The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	153683	258555	4235113	integrase,tail,portal,tRNA,holin,terminase,capsid,plate,transposase	Bacillus_phage(36.17%)	111	166679:166738	220501:220606
QAW48403.1|153683_154427_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
QAW48404.1|154586_155024_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
QAW48405.1|155044_155437_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
QAW48406.1|155574_156342_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QAW52147.1|156355_156829_-	damage-inducible protein DinB	NA	NA	NA	NA	NA
QAW48407.1|156959_157403_+	DUF2521 family protein	NA	NA	NA	NA	NA
QAW48408.1|157463_158177_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	NA	NA	NA	NA
QAW48409.1|158256_159309_+	ATP-binding protein	NA	NA	NA	NA	NA
QAW48410.1|160007_160604_+	KinB-signaling pathway activation protein	NA	NA	NA	NA	NA
QAW48411.1|160604_161369_-	polysaccharide deacetylase family sporulation protein PdaB	NA	NA	NA	NA	NA
166679:166738	attL	CTTCCATGGTAAGGAAGAGGTCAGCGGTTCGAGCCCGCTTGGAAGCTTATCTAAATACGT	NA	NA	NA	NA
QAW48412.1|166901_168116_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	39.7	1.9e-72
QAW48413.1|168102_168633_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	48.4	1.6e-34
QAW48414.1|168712_169321_-	hypothetical protein	NA	O64079	Bacillus_phage	69.4	4.8e-56
QAW48415.1|169552_169879_-	XRE family transcriptional regulator	NA	O64078	Bacillus_phage	46.7	2.6e-16
QAW48416.1|170038_170272_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAW48417.1|170339_170534_+	DNA-binding protein	NA	NA	NA	NA	NA
QAW48418.1|170628_170886_+	XRE family transcriptional regulator	NA	S5MNZ7	Brevibacillus_phage	57.0	1.1e-17
QAW48419.1|170887_171166_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48420.1|171491_171686_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48421.1|171798_171984_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48422.1|171980_173969_+	hypothetical protein	NA	A0A1L2K2K3	Aeribacillus_phage	48.2	2.5e-154
QAW48423.1|173965_174217_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48424.1|174209_174950_+	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	59.8	3.9e-68
QAW48425.1|174946_175648_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	67.0	7.0e-91
QAW48426.1|175848_176604_+	hypothetical protein	NA	U5Q085	Bacillus_phage	31.3	1.2e-11
QAW48427.1|176609_176891_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48428.1|176865_178164_+	replicative DNA helicase	NA	Q38152	Bacillus_phage	44.7	7.3e-94
QAW48429.1|178178_178361_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
QAW48430.1|178457_178916_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	66.9	9.2e-52
QAW48431.1|178885_179578_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48432.1|179885_180146_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	60.8	2.9e-18
QAW48433.1|180126_180405_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
QAW48434.1|180476_180680_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48435.1|180718_180940_+	hypothetical protein	NA	A0A0M3ULE9	Bacillus_phage	40.3	6.9e-05
QAW48436.1|181268_181571_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48437.1|181545_181785_+	hypothetical protein	NA	NA	NA	NA	NA
QAW52148.1|181798_182233_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	69.3	2.6e-48
QAW48438.1|182334_182721_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	58.9	1.3e-30
QAW48439.1|182629_182836_-	hypothetical protein	NA	NA	NA	NA	NA
QAW48440.1|183479_183824_+	structural protein	NA	Q38579	Bacillus_phage	59.6	6.3e-29
QAW48441.1|183896_184373_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48442.1|184428_185700_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	43.7	3.7e-90
QAW48443.1|185833_186082_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48444.1|186174_187212_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48445.1|187245_188127_+|terminase	terminase	terminase	D2J000	Enterococcus_phage	42.5	2.8e-36
QAW48446.1|188126_189473_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	62.7	3.8e-154
QAW48447.1|189438_190983_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.2	4.9e-145
QAW48448.1|190966_191884_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	38.5	7.8e-50
QAW48449.1|191926_192550_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48450.1|192613_193801_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	52.8	1.0e-81
QAW48451.1|193830_194766_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.4	1.0e-105
QAW48452.1|194777_195128_+	hypothetical protein	NA	NA	NA	NA	NA
QAW52149.1|195133_195526_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	38.5	2.7e-12
QAW48453.1|195522_195885_+	DUF3599 family protein	NA	NA	NA	NA	NA
QAW48454.1|195881_196385_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	1.1e-37
QAW48455.1|196398_196836_+|portal	phage portal protein	portal	NA	NA	NA	NA
QAW48456.1|196832_197024_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48457.1|197024_198425_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	40.7	6.5e-80
QAW48458.1|198426_198870_+|portal	phage portal protein	portal	A0A0A7RVP1	Clostridium_phage	46.5	7.6e-27
QAW48459.1|199256_199361_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
QAW48460.1|199890_199980_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
QAW48461.1|200132_200582_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.2	2.0e-11
QAW48462.1|200797_206104_+	hypothetical protein	NA	A0A1L2JY60	Aeribacillus_phage	44.4	3.1e-42
QAW48463.1|206096_206756_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	49.1	4.5e-07
QAW48464.1|206769_207750_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.0	1.2e-40
QAW48465.1|207746_208013_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
QAW48466.1|208026_208452_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	37.3	6.6e-12
QAW48467.1|208444_209491_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.6	9.1e-71
QAW48468.1|209474_210053_+	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	1.3e-13
QAW48469.1|210049_210322_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48470.1|210324_211422_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	53.5	3.1e-13
QAW48471.1|211433_211772_+|portal	phage portal protein	portal	NA	NA	NA	NA
QAW48472.1|211768_211933_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	58.5	1.5e-12
QAW48473.1|212028_212931_+|portal	phage portal protein	portal	NA	NA	NA	NA
QAW48474.1|213001_213280_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	70.7	1.5e-28
QAW48475.1|213292_213556_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	70.1	6.5e-26
QAW48476.1|213611_214583_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.1	1.5e-64
QAW48477.1|214620_215061_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
QAW48478.1|215073_216894_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	43.0	9.5e-108
QAW48479.1|217401_217935_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48480.1|217959_218139_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48481.1|218275_219403_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	48.3	1.2e-89
QAW48482.1|219580_219769_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	61.3	1.3e-15
QAW48483.1|219876_220104_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48484.1|220096_220306_+	transcriptional regulator	NA	NA	NA	NA	NA
QAW48485.1|226387_227602_-	MFS transporter	NA	NA	NA	NA	NA
220501:220606	attR	CTTCCATGGTAAGGAAGAGGTCAGCGGTTCGAGCCCGCTTGGAAGCTTATCTAAATACGTTGATCTGAAGCAGTTTCCGCGCGTTATGGAACTGTTATTTTTTTGT	NA	NA	NA	NA
QAW48486.1|227827_229096_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.5	2.1e-21
QAW48487.1|229092_230043_+	hypothetical protein	NA	NA	NA	NA	NA
QAW48488.1|230017_231064_+	alcohol dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	27.6	3.9e-13
QAW48489.1|231297_232731_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	2.0e-137
QAW52150.1|232881_233823_+	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
QAW48490.1|233811_234564_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
QAW52151.1|234560_235571_-	iron ABC transporter permease	NA	NA	NA	NA	NA
QAW48491.1|235572_236580_-	iron ABC transporter permease	NA	NA	NA	NA	NA
QAW48492.1|236599_237556_-	iron-uptake system-binding protein	NA	NA	NA	NA	NA
QAW48493.1|237646_239239_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAW48494.1|239376_240621_-	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
QAW48495.1|240636_242550_-	hypothetical protein	NA	NA	NA	NA	NA
QAW48496.1|242596_243880_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	22.1	4.8e-05
QAW48497.1|243898_245266_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QAW48498.1|245394_246324_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
QAW48499.1|246423_246900_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAW48500.1|246918_247371_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
QAW48501.1|248189_248753_+	RNA polymerase sigma factor SigW	NA	NA	NA	NA	NA
QAW48502.1|248766_249393_+	anti-sigma-W factor RsiW	NA	NA	NA	NA	NA
QAW48503.1|249559_250381_+	TIGR00159 family protein	NA	NA	NA	NA	NA
QAW48504.1|250373_251813_+	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
QAW48505.1|251830_253177_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
QAW48506.1|253608_255411_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.4	8.3e-104
QAW48507.1|255562_256402_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
QAW48508.1|256398_258555_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	725060	734951	4235113		Synechococcus_phage(50.0%)	9	NA	NA
QAW48925.1|725060_726353_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
QAW48926.1|726428_727148_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	44.7	1.3e-47
QAW48927.1|727147_727402_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	34.6	2.1e-05
QAW48928.1|727398_728082_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
QAW48929.1|728065_730294_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	7.2e-158
QAW48930.1|730269_731700_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
QAW48931.1|731791_732832_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	6.3e-64
QAW48932.1|732828_733416_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
QAW48933.1|733412_734951_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	1.9e-77
>prophage 3
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	1192466	1240424	4235113	tRNA,transposase,coat	Planktothrix_phage(20.0%)	53	NA	NA
QAW49339.1|1192466_1193616_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
QAW49340.1|1193732_1193912_+	YjzC family protein	NA	NA	NA	NA	NA
QAW49341.1|1193948_1194134_-	DUF2929 family protein	NA	NA	NA	NA	NA
QAW49342.1|1194150_1194396_-	hypothetical protein	NA	NA	NA	NA	NA
QAW49343.1|1195212_1195779_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49344.1|1195869_1196823_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAW49345.1|1196835_1197027_+	competence protein ComG	NA	NA	NA	NA	NA
QAW49346.1|1197055_1197274_-	hypothetical protein	NA	NA	NA	NA	NA
QAW49347.1|1197441_1198380_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
QAW49348.1|1198401_1199640_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
QAW49349.1|1199723_1200509_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49350.1|1200682_1201669_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	6.0e-24
QAW49351.1|1201665_1202655_+	dipeptide ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	24.6	5.7e-06
QAW49352.1|1202732_1204361_+	peptide-binding protein	NA	NA	NA	NA	NA
QAW49353.1|1204427_1205378_+	ABC transporter permease	NA	NA	NA	NA	NA
QAW49354.1|1205399_1206314_+	ABC transporter permease	NA	NA	NA	NA	NA
QAW49355.1|1206462_1207215_+	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	1.9e-49
QAW49356.1|1207247_1208240_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
QAW49357.1|1208983_1210618_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAW49358.1|1210724_1211660_+	ABC transporter permease	NA	NA	NA	NA	NA
QAW49359.1|1211663_1212581_+	ABC transporter permease	NA	NA	NA	NA	NA
QAW49360.1|1212593_1213670_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
QAW49361.1|1213662_1214580_+	ATP-binding cassette domain-containing protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
QAW49362.1|1214686_1215874_+	GTP-binding protein	NA	NA	NA	NA	NA
QAW49363.1|1215991_1216570_+	N-acetyltransferase	NA	NA	NA	NA	NA
QAW49364.1|1216748_1217144_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
QAW49365.1|1217199_1217856_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	41.9	2.2e-30
QAW49366.1|1218131_1218788_+	adaptor protein MecA	NA	NA	NA	NA	NA
QAW49367.1|1218939_1220100_+	competence protein CoiA	NA	NA	NA	NA	NA
QAW52204.1|1220327_1222157_+	oligoendopeptidase F	NA	NA	NA	NA	NA
QAW49368.1|1222647_1223550_-	DsbA family protein	NA	NA	NA	NA	NA
QAW49369.1|1223546_1223945_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
QAW49370.1|1224173_1224860_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.8e-38
QAW49371.1|1224864_1225437_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
QAW49372.1|1225561_1225927_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49373.1|1225954_1226590_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
QAW49374.1|1226607_1227408_+	NAD kinase	NA	NA	NA	NA	NA
QAW49375.1|1227422_1228316_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.4e-06
QAW49376.1|1228348_1229098_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
QAW49377.1|1229324_1231169_+	sodium:proton antiporter	NA	NA	NA	NA	NA
QAW52205.1|1231418_1232126_+	thiaminase II	NA	NA	NA	NA	NA
QAW49378.1|1232103_1232721_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
QAW49379.1|1232704_1233814_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
QAW49380.1|1233810_1234014_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
QAW49381.1|1234010_1234781_+	thiazole synthase	NA	NA	NA	NA	NA
QAW49382.1|1234777_1235788_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
QAW49383.1|1235810_1236623_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
QAW49384.1|1236753_1237530_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
QAW49385.1|1237627_1238236_+|coat	spore coat protein	coat	NA	NA	NA	NA
QAW49386.1|1238294_1238738_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAW49387.1|1238883_1239366_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAW49388.1|1239516_1240017_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAW49389.1|1240109_1240424_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	1252694	1264268	4235113	integrase	Bacillus_phage(50.0%)	15	1246560:1246575	1268122:1268137
1246560:1246575	attL	ACCGATGACATAATCG	NA	NA	NA	NA
QAW49405.1|1252694_1253741_+|integrase	integrase	integrase	Q938N9	Temperate_phage	27.0	6.4e-08
QAW49406.1|1253887_1254835_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49407.1|1254831_1255251_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	1.6e-34
QAW49408.1|1255637_1255961_+	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	38.9	2.6e-08
QAW49409.1|1256208_1256571_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	37.9	1.9e-12
QAW49410.1|1256567_1256918_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49411.1|1257999_1258203_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49412.1|1258220_1258400_+	hypothetical protein	NA	A0A1P8CX65	Bacillus_phage	68.8	2.8e-12
QAW49413.1|1258392_1259172_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	55.6	3.7e-77
QAW49414.1|1259168_1259678_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49415.1|1259764_1260091_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49416.1|1260105_1261500_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.9	4.4e-129
QAW49417.1|1261634_1262630_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.2	4.6e-72
QAW49418.1|1262646_1262892_-	XRE family transcriptional regulator	NA	O64102	Bacillus_phage	42.6	1.7e-07
QAW49419.1|1263041_1264268_+	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	38.0	1.9e-67
1268122:1268137	attR	ACCGATGACATAATCG	NA	NA	NA	NA
>prophage 5
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	1267461	1351069	4235113	integrase,tail,portal,holin,coat,protease,capsid,transposase	Bacillus_phage(52.54%)	93	1305227:1305242	1342654:1342669
QAW49424.1|1267461_1268724_+	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	30.2	1.5e-22
QAW49425.1|1269088_1271374_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.5	3.2e-121
QAW49426.1|1271374_1271671_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49427.1|1271667_1272729_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.4	2.1e-78
QAW49428.1|1272882_1273446_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49429.1|1273446_1273644_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49430.1|1273643_1274054_+	hypothetical protein	NA	A0A0K2D038	Bacillus_phage	29.5	1.1e-06
QAW49431.1|1274059_1274305_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49432.1|1274301_1274487_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49433.1|1274491_1274845_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	55.6	1.3e-29
QAW49434.1|1275033_1277133_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	79.3	0.0e+00
QAW52207.1|1277312_1278278_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.1	4.8e-143
QAW49435.1|1278500_1279049_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	53.8	5.0e-44
QAW49436.1|1279048_1279270_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	86.3	1.3e-30
QAW52208.1|1279285_1280056_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	67.0	5.7e-86
QAW49437.1|1280025_1280634_+	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	59.8	1.4e-26
QAW49438.1|1280649_1281495_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	53.4	3.1e-37
QAW49439.1|1281592_1282168_+	dephospho-CoA kinase	NA	J9Q953	Bacillus_phage	43.4	2.4e-36
QAW49440.1|1282150_1282543_-	hypothetical protein	NA	NA	NA	NA	NA
QAW49441.1|1282659_1283838_+	hypothetical protein	NA	A0A0N9ST12	Paenibacillus_phage	65.1	4.4e-146
QAW49442.1|1284254_1284740_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	43.5	1.1e-13
QAW49443.1|1284827_1285628_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	55.0	1.4e-71
QAW49444.1|1285954_1286767_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	61.0	9.8e-97
QAW49445.1|1286858_1287215_-	hypothetical protein	NA	NA	NA	NA	NA
QAW49446.1|1287229_1287409_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
QAW49447.1|1287539_1287977_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	68.1	1.7e-50
QAW49448.1|1287990_1288728_-	DUF2786 domain-containing protein	NA	A0A1U9WR73	Streptococcus_virus	34.8	1.3e-23
QAW49449.1|1288833_1289034_-	hypothetical protein	NA	NA	NA	NA	NA
QAW49450.1|1289501_1289732_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAW49451.1|1290944_1291226_+	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	57.5	7.5e-20
QAW49452.1|1291831_1292065_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49453.1|1292078_1292774_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49454.1|1292800_1293055_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49455.1|1293259_1293808_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	2.4e-38
QAW49456.1|1293890_1295645_+	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	71.4	5.7e-251
QAW49457.1|1295661_1296093_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	6.5e-31
QAW49458.1|1296095_1297727_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	56.2	1.3e-164
QAW49459.1|1297726_1298551_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.4	1.5e-73
QAW49460.1|1298641_1299313_+|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	50.0	5.8e-18
QAW49461.1|1299324_1300428_+	hypothetical protein	NA	A0A2I7S650	Vibrio_phage	27.6	2.2e-30
QAW49462.1|1300478_1300715_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49463.1|1300717_1300936_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49464.1|1300949_1301336_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	4.6e-20
QAW52209.1|1301351_1301672_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49465.1|1301668_1302076_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	3.0e-30
QAW49466.1|1302082_1302472_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49467.1|1302496_1303051_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
QAW49468.1|1303108_1303480_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49469.1|1303575_1303812_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49470.1|1303812_1306614_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	38.0	7.3e-99
1305227:1305242	attL	ATAAACTTCAAAATAA	NA	NA	NA	NA
QAW49471.1|1306617_1308042_+|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	43.6	4.0e-61
QAW49472.1|1308053_1309454_+	endopeptidase	NA	A6M966	Geobacillus_virus	32.3	2.8e-38
QAW49473.1|1309468_1312033_+	peptidase G2	NA	D6R401	Bacillus_phage	92.7	0.0e+00
QAW49474.1|1312049_1313327_+	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	82.4	6.2e-154
QAW49475.1|1313323_1313686_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.8	7.1e-55
QAW49476.1|1313682_1313871_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	100.0	3.7e-31
QAW49477.1|1313922_1314345_+|holin	holin family protein	holin	D6R405	Bacillus_phage	100.0	4.7e-66
QAW49478.1|1314392_1315295_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	92.7	5.7e-162
QAW49479.1|1315315_1315573_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	6.6e-23
QAW49480.1|1315665_1316226_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49481.1|1316241_1316577_-	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	4.4e-11
QAW49482.1|1316652_1316904_-	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	50.8	2.8e-10
QAW49483.1|1316923_1317130_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAW49484.1|1317304_1318090_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.8	4.8e-16
QAW49485.1|1318355_1319486_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	36.8	4.5e-55
QAW49486.1|1319507_1320170_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAW49487.1|1320373_1320598_+	DNA-binding protein	NA	NA	NA	NA	NA
QAW49488.1|1320787_1321750_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49489.1|1322021_1322939_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	89.9	6.6e-142
QAW49490.1|1322940_1323123_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49491.1|1323661_1324174_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49492.1|1324183_1325239_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49493.1|1325555_1328459_+	hypothetical protein	NA	O64076	Bacillus_phage	46.9	3.2e-222
QAW49494.1|1328786_1329005_+	transcriptional regulator	NA	NA	NA	NA	NA
QAW49495.1|1329592_1330069_+	hypothetical protein	NA	O64060	Bacillus_phage	45.5	1.7e-32
QAW49496.1|1330068_1330782_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	42.4	7.4e-48
QAW49497.1|1330805_1331591_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	49.0	5.0e-37
QAW49498.1|1331599_1332187_+	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	47.8	1.3e-37
QAW49499.1|1332186_1332414_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49500.1|1332448_1332922_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	38.7	6.5e-24
QAW49501.1|1333339_1333522_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49502.1|1333514_1333727_+	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	51.6	4.5e-09
QAW49503.1|1333810_1334218_+|transposase	transposase	transposase	NA	NA	NA	NA
QAW49504.1|1334234_1334798_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	50.5	3.7e-42
QAW49505.1|1335150_1336905_+	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	46.9	3.8e-146
QAW49506.1|1336919_1338254_+|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	31.1	2.3e-42
QAW49507.1|1338361_1338961_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	44.5	4.0e-31
QAW49508.1|1338989_1339808_+|coat	P22 coat protein - protein 5 domain protein	coat	E5DV53	Deep-sea_thermophilic_phage	43.3	3.8e-56
QAW49509.1|1340015_1340333_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49510.1|1340343_1340682_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49511.1|1348214_1348676_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
1342654:1342669	attR	ATAAACTTCAAAATAA	NA	NA	NA	NA
QAW49512.1|1348991_1349723_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49513.1|1349821_1351069_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 6
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	1382173	1433969	4235113	portal,holin,terminase,coat,transposase	Bacillus_phage(47.83%)	51	NA	NA
QAW49546.1|1382173_1382356_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAW49547.1|1382469_1382643_-	putative motility protein	NA	NA	NA	NA	NA
QAW49548.1|1382656_1383088_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
QAW49549.1|1383186_1383756_-	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
QAW49550.1|1383880_1386838_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
QAW49551.1|1386830_1387373_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
QAW49552.1|1387580_1388801_+	cytochrome P450	NA	NA	NA	NA	NA
QAW49553.1|1390024_1390210_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	75.9	2.6e-21
QAW49554.1|1390385_1391204_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
QAW49555.1|1391229_1391991_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
QAW49556.1|1391992_1392730_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	35.3	1.8e-17
QAW49557.1|1392756_1393740_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
QAW49558.1|1393869_1394367_+	cupin domain-containing protein	NA	NA	NA	NA	NA
QAW49559.1|1394754_1395171_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
QAW49560.1|1395210_1396389_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
QAW49561.1|1399444_1400443_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
QAW49562.1|1400518_1401964_+	tagaturonate reductase	NA	NA	NA	NA	NA
QAW49563.1|1401960_1403454_+	altronate dehydratase	NA	NA	NA	NA	NA
QAW49564.1|1403637_1404309_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.1	2.4e-24
QAW49565.1|1404305_1405664_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.6	3.5e-14
QAW49566.1|1405783_1406719_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.4	1.8e-41
QAW49567.1|1406699_1407431_+	ABC transporter permease	NA	NA	NA	NA	NA
QAW49568.1|1407448_1407640_+	Mas-related G-protein coupled receptor member D	NA	NA	NA	NA	NA
QAW49569.1|1407705_1408956_+	sensor histidine kinase	NA	NA	NA	NA	NA
QAW49570.1|1408967_1409633_+	response regulator transcription factor	NA	NA	NA	NA	NA
QAW49571.1|1409825_1410008_+	plantaricin C family lantibiotic	NA	NA	NA	NA	NA
QAW49572.1|1413283_1415431_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.6	2.4e-33
QAW49573.1|1416115_1419001_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
QAW49574.1|1419129_1420279_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.9	2.7e-39
QAW49575.1|1420336_1421101_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
QAW49576.1|1421249_1421717_-	hypothetical protein	NA	NA	NA	NA	NA
QAW49577.1|1421921_1423058_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
QAW49578.1|1423324_1424278_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	2.4e-62
QAW49579.1|1424315_1424693_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	2.0e-15
QAW49580.1|1424802_1425408_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	6.1e-43
QAW49581.1|1425562_1426153_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
QAW49582.1|1426300_1426639_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
QAW49583.1|1426829_1427009_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49584.1|1426998_1427826_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	1.7e-19
QAW49585.1|1427725_1428526_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.9	2.3e-58
QAW49586.1|1428790_1429132_+|portal	phage portal protein	portal	NA	NA	NA	NA
QAW49587.1|1429121_1429325_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
QAW49588.1|1429431_1429944_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	2.9e-22
QAW49589.1|1430056_1430716_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	31.7	3.4e-07
QAW49590.1|1430613_1431081_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	47.1	5.7e-33
QAW49591.1|1431093_1431465_+	hypothetical protein	NA	NA	NA	NA	NA
QAW49592.1|1431469_1431667_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
QAW49593.1|1431723_1432485_+|portal	phage portal protein	portal	NA	NA	NA	NA
QAW49594.1|1432536_1432800_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	65.5	2.1e-24
QAW49595.1|1432813_1433077_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
QAW49596.1|1433090_1433969_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 7
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	1971715	1977929	4235113		Bacillus_phage(50.0%)	7	NA	NA
QAW50038.1|1971715_1972108_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
QAW50039.1|1972067_1974170_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
QAW50040.1|1974187_1975177_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
QAW50041.1|1975225_1975843_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
QAW50042.1|1975895_1976654_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	3.1e-52
QAW50043.1|1976687_1976912_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50044.1|1976960_1977929_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 8
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	2404063	2410316	4235113		Staphylococcus_phage(66.67%)	10	NA	NA
QAW50416.1|2404063_2404657_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
QAW50417.1|2404646_2405402_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
QAW50418.1|2405609_2405699_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
QAW50419.1|2405786_2406308_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
QAW50420.1|2406252_2406468_+	hypothetical protein	NA	NA	NA	NA	NA
QAW50421.1|2406373_2406748_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
QAW50422.1|2406864_2407329_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
QAW50423.1|2407361_2408558_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
QAW50424.1|2408572_2409220_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	8.8e-40
QAW50425.1|2409200_2410316_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.2e-55
>prophage 9
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	2724180	2911618	4235113	integrase,tail,head,portal,tRNA,holin,terminase,coat,capsid,protease	Bacillus_phage(43.96%)	202	2745409:2745446	2786871:2786908
QAW50700.1|2724180_2724663_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
QAW50701.1|2724726_2725611_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QAW50702.1|2725735_2726944_+	MFS transporter	NA	NA	NA	NA	NA
QAW50703.1|2727093_2730255_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.3	3.7e-75
QAW50704.1|2730282_2730849_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAW50705.1|2731058_2731598_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QAW50706.1|2732098_2732239_-	YrzI family small protein	NA	NA	NA	NA	NA
QAW50707.1|2732293_2732542_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50708.1|2732628_2733429_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
QAW50709.1|2733696_2734065_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
QAW52254.1|2734371_2737314_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
QAW50710.1|2737331_2737823_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
QAW50711.1|2737861_2738092_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50712.1|2738175_2739318_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.6	7.3e-21
QAW50713.1|2739319_2740243_-	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	43.0	4.0e-62
QAW50714.1|2740290_2740986_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
QAW50715.1|2741006_2741648_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QAW50716.1|2741831_2742035_+	DUF2536 family protein	NA	NA	NA	NA	NA
QAW50717.1|2742074_2742791_-	DUF1510 family protein	NA	NA	NA	NA	NA
QAW50718.1|2742854_2744609_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
QAW50719.1|2744662_2745136_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
2745409:2745446	attL	TCAAGGATCGTTTGAATCTTCGTGACCATCAGATCAAT	NA	NA	NA	NA
QAW50720.1|2745820_2746435_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50721.1|2746421_2746853_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50722.1|2747299_2747932_+	hypothetical protein	NA	NA	NA	NA	NA
QAW50723.1|2747964_2748174_+	hypothetical protein	NA	NA	NA	NA	NA
QAW50724.1|2748349_2749009_+	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	31.9	7.9e-12
QAW50725.1|2749115_2750129_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	95.5	3.5e-184
QAW50726.1|2750177_2750600_-|holin	holin family protein	holin	D6R405	Bacillus_phage	98.5	3.3e-64
QAW50727.1|2750651_2750840_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	4.1e-30
QAW50728.1|2750836_2751199_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.8	2.1e-54
QAW50729.1|2751195_2752428_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	87.1	2.9e-148
QAW50730.1|2752440_2755005_-	peptidase G2	NA	D6R401	Bacillus_phage	57.5	5.4e-290
QAW50731.1|2755055_2756759_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.9	1.0e-180
QAW50732.1|2756773_2757613_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	8.0e-94
QAW50733.1|2757606_2762094_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.5	8.5e-65
QAW50734.1|2762299_2762668_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50735.1|2762726_2763341_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	1.1e-23
QAW50736.1|2763355_2763739_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
QAW50737.1|2763735_2764134_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50738.1|2764130_2764448_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
QAW50739.1|2764437_2764740_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	41.5	1.2e-10
QAW50740.1|2764757_2765183_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	52.4	1.0e-12
QAW50741.1|2765210_2766503_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.4	9.2e-89
QAW50742.1|2766540_2767167_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	8.7e-85
QAW50743.1|2767129_2768410_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.1	2.9e-151
QAW50744.1|2768598_2770308_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
QAW50745.1|2770304_2770820_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	9.8e-34
QAW52255.1|2770829_2771027_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50746.1|2771048_2771414_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	2.1e-30
QAW50747.1|2771403_2771772_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50748.1|2771819_2772134_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50749.1|2772130_2772412_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50750.1|2773217_2773760_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
QAW50751.1|2773756_2774209_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
QAW50752.1|2774509_2774944_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.1e-49
QAW50753.1|2774946_2775192_-	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
QAW50754.1|2775188_2775497_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50755.1|2775493_2775682_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50756.1|2775686_2775869_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	53.7	1.6e-10
QAW50757.1|2775884_2776112_-	hypothetical protein	NA	A0A217EQZ3	Bacillus_phage	63.5	2.0e-23
QAW50758.1|2776108_2776411_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50759.1|2776412_2777090_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.7	4.3e-37
QAW50760.1|2777086_2777410_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50761.1|2778533_2778791_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	1.6e-05
QAW50762.1|2779455_2779659_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
QAW50763.1|2779906_2780047_-	BH0509 family protein	NA	NA	NA	NA	NA
QAW50764.1|2780155_2780704_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
QAW52256.1|2781019_2781850_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	2.4e-34
QAW50765.1|2781833_2782712_-	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	48.7	1.2e-60
QAW50766.1|2782725_2783043_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50767.1|2783084_2783282_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAW50768.1|2783483_2783873_+	XRE family transcriptional regulator	NA	A0A0U4B088	Bacillus_phage	28.4	2.0e-07
QAW50769.1|2784228_2785326_-	XRE family transcriptional regulator	NA	A0A288WGM1	Bacillus_phage	23.0	4.7e-09
QAW50770.1|2785630_2786791_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.3	2.9e-65
QAW50771.1|2786854_2787487_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	3.2e-34
2786871:2786908	attR	TCAAGGATCGTTTGAATCTTCGTGACCATCAGATCAAT	NA	NA	NA	NA
QAW50772.1|2787493_2788762_-	U32 family peptidase	NA	Q6DW11	Phage_TP	32.1	7.3e-38
QAW50773.1|2788779_2789709_-	U32 family peptidase	NA	NA	NA	NA	NA
QAW50774.1|2789715_2790369_-	O-methyltransferase	NA	NA	NA	NA	NA
QAW50775.1|2790520_2791612_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
QAW50776.1|2791722_2792004_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
QAW50777.1|2792016_2792433_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
QAW50778.1|2792441_2792708_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
QAW50779.1|2792792_2795429_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	4.1e-67
QAW50780.1|2795760_2796822_-	AI-2E family transporter	NA	NA	NA	NA	NA
QAW50781.1|2797040_2797769_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	4.3e-35
QAW50782.1|2797789_2798617_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
QAW50783.1|2798673_2799324_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
QAW50784.1|2799342_2799999_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
QAW50785.1|2800034_2800166_-	DUF3918 domain-containing protein	NA	NA	NA	NA	NA
QAW50786.1|2800187_2800379_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50787.1|2800391_2800850_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50788.1|2800968_2803347_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.6	2.6e-81
QAW52257.1|2803365_2803986_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
QAW50789.1|2804073_2805189_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
QAW50790.1|2805225_2806365_-	cysteine desulfurase	NA	NA	NA	NA	NA
QAW50791.1|2806383_2806800_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
QAW50792.1|2806994_2808263_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.3	1.5e-112
QAW50793.1|2808377_2809142_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	33.5	2.2e-21
QAW50794.1|2809467_2811246_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	6.6e-13
QAW50795.1|2811260_2812535_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
QAW50796.1|2813192_2814755_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	1.2e-13
QAW50797.1|2814781_2815225_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
QAW50798.1|2815237_2817442_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
QAW50799.1|2817599_2818112_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
QAW50800.1|2818117_2820478_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.5	7.5e-89
QAW50801.1|2820533_2820860_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
QAW50802.1|2820923_2821421_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50803.1|2821551_2823774_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	2.0e-27
QAW50804.1|2823810_2824107_-	competence protein ComN	NA	NA	NA	NA	NA
QAW50805.1|2824222_2825779_+	stage V sporulation protein B	NA	NA	NA	NA	NA
QAW50806.1|2825786_2826443_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
QAW50807.1|2826609_2826996_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
QAW50808.1|2827049_2827310_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
QAW50809.1|2827340_2828486_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
QAW52258.1|2828513_2829542_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
QAW50810.1|2829567_2829768_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
QAW50811.1|2829760_2830765_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
QAW50812.1|2830775_2831381_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
QAW50813.1|2831515_2832025_-	signaling peptide protein	NA	NA	NA	NA	NA
QAW50814.1|2832157_2832397_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50815.1|2832409_2833003_-	sporulation protein	NA	NA	NA	NA	NA
QAW50816.1|2833150_2834356_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
QAW50817.1|2834482_2835586_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
QAW50818.1|2835587_2836436_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
QAW50819.1|2836417_2837983_-	L-aspartate oxidase	NA	NA	NA	NA	NA
QAW50820.1|2838089_2839241_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	29.6	2.3e-30
QAW50821.1|2839290_2839833_+	transcription repressor NadR	NA	NA	NA	NA	NA
QAW50822.1|2839858_2840716_-	prephenate dehydratase	NA	NA	NA	NA	NA
QAW50823.1|2840729_2841173_-	ACT domain-containing protein	NA	NA	NA	NA	NA
QAW50824.1|2841226_2842513_-	GTPase ObgE	NA	NA	NA	NA	NA
QAW50825.1|2842544_2843123_-	sporulation protein	NA	NA	NA	NA	NA
QAW50826.1|2843440_2843725_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
QAW50827.1|2843737_2844079_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
QAW50828.1|2844081_2844390_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
QAW50829.1|2844535_2845402_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
QAW50830.1|2845394_2846198_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
QAW50831.1|2846325_2847129_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
QAW50832.1|2847131_2847812_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
QAW50833.1|2847865_2848384_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
QAW50834.1|2848380_2849244_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
QAW50835.1|2849274_2850288_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
QAW52259.1|2850379_2850781_-	DNA repair protein RadC	NA	NA	NA	NA	NA
QAW50836.1|2850995_2851358_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50837.1|2851373_2851853_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50838.1|2852016_2853030_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	95.3	5.4e-185
QAW50839.1|2853078_2853501_-|holin	holin	holin	D6R405	Bacillus_phage	87.9	2.7e-58
QAW50840.1|2853552_2853741_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
QAW50841.1|2853737_2854100_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	89.1	5.1e-53
QAW50842.1|2854096_2855233_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	73.4	5.7e-143
QAW50843.1|2855245_2857810_-	peptidase G2	NA	D6R401	Bacillus_phage	57.1	2.9e-288
QAW50844.1|2857842_2859561_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.8	5.8e-224
QAW50845.1|2859573_2860410_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	69.0	1.4e-109
QAW50846.1|2860424_2864171_-	hypothetical protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	64.2	4.4e-107
QAW50847.1|2864233_2864416_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50848.1|2864427_2864790_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50849.1|2864847_2865426_-|tail	major tail protein	tail	J7KKC8	Streptococcus_phage	41.0	1.8e-31
QAW50850.1|2865444_2865834_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
QAW50851.1|2865830_2866220_-	HK97 gp10 family phage protein	NA	I7A9A4	Enterococcus_phage	36.7	2.6e-10
QAW50852.1|2866219_2866546_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
QAW50853.1|2866535_2866829_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	39.6	8.6e-11
QAW50854.1|2866879_2867329_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	62.0	1.6e-11
QAW50855.1|2867356_2868553_-|capsid	phage major capsid protein	capsid	A0A2H4J312	uncultured_Caudovirales_phage	49.7	2.2e-76
QAW50856.1|2868601_2869198_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	53.6	4.7e-48
QAW50857.1|2869190_2870417_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	5.5e-67
QAW50858.1|2870421_2870628_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50859.1|2870644_2872351_-|terminase	terminase large subunit	terminase	A0A2H4JC16	uncultured_Caudovirales_phage	42.4	2.4e-121
QAW50860.1|2872343_2872838_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	35.5	2.6e-20
QAW52260.1|2873086_2873482_-	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	45.8	2.3e-19
QAW50861.1|2873852_2874233_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	75.6	1.0e-43
QAW50862.1|2874229_2875585_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	66.1	5.3e-180
QAW50863.1|2875544_2875859_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	57.8	2.4e-19
QAW52261.1|2876141_2878556_-	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	56.0	5.8e-278
QAW50864.1|2878867_2880814_-	hypothetical protein	NA	S5M5X4	Brevibacillus_phage	66.9	1.1e-250
QAW50865.1|2880810_2881359_-	hypothetical protein	NA	Q38587	Bacillus_phage	62.8	4.8e-23
QAW50866.1|2881417_2881987_-	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	74.9	1.3e-76
QAW50867.1|2882042_2882387_-	hypothetical protein	NA	A0A2P0ZLA7	Lactobacillus_phage	50.0	5.7e-22
QAW50868.1|2882386_2883565_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	61.6	5.0e-134
QAW50869.1|2883561_2883957_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50870.1|2883969_2884371_-	hypothetical protein	NA	NA	NA	NA	NA
QAW50871.1|2884685_2884958_-	XRE family transcriptional regulator	NA	D6R414	Bacillus_phage	91.1	5.3e-39
QAW50872.1|2885210_2885645_+	XRE family transcriptional regulator	NA	Q786F1	Bacillus_phage	95.1	3.7e-66
QAW50873.1|2885658_2886105_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	95.9	5.6e-78
QAW50874.1|2886142_2887567_+	recombinase family protein	NA	Q9T200	Bacillus_phage	97.0	1.4e-263
QAW50875.1|2888018_2888588_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
QAW50876.1|2888728_2889730_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
QAW50877.1|2889856_2890609_-	prepilin peptidase	NA	NA	NA	NA	NA
QAW50878.1|2890749_2892042_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
QAW50879.1|2892100_2894743_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	3.7e-161
QAW50880.1|2895195_2895387_+	hypothetical protein	NA	NA	NA	NA	NA
QAW52262.1|2895401_2896424_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
QAW50881.1|2896457_2898341_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
QAW50882.1|2898473_2899763_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
QAW52263.1|2899791_2900766_-	porphobilinogen synthase	NA	NA	NA	NA	NA
QAW50883.1|2900771_2901551_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
QAW50884.1|2901540_2902482_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
QAW50885.1|2902516_2903347_-	cytochrome C assembly protein	NA	NA	NA	NA	NA
QAW52264.1|2903354_2904722_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
QAW50886.1|2904915_2905407_+	hypothetical protein	NA	NA	NA	NA	NA
QAW50887.1|2905439_2906027_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
QAW50888.1|2906023_2908348_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
QAW50889.1|2908546_2910205_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
QAW50890.1|2910355_2911618_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
>prophage 10
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	3474264	3511661	4235113	integrase,tail,head,portal,holin,terminase,protease,capsid	Bacillus_phage(80.95%)	54	3472732:3472756	3511733:3511757
3472732:3472756	attL	GTTATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
QAW51411.1|3474264_3475428_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	3.9e-70
QAW51412.1|3475474_3475897_-|holin	holin family protein	holin	D6R405	Bacillus_phage	98.5	2.3e-65
QAW51413.1|3475948_3476137_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	98.4	8.2e-31
QAW51414.1|3476133_3476496_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	91.7	4.9e-56
QAW51415.1|3476492_3477770_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	82.1	4.0e-153
QAW51416.1|3477786_3480348_-	peptidase G2	NA	D6R401	Bacillus_phage	97.3	0.0e+00
QAW51417.1|3480387_3482091_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	99.1	6.3e-312
QAW51418.1|3482102_3482942_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	93.5	1.7e-152
QAW51419.1|3482941_3486820_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	88.4	0.0e+00
QAW51420.1|3487020_3487359_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	91.1	6.8e-52
QAW51421.1|3487410_3488013_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	100.0	1.8e-111
QAW52292.1|3488013_3488394_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	94.4	1.4e-58
QAW51422.1|3488390_3488774_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	99.2	1.9e-66
QAW51423.1|3488766_3489126_-|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	96.6	1.0e-58
QAW51424.1|3489058_3489406_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	95.7	4.2e-57
QAW51425.1|3489420_3489831_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	67.4	1.2e-37
QAW51426.1|3489858_3490170_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	96.2	2.3e-46
QAW51427.1|3490181_3491375_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	99.5	4.6e-220
QAW51428.1|3491414_3492041_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	100.0	6.8e-114
QAW51429.1|3492030_3493281_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	98.3	7.7e-242
QAW51430.1|3493286_3493517_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.3	1.5e-21
QAW51431.1|3493528_3495238_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	96.7	0.0e+00
QAW51432.1|3495237_3495744_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	95.8	3.1e-85
QAW51433.1|3495830_3496157_-	transglycosylase	NA	Q9T203	Bacillus_phage	97.2	1.1e-54
QAW51434.1|3496125_3496500_-	HNH endonuclease	NA	Q38456	Bacillus_phage	93.5	1.7e-67
QAW51435.1|3496496_3496919_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51436.1|3496918_3497146_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51437.1|3497711_3498254_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.4	1.8e-54
QAW51438.1|3498250_3498703_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
QAW51439.1|3499003_3499438_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.1e-49
QAW51440.1|3499440_3499686_-	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
QAW51441.1|3499682_3499991_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51442.1|3499987_3500176_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51443.1|3500180_3500363_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	53.7	1.6e-10
QAW51444.1|3500378_3500606_-	hypothetical protein	NA	A0A217EQZ3	Bacillus_phage	63.5	2.0e-23
QAW51445.1|3500602_3500905_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51446.1|3500906_3501584_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.7	4.3e-37
QAW51447.1|3501580_3501904_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51448.1|3501985_3502825_-	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	56.8	5.1e-88
QAW51449.1|3502828_3503086_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	41.2	3.9e-07
QAW51450.1|3503082_3503490_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	43.5	4.7e-23
QAW51451.1|3503486_3503849_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51452.1|3503989_3504193_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.9	9.8e-14
QAW51453.1|3504440_3504581_-	BH0509 family protein	NA	NA	NA	NA	NA
QAW51454.1|3504689_3505238_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
QAW52293.1|3505553_3506384_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.6	8.4e-35
QAW51455.1|3506367_3507234_-	hypothetical protein	NA	D2XR43	Bacillus_phage	62.4	1.1e-50
QAW51456.1|3507226_3507457_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51457.1|3507474_3507798_-	DUF771 domain-containing protein	NA	A0A1B1IME6	Lactococcus_phage	38.0	5.6e-11
QAW51458.1|3507817_3508009_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.7	2.7e-13
QAW52294.1|3508044_3508248_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAW51459.1|3508410_3508809_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAW51460.1|3509235_3510336_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAW51461.1|3510596_3511661_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	65.3	3.6e-131
3511733:3511757	attR	GTTATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
>prophage 11
CP035410	Bacillus velezensis strain SRCM103616 chromosome, complete genome	4235113	3906856	3957301	4235113	lysis,holin,coat	Bacillus_phage(40.0%)	56	NA	NA
QAW51839.1|3906856_3907792_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	3.4e-24
QAW51840.1|3907793_3908492_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	3.2e-35
QAW51841.1|3908683_3909550_-	protein liaG	NA	NA	NA	NA	NA
QAW51842.1|3909570_3910275_-	ABC transporter permease	NA	NA	NA	NA	NA
QAW51843.1|3910339_3911266_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.4	1.9e-43
QAW52310.1|3911624_3912080_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAW51844.1|3912076_3912925_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	7.0e-37
QAW51845.1|3912945_3913893_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.6	2.3e-68
QAW51846.1|3913895_3914633_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
QAW51847.1|3914660_3915665_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAW51848.1|3916170_3917292_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAW51849.1|3917291_3918155_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAW51850.1|3918155_3919325_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
QAW51851.1|3919347_3920772_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
QAW51852.1|3920776_3921547_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.0	8.9e-07
QAW51853.1|3921827_3922328_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
QAW51854.1|3922374_3922746_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
QAW51855.1|3922809_3924129_-	purine permease	NA	NA	NA	NA	NA
QAW51856.1|3924147_3924570_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51857.1|3924628_3925312_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
QAW51858.1|3925327_3926134_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
QAW51859.1|3926219_3926747_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51860.1|3926791_3927427_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51861.1|3927419_3927758_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
QAW51862.1|3927907_3928720_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
QAW51863.1|3928750_3928990_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51864.1|3929089_3930529_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.3	5.4e-21
QAW51865.1|3930525_3931908_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
QAW51866.1|3932127_3932958_-	transcription antiterminator	NA	NA	NA	NA	NA
QAW51867.1|3932981_3933296_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51868.1|3933821_3936233_+	peptidase S8	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
QAW52311.1|3936274_3937276_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
QAW51869.1|3937439_3938189_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
QAW51870.1|3938291_3939479_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
QAW51871.1|3939680_3940142_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAW51872.1|3940433_3940694_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
QAW51873.1|3940737_3941106_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
QAW51874.1|3941107_3941722_-	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
QAW51875.1|3941736_3943686_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
QAW52312.1|3943713_3944679_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
QAW51876.1|3945181_3945427_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
QAW51877.1|3945443_3946985_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
QAW51878.1|3946974_3948159_-	galactokinase	NA	NA	NA	NA	NA
QAW52313.1|3948210_3948597_-	GtrA family protein	NA	NA	NA	NA	NA
QAW51879.1|3948676_3949327_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAW51880.1|3949634_3949796_+	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
QAW51881.1|3950013_3950694_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QAW51882.1|3950693_3951368_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
QAW51883.1|3951388_3951991_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
QAW51884.1|3952077_3953334_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
QAW51885.1|3953352_3953547_-	hypothetical protein	NA	NA	NA	NA	NA
QAW51886.1|3953748_3954423_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
QAW51887.1|3954419_3955238_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
QAW51888.1|3955240_3956149_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QAW51889.1|3956255_3956642_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
QAW51890.1|3956623_3957301_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
