	NA
QAX23595.1|11243_11738_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	98.8	1.9e-82
QAX23596.1|11834_12482_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.1	6.4e-91
QAX23597.1|13054_13288_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
QAX23598.1|13485_14079_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	84.3	7.2e-97
QAX23599.1|14263_15097_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	55.3	3.0e-64
QAX23600.1|15222_15771_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	74.4	3.2e-75
QAX23601.1|15767_16349_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	50.4	4.2e-33
QAX23602.1|16571_16991_-	hypothetical protein	NA	J9Q743	Salmonella_phage	73.4	5.5e-51
QAX23603.1|17054_17699_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	78.0	2.1e-94
QAX23604.1|17698_18175_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.6	4.9e-72
QAX23605.1|18171_18585_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	1.8e-54
QAX23606.1|18586_19690_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
QAX23607.1|19883_20759_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	85.1	1.2e-140
QAX23608.1|20836_21979_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.5	2.0e-212
QAX23609.1|22109_24413_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
QAX23610.1|24488_25058_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
QAX23611.1|25067_25814_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	62.1	7.7e-80
QAX23612.1|25803_27720_-	exonuclease	NA	J9Q741	Salmonella_phage	84.8	1.1e-300
QAX23613.1|27716_27950_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
QAX23614.1|27949_29035_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.5	2.0e-182
QAX23615.1|29462_29675_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAX23616.1|29671_30538_+	hypothetical protein	NA	A0A2I6UHT9	Bacillus_phage	55.8	1.1e-05
QAX23617.1|30568_32029_-	hypothetical protein	NA	A0A2I6UHU5	Bacillus_phage	33.3	5.0e-59
QAX23618.1|32543_33188_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	1.1e-98
QAX23619.1|33306_33498_-	hypothetical protein	NA	NA	NA	NA	NA
QAX23620.1|33509_34607_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.1	1.3e-72
QAX23621.1|35058_35271_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
QAX23622.1|35270_35606_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	3.6e-37
QAX23623.1|35602_35782_-	hypothetical protein	NA	NA	NA	NA	NA
QAX23624.1|36315_37392_-	recombinase	NA	J9Q736	Salmonella_phage	96.1	8.5e-197
QAX23625.1|37394_37661_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
QAX23626.1|37660_38605_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.3	2.8e-172
QAX23627.1|38665_39673_-	regulator	NA	J9Q7Z3	Salmonella_phage	88.0	6.0e-144
QAX23699.1|39792_40224_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	90.9	9.0e-65
QAX23628.1|40370_40670_-	hypothetical protein	NA	NA	NA	NA	NA
QAX23629.1|40680_41100_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
QAX23630.1|41300_41744_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	82.3	1.7e-58
QAX23631.1|41740_42910_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.0	5.8e-207
QAX23632.1|42931_43633_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.1	4.9e-20
QAX23633.1|43629_45993_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	87.0	0.0e+00
45728:45743	attL	AATGATTCCATACATC	NA	NA	NA	NA
QAX23634.1|45967_46171_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	7.2e-25
QAX23635.1|46173_47406_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	86.4	3.7e-212
QAX23636.1|47502_49782_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	65.1	6.5e-247
QAX23637.1|50383_50764_+	transcriptional regulator	NA	NA	NA	NA	NA
QAX23638.1|50758_51859_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.2e-17
QAX23639.1|52208_52568_+	hypothetical protein	NA	NA	NA	NA	NA
QAX23640.1|52632_53043_-	toxin YafO	NA	NA	NA	NA	NA
QAX23641.1|53052_53670_-	hypothetical protein	NA	NA	NA	NA	NA
QAX23700.1|53764_54010_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
QAX23642.1|54140_54917_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.4	5.5e-89
QAX23643.1|55122_56355_+	hypothetical protein	NA	NA	NA	NA	NA
QAX23644.1|57605_57905_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	66.7	3.9e-27
57041:57056	attR	GATGTATGGAATCATT	NA	NA	NA	NA
QAX23645.1|57901_58054_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	82.0	1.2e-16
QAX23646.1|58050_58266_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	8.5e-24
QAX23647.1|58478_58946_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	64.6	8.8e-50
QAX23648.1|59025_59814_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	2.0e-70
QAX23649.1|60109_61276_+	hypothetical protein	NA	NA	NA	NA	NA
QAX23650.1|61315_62434_-	DNA primase	NA	J9Q720	Salmonella_phage	91.6	1.1e-202
QAX23651.1|62586_63927_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	95.7	7.0e-241
QAX23652.1|63991_64717_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	5.6e-128
QAX23653.1|64923_65688_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	41.0	7.7e-51
QAX23654.1|65703_66066_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
QAX23655.1|66065_66731_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
QAX23656.1|66915_67665_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.3	1.6e-16
QAX23657.1|67649_68042_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	42.2	1.0e-14
QAX23658.1|68458_68710_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	73.5	2.0e-24
QAX23659.1|68712_69405_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.1	2.0e-119
QAX23660.1|69418_69742_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
QAX23661.1|69832_71278_-	endosialidase chaperone	NA	A0A0H4TGH1	Klebsiella_phage	38.2	1.8e-40
QAX23662.1|71330_83501_-	hypothetical protein	NA	J9Q713	Salmonella_phage	59.1	6.3e-30
QAX23663.1|83517_84129_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
QAX23664.1|84116_84914_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	7.1e-140
QAX23665.1|84906_85605_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
QAX23666.1|85691_86027_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
QAX23667.1|86070_90600_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	69.1	0.0e+00
QAX23668.1|90607_90841_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
QAX23669.1|90957_91275_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
QAX23670.1|91336_92083_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
QAX23671.1|92150_92543_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	68.3	9.0e-48
QAX23672.1|92544_93018_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
QAX23673.1|93008_93353_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	2.2e-53
QAX23674.1|93450_94284_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	4.8e-131
QAX23675.1|94283_94718_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
QAX23676.1|94765_95194_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	71.6	1.0e-28
QAX23677.1|95272_96151_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	4.7e-153
QAX23678.1|96177_97077_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
QAX23679.1|97099_98689_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.5	5.1e-275
QAX23680.1|98706_99963_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
QAX23681.1|99965_100607_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
QAX23682.1|100782_101049_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
QAX23683.1|101058_101949_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
QAX23684.1|101945_102497_-	hypothetical protein	NA	NA	NA	NA	NA
QAX23685.1|102486_103128_-	adenylyl-sulfate kinase	NA	J9Q807	Salmonella_phage	96.7	6.8e-109
QAX23686.1|103124_103793_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
QAX23687.1|103792_104473_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
QAX23688.1|104556_106116_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	92.9	5.2e-280
QAX23689.1|106118_106394_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
QAX23690.1|106444_106882_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
QAX23691.1|107037_107568_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
QAX23692.1|107571_107880_+	hypothetical protein	NA	NA	NA	NA	NA
QAX23693.1|108200_108851_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.2	1.9e-106
QAX23694.1|108901_109105_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
QAX23695.1|109697_110180_-	hypothetical protein	NA	J9Q805	Salmonella_phage	76.9	1.0e-69
QAX23696.1|110385_110667_-	ABC transporter	NA	J9Q753	Salmonella_phage	84.9	2.4e-42
>prophage 1
CP026166	Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence	211437	12490	56219	211437	integrase,transposase	Bacillus_phage(23.53%)	36	9039:9054	59718:59733
9039:9054	attL	CGGAGGCCTTCGAACA	NA	NA	NA	NA
QAX23708.1|12490_13273_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
QAX23709.1|15619_16057_-	hypothetical protein	NA	NA	NA	NA	NA
QAX23710.1|16056_17088_-	chromosome partitioning protein ParB	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
QAX23711.1|17087_17954_-	ParA family protein	NA	NA	NA	NA	NA
QAX23712.1|18424_18613_-	hypothetical protein	NA	NA	NA	NA	NA
QAX23713.1|19076_20045_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
QAX23714.1|20159_20318_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
QAX23884.1|20630_21560_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
QAX23715.1|21704_22484_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
QAX23885.1|22480_23293_-	hypothetical protein	NA	NA	NA	NA	NA
QAX23716.1|24225_25200_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
QAX23886.1|25836_26745_+	HNH endonuclease	NA	NA	NA	NA	NA
QAX23717.1|27131_27482_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
QAX23718.1|27625_28057_-	silver-binding protein SilE	NA	NA	NA	NA	NA
QAX23719.1|28307_29783_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
QAX23720.1|29775_30456_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
QAX23721.1|30645_32031_+	hypothetical protein	NA	NA	NA	NA	NA
QAX23722.1|32059_32422_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAX23723.1|32535_33828_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
QAX23724.1|33838_36985_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
QAX23725.1|37071_37512_+	hypothetical protein	NA	NA	NA	NA	NA
QAX23726.1|37638_40086_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
QAX23727.1|40126_40324_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
QAX23728.1|40357_41095_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
QAX23729.1|41383_41833_-	copper resistance protein	NA	NA	NA	NA	NA
QAX23730.1|42066_43884_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
QAX23731.1|43883_44780_+	copper resistance protein B	NA	NA	NA	NA	NA
QAX23732.1|44819_45200_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
QAX23733.1|45204_46134_+	copper resistance protein CopD	NA	NA	NA	NA	NA
QAX23734.1|46188_46869_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
QAX23735.1|46865_48266_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
QAX23736.1|48561_48996_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
QAX23737.1|49081_51487_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
QAX23738.1|51483_52560_+	signal peptidase II	NA	NA	NA	NA	NA
QAX23739.1|52689_53247_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
QAX23740.1|53249_56219_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
59718:59733	attR	CGGAGGCCTTCGAACA	NA	NA	NA	NA
