The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026162	Klebsiella pneumoniae strain F13 chromosome, complete genome	5371994	1168230	1254180	5371994	head,tail,capsid,portal,integrase,tRNA,plate	Salmonella_phage(77.78%)	89	1178324:1178370	1213191:1213237
QAX14554.1|1168230_1168902_-|integrase	integrase	integrase	NA	NA	NA	NA
QAX14555.1|1169014_1169362_-	addiction module toxin RelE	NA	NA	NA	NA	NA
QAX14556.1|1169385_1169613_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
QAX18368.1|1170142_1171012_+	hypothetical protein	NA	NA	NA	NA	NA
QAX14557.1|1171101_1172493_+	hypothetical protein	NA	NA	NA	NA	NA
QAX14558.1|1173112_1176742_-	DNA helicase	NA	NA	NA	NA	NA
QAX14559.1|1176879_1178121_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	47.5	7.0e-102
1178324:1178370	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
QAX18369.1|1178483_1179584_-	hypothetical protein	NA	NA	NA	NA	NA
QAX14560.1|1179649_1180642_-	hypothetical protein	NA	NA	NA	NA	NA
QAX14561.1|1180650_1181664_-|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	93.5	8.5e-191
QAX14562.1|1181666_1182296_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.1	3.9e-61
QAX14563.1|1182418_1182661_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
QAX14564.1|1182693_1183203_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	84.6	3.2e-77
QAX18370.1|1183210_1183411_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	84.6	1.3e-26
QAX14565.1|1183374_1183716_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	86.7	8.4e-50
QAX14566.1|1183783_1184017_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.3e-30
QAX14567.1|1184016_1184244_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	89.3	1.2e-33
QAX14568.1|1184240_1185098_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.2	3.4e-116
QAX14569.1|1185094_1187509_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	88.4	0.0e+00
QAX14570.1|1187662_1187851_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
QAX14571.1|1188380_1188599_+	multidrug ABC transporter ATPase	NA	NA	NA	NA	NA
QAX14572.1|1188598_1189441_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.0e-59
QAX14573.1|1189450_1189660_+	hypothetical protein	NA	NA	NA	NA	NA
QAX14574.1|1189656_1191090_+	hypothetical protein	NA	NA	NA	NA	NA
QAX14575.1|1191124_1192159_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.7e-176
QAX14576.1|1192158_1193922_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
QAX14577.1|1194062_1194896_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	1.5e-103
QAX14578.1|1194912_1195977_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
QAX14579.1|1195980_1196631_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.1	3.6e-102
QAX14580.1|1196727_1197192_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	1.0e-74
QAX14581.1|1197191_1197395_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
QAX14582.1|1197398_1197614_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
QAX14583.1|1197594_1198104_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	1.2e-81
QAX14584.1|1198108_1198492_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	1.2e-17
QAX14585.1|1198488_1198917_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	79.4	7.3e-51
QAX14586.1|1199012_1199444_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
QAX14587.1|1199436_1199883_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.0	2.5e-54
QAX14588.1|1199951_1200524_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.8	1.6e-77
QAX14589.1|1200520_1200883_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	2.9e-48
QAX14590.1|1200869_1201778_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.5	5.4e-104
QAX18371.1|1201770_1202364_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	60.7	9.5e-57
QAX14591.1|1202369_1204478_+	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	39.6	7.4e-112
QAX14592.1|1204478_1204697_+	hypothetical protein	NA	NA	NA	NA	NA
QAX14593.1|1204724_1205888_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	53.8	7.6e-50
QAX14594.1|1206026_1207199_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	3.3e-210
QAX14595.1|1207208_1207724_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
QAX14596.1|1207776_1208076_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	2.8e-33
QAX14597.1|1208090_1208210_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
QAX14598.1|1208202_1210830_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.7	2.7e-119
QAX14599.1|1210826_1211312_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.0	9.1e-58
QAX14600.1|1211308_1212406_+	late control protein D	NA	E5G6Q3	Salmonella_phage	84.4	1.3e-173
QAX14601.1|1212472_1212691_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.1e-26
QAX14602.1|1212718_1213096_-	hypothetical protein	NA	NA	NA	NA	NA
QAX14603.1|1213697_1214180_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1213191:1213237	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
QAX14604.1|1214290_1214767_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
QAX14605.1|1214756_1215047_+	RnfH family protein	NA	NA	NA	NA	NA
QAX14606.1|1215113_1215455_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
QAX14607.1|1215602_1217264_-	DNA repair protein RecN	NA	NA	NA	NA	NA
QAX14608.1|1217351_1218230_-	NAD(+) kinase	NA	NA	NA	NA	NA
QAX14609.1|1218354_1218945_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
QAX14610.1|1219064_1220351_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
QAX14611.1|1220370_1221162_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
QAX14612.1|1221325_1222690_+	signal recognition particle protein	NA	NA	NA	NA	NA
QAX14613.1|1222949_1223198_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
QAX14614.1|1223216_1223765_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
QAX14615.1|1223796_1224564_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
QAX14616.1|1224603_1224951_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
QAX14617.1|1225070_1225529_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
QAX14618.1|1225585_1226956_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
QAX14619.1|1226964_1227447_-	hypothetical protein	NA	NA	NA	NA	NA
QAX14620.1|1227460_1228684_-	diguanylate cyclase	NA	NA	NA	NA	NA
QAX14621.1|1228676_1229186_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
QAX14622.1|1229528_1230599_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
QAX14623.1|1230608_1231730_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
QAX14624.1|1231792_1232665_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
QAX14625.1|1232661_1233822_-	prephenate dehydratase	NA	NA	NA	NA	NA
QAX18372.1|1233922_1233970_-	hypothetical protein	NA	NA	NA	NA	NA
QAX14626.1|1234076_1234412_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
QAX14627.1|1234682_1235420_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
QAX14628.1|1235551_1236532_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
QAX14629.1|1236528_1237260_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
QAX14630.1|1237389_1239963_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
QAX14631.1|1245868_1247167_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
QAX14632.1|1247170_1247494_-	hypothetical protein	NA	NA	NA	NA	NA
QAX14633.1|1247535_1248891_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
QAX14634.1|1249011_1251663_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
QAX14635.1|1251697_1252396_-	DTW domain-containing protein	NA	NA	NA	NA	NA
QAX14636.1|1252465_1252891_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
QAX14637.1|1253094_1254180_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
CP026162	Klebsiella pneumoniae strain F13 chromosome, complete genome	5371994	1663185	1670090	5371994		Planktothrix_phage(33.33%)	6	NA	NA
QAX18386.1|1663185_1664049_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
QAX14992.1|1664059_1664833_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
QAX18387.1|1665073_1665967_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
QAX14993.1|1666212_1667574_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
QAX14994.1|1667892_1668615_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
QAX14995.1|1668611_1670090_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
CP026162	Klebsiella pneumoniae strain F13 chromosome, complete genome	5371994	2760981	2771868	5371994		Escherichia_phage(87.5%)	9	NA	NA
QAX15985.1|2760981_2764089_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
QAX15986.1|2764143_2765409_+	MFS transporter	NA	NA	NA	NA	NA
QAX15987.1|2765439_2766528_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
QAX15988.1|2766614_2766875_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
QAX15989.1|2767172_2768033_+	class A extended-spectrum beta-lactamase SHV-27	NA	A0A077SL40	Escherichia_phage	99.3	2.9e-155
QAX15990.1|2768053_2768815_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
QAX15991.1|2769075_2769978_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
QAX15992.1|2769989_2771255_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	5.1e-233
QAX15993.1|2771247_2771868_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
CP026162	Klebsiella pneumoniae strain F13 chromosome, complete genome	5371994	3043252	3091515	5371994	holin,lysis,integrase,terminase	Salmonella_phage(22.45%)	63	3086201:3086218	3097242:3097259
QAX16233.1|3043252_3045454_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.7	2.6e-99
QAX16234.1|3045528_3048597_-	kinase	NA	A0A286S259	Klebsiella_phage	97.7	0.0e+00
QAX16235.1|3048593_3048974_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	96.8	6.2e-70
QAX16236.1|3048983_3049466_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.2	2.1e-83
QAX16237.1|3049452_3049926_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.6	8.6e-61
QAX16238.1|3049925_3052517_-	hypothetical protein	NA	D4FUM0	Pseudomonas_phage	34.7	2.4e-56
QAX16239.1|3052581_3052974_-	hypothetical protein	NA	S4TR42	Salmonella_phage	69.0	6.1e-28
QAX16240.1|3052977_3053961_-	hypothetical protein	NA	W6AT81	Vibrio_phage	38.5	5.1e-07
QAX16241.1|3053965_3054133_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16242.1|3054300_3054783_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16243.1|3054836_3056009_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	7.2e-24
QAX16244.1|3056032_3056425_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
QAX16245.1|3056421_3056973_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
QAX16246.1|3056974_3057358_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	1.2e-20
QAX16247.1|3057344_3057578_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
QAX16248.1|3057587_3057842_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
QAX16249.1|3057843_3058239_-	protein singed	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	1.5e-13
QAX16250.1|3058560_3059514_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	1.7e-132
QAX16251.1|3059524_3060310_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.7	2.4e-68
QAX16252.1|3060394_3061507_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.2	5.6e-111
QAX16253.1|3061490_3062891_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.7	6.4e-128
QAX16254.1|3062890_3064198_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
QAX16255.1|3064175_3065180_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.1	3.8e-34
QAX16256.1|3065226_3065562_+	hypothetical protein	NA	NA	NA	NA	NA
QAX16257.1|3065611_3066028_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
QAX16258.1|3066101_3066347_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	95.1	1.1e-32
QAX18449.1|3066631_3066853_-	DNA gyrase subunit B	NA	NA	NA	NA	NA
QAX16259.1|3066958_3067147_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16260.1|3067592_3067793_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	5.9e-19
QAX16261.1|3067934_3068402_-|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	72.3	1.2e-54
QAX16262.1|3068398_3068878_-	lysozyme	NA	A5VW81	Enterobacteria_phage	82.4	5.5e-71
QAX16263.1|3068861_3069185_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	78.5	1.8e-41
QAX16264.1|3070208_3071180_-	DUF4747 domain-containing protein	NA	NA	NA	NA	NA
QAX16265.1|3071423_3072239_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	75.6	2.3e-109
QAX16266.1|3072235_3072532_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	2.7e-36
QAX16267.1|3072534_3072741_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	71.2	9.0e-23
QAX16268.1|3072740_3073340_-	hypothetical protein	NA	K7PKS6	Enterobacteria_phage	78.4	1.1e-89
QAX16269.1|3073750_3073984_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	70.1	2.9e-25
QAX16270.1|3074244_3074565_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16271.1|3074682_3076542_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	57.8	1.6e-211
QAX18450.1|3076538_3076796_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16272.1|3076804_3077056_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	52.8	2.8e-10
QAX16273.1|3077052_3077253_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	78.5	6.7e-23
QAX16274.1|3077249_3077618_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	39.0	2.9e-11
QAX16275.1|3077610_3078354_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	56.4	8.2e-66
QAX16276.1|3078350_3079268_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	65.1	3.7e-100
QAX16277.1|3079345_3079606_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16278.1|3079616_3080153_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.8	5.4e-59
QAX16279.1|3080155_3080383_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	50.0	3.4e-15
QAX16280.1|3080487_3080922_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	39.0	2.3e-15
QAX16281.1|3081105_3081204_+	hypothetical protein	NA	NA	NA	NA	NA
QAX16282.1|3081310_3081502_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
QAX16283.1|3081510_3081666_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
QAX16284.1|3081803_3084908_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	56.6	1.6e-293
QAX16285.1|3084920_3086009_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.2	3.7e-107
QAX16286.1|3086043_3086685_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	71.8	1.1e-87
3086201:3086218	attL	TTGTTCTCGGCGAAAAAG	NA	NA	NA	NA
QAX16287.1|3086681_3086990_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	7.1e-24
QAX16288.1|3086997_3087237_+	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
QAX16289.1|3087246_3087561_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
QAX16290.1|3087457_3088645_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
QAX16291.1|3088821_3089712_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
QAX16292.1|3089711_3090704_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
QAX16293.1|3090705_3091515_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3097242:3097259	attR	TTGTTCTCGGCGAAAAAG	NA	NA	NA	NA
>prophage 5
CP026162	Klebsiella pneumoniae strain F13 chromosome, complete genome	5371994	3213897	3300135	5371994	head,tail,capsid,portal,tRNA,integrase,holin,terminase	Klebsiella_phage(46.67%)	96	3252439:3252454	3303821:3303836
QAX16410.1|3213897_3214398_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
QAX16411.1|3214515_3214962_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
QAX18454.1|3214945_3215737_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QAX16412.1|3215838_3217023_+	cyanate MFS transporter	NA	NA	NA	NA	NA
QAX16413.1|3217054_3217747_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16414.1|3217892_3218402_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
QAX16415.1|3218388_3218745_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
QAX16416.1|3218734_3218974_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
QAX16417.1|3219274_3220288_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
QAX16418.1|3220345_3220447_+	hypothetical protein	NA	NA	NA	NA	NA
QAX18455.1|3220446_3220521_+	hypothetical protein	NA	NA	NA	NA	NA
QAX16419.1|3220638_3220764_+	hypothetical protein	NA	NA	NA	NA	NA
QAX16420.1|3220823_3221087_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
QAX16421.1|3221217_3221856_-	leucine efflux protein	NA	NA	NA	NA	NA
QAX16422.1|3221945_3222860_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
QAX16423.1|3223075_3223267_+	hypothetical protein	NA	NA	NA	NA	NA
QAX16424.1|3223521_3224565_-	L-asparaginase	NA	NA	NA	NA	NA
QAX16425.1|3224867_3226076_+	phosphodiesterase	NA	NA	NA	NA	NA
QAX16426.1|3226149_3227934_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
QAX16427.1|3227940_3228831_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QAX16428.1|3228951_3230460_+	3,4-dihydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
QAX16429.1|3230770_3231457_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
QAX16430.1|3231854_3232034_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16431.1|3232073_3232706_-	DNA-binding protein	NA	NA	NA	NA	NA
QAX16432.1|3233272_3233470_+	hypothetical protein	NA	NA	NA	NA	NA
QAX16433.1|3233585_3234596_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
QAX16434.1|3234592_3235999_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
QAX16435.1|3236054_3236942_-	Mn-containing catalase	NA	NA	NA	NA	NA
QAX16436.1|3236958_3237465_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
QAX16437.1|3237491_3237986_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
QAX16438.1|3238076_3238262_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
QAX16439.1|3238883_3240077_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
QAX16440.1|3240189_3240417_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
QAX16441.1|3240437_3240623_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16442.1|3240866_3241190_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
QAX16443.1|3241182_3241575_+	amino acid-binding protein	NA	NA	NA	NA	NA
QAX16444.1|3241571_3242285_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
QAX16445.1|3242557_3242725_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.6e-20
QAX16446.1|3243826_3244891_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	32.2	9.4e-15
QAX16447.1|3245315_3246752_-|tail	phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	54.5	8.3e-99
QAX16448.1|3246820_3258154_-	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	50.9	0.0e+00
3252439:3252454	attL	TGCCCTGCTGCGTCAC	NA	NA	NA	NA
QAX16449.1|3258216_3258810_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	2.2e-85
QAX16450.1|3258826_3259654_-	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	44.7	4.8e-06
QAX16451.1|3259700_3260411_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	88.9	3.3e-133
QAX16452.1|3260412_3261168_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	3.0e-124
QAX16453.1|3261164_3261503_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
QAX16454.1|3261502_3264859_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	86.6	0.0e+00
QAX16455.1|3264858_3265071_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
QAX16456.1|3265091_3265457_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
QAX16457.1|3265514_3265976_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	1.0e-66
QAX16458.1|3266007_3266409_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
QAX16459.1|3266405_3266795_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
QAX16460.1|3266775_3267114_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
QAX16461.1|3267110_3267428_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
QAX16462.1|3267408_3267681_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	65.1	2.0e-22
QAX16463.1|3267739_3269026_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.5	1.3e-215
QAX16464.1|3269103_3270024_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.1e-148
QAX16465.1|3270060_3271320_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	6.2e-223
QAX16466.1|3271319_3271499_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
QAX16467.1|3271492_3273214_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
QAX16468.1|3273213_3273648_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
QAX16469.1|3273897_3274329_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.8e-41
QAX16470.1|3274325_3274643_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16471.1|3274594_3274957_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
QAX16472.1|3275110_3275332_-	DNA gyrase subunit B	NA	NA	NA	NA	NA
QAX16473.1|3275438_3275627_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16474.1|3276706_3277057_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
QAX16475.1|3277053_3277551_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
QAX16476.1|3277550_3277766_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
QAX16477.1|3279189_3279792_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	2.4e-76
QAX16478.1|3279808_3280840_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	3.6e-96
QAX16479.1|3280839_3281043_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16480.1|3281039_3281432_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	35.6	1.0e-11
QAX16481.1|3281472_3281763_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	60.9	1.8e-16
QAX16482.1|3281774_3282008_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
QAX16483.1|3282444_3283119_-	HNH endonuclease	NA	NA	NA	NA	NA
QAX16484.1|3283111_3284635_-	ATP-binding protein	NA	NA	NA	NA	NA
QAX16485.1|3284938_3285541_-|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	32.1	4.1e-07
QAX16486.1|3285736_3287506_+	Overcoming lysogenization defect protein	NA	NA	NA	NA	NA
QAX16487.1|3287710_3288151_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16488.1|3288164_3288629_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	71.5	9.0e-63
QAX16489.1|3288621_3289605_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	2.5e-46
QAX16490.1|3289656_3290211_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16491.1|3290213_3290429_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
QAX16492.1|3290530_3290920_+	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
QAX16493.1|3291266_3291581_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16494.1|3291743_3291962_+	hypothetical protein	NA	NA	NA	NA	NA
QAX16495.1|3291971_3292166_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
QAX16496.1|3292208_3292553_+	transcriptional regulator	NA	NA	NA	NA	NA
QAX16497.1|3292694_3294833_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.3	3.3e-99
QAX16498.1|3294885_3295131_+	excisionase	NA	NA	NA	NA	NA
QAX16499.1|3295111_3296239_+|integrase	integrase	integrase	O21925	Phage_21	58.4	3.3e-119
QAX16500.1|3296355_3297606_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
QAX16501.1|3297846_3298497_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
QAX16502.1|3298513_3298972_+	NUDIX hydrolase	NA	NA	NA	NA	NA
QAX18456.1|3299028_3300135_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3303821:3303836	attR	TGCCCTGCTGCGTCAC	NA	NA	NA	NA
>prophage 6
CP026162	Klebsiella pneumoniae strain F13 chromosome, complete genome	5371994	3528932	3538395	5371994	tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
QAX16703.1|3528932_3530654_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.2e-14
QAX16704.1|3530698_3531400_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
QAX16705.1|3531753_3531972_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
QAX16706.1|3532091_3534371_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
QAX16707.1|3534401_3534719_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
QAX16708.1|3535044_3535266_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
QAX16709.1|3535199_3535403_-	hypothetical protein	NA	NA	NA	NA	NA
QAX16710.1|3535342_3537283_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
QAX16711.1|3537279_3538395_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
