The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	1207617	1241474	4110403	tRNA,coat	Planktothrix_phage(20.0%)	41	NA	NA
QAV87764.1|1207617_1208610_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
QAV87765.1|1209353_1210991_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAV87766.1|1211097_1212033_+	ABC transporter permease	NA	NA	NA	NA	NA
QAV87767.1|1212036_1212954_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
QAV87768.1|1212958_1214035_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
QAV87769.1|1214036_1214954_+	ATP-binding cassette domain-containing protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
QAV87770.1|1215060_1216278_+	MFS transporter	NA	NA	NA	NA	NA
QAV87771.1|1216441_1217020_+	N-acetyltransferase	NA	NA	NA	NA	NA
QAV87772.1|1217200_1217596_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
QAV87773.1|1217638_1218295_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
QAV87774.1|1218464_1218605_+	hypothetical protein	NA	NA	NA	NA	NA
QAV87775.1|1218571_1219228_+	adaptor protein MecA	NA	NA	NA	NA	NA
QAV87776.1|1219222_1219345_-	hypothetical protein	NA	NA	NA	NA	NA
QAV87777.1|1219388_1220540_+	competence protein CoiA	NA	NA	NA	NA	NA
QAV87778.1|1220586_1222599_+	oligoendopeptidase F	NA	NA	NA	NA	NA
QAV87779.1|1222636_1222804_-	hypothetical protein	NA	NA	NA	NA	NA
QAV87780.1|1222899_1223100_-	hypothetical protein	NA	NA	NA	NA	NA
QAV87781.1|1223118_1224018_-	DsbA family protein	NA	NA	NA	NA	NA
QAV87782.1|1224014_1224413_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
QAV90679.1|1224667_1225213_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	73.7	5.1e-41
QAV87783.1|1225416_1225989_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
QAV87784.1|1226113_1226482_+	hypothetical protein	NA	NA	NA	NA	NA
QAV87785.1|1226510_1227146_+	GTP pyrophosphokinase YjbM	NA	NA	NA	NA	NA
QAV87786.1|1227164_1227965_+	NAD(+) kinase	NA	NA	NA	NA	NA
QAV90680.1|1228027_1228879_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
QAV87787.1|1228891_1229626_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A8E2N0	Enterococcus_phage	24.8	7.2e-06
QAV87788.1|1229860_1231705_+	sodium:proton antiporter	NA	NA	NA	NA	NA
QAV87789.1|1231953_1232664_+	thiaminase II	NA	NA	NA	NA	NA
QAV87790.1|1232638_1233256_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
QAV87791.1|1233239_1234349_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
QAV90681.1|1234348_1234549_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
QAV87792.1|1234545_1235316_+	thiazole synthase	NA	NA	NA	NA	NA
QAV87793.1|1235312_1236323_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
QAV87794.1|1236341_1237157_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
QAV87795.1|1237292_1238069_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
QAV87796.1|1238169_1238853_+|coat	spore coat protein	coat	NA	NA	NA	NA
QAV87797.1|1238946_1239393_-|coat	spore coat protein Z	coat	NA	NA	NA	NA
QAV87798.1|1239520_1240009_-|coat	spore coat protein Y	coat	NA	NA	NA	NA
QAV87799.1|1240160_1240643_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAV87800.1|1240727_1241048_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAV87801.1|1241087_1241474_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 2
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	1284865	1367396	4110403	terminase,coat,protease,portal,plate,tail,tRNA,holin	Bacillus_phage(25.0%)	95	NA	NA
QAV87840.1|1284865_1285345_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
QAV87841.1|1285371_1285578_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
QAV87842.1|1285709_1286039_-	DUF4306 domain-containing protein	NA	NA	NA	NA	NA
QAV87843.1|1286446_1286641_+	hypothetical protein	NA	NA	NA	NA	NA
QAV87844.1|1286659_1287649_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
QAV87845.1|1287771_1288008_-|coat	spore coat protein CotT	coat	NA	NA	NA	NA
QAV87846.1|1288261_1289665_+	DUF4163 domain-containing protein	NA	NA	NA	NA	NA
QAV87847.1|1289704_1290178_-	DUF2690 domain-containing protein	NA	NA	NA	NA	NA
QAV87848.1|1290302_1290470_-	putative motility protein	NA	NA	NA	NA	NA
QAV87849.1|1290596_1291496_+	hypothetical protein	NA	NA	NA	NA	NA
QAV87850.1|1291505_1291904_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
QAV87851.1|1292004_1292580_-	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
QAV87852.1|1292725_1295683_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
QAV87853.1|1295675_1296236_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
QAV87854.1|1296432_1297074_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
QAV87855.1|1297152_1297779_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
QAV87856.1|1297809_1298088_-	hypothetical protein	NA	NA	NA	NA	NA
QAV87857.1|1298478_1299669_+	cytochrome P450	NA	NA	NA	NA	NA
QAV87858.1|1299691_1300870_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.3	5.6e-08
QAV87859.1|1300910_1301099_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	75.4	1.5e-21
QAV87860.1|1301272_1302085_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
QAV87861.1|1302129_1302882_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
QAV87862.1|1302881_1303634_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.4	5.5e-17
QAV87863.1|1303753_1304728_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
QAV87864.1|1304859_1305357_+	cupin domain-containing protein	NA	NA	NA	NA	NA
QAV87865.1|1305745_1306168_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
QAV87866.1|1306207_1307386_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
QAV87867.1|1307582_1309004_+	glucuronate isomerase	NA	NA	NA	NA	NA
QAV87868.1|1309071_1310451_+	MFS transporter	NA	NA	NA	NA	NA
QAV87869.1|1310555_1311569_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
QAV87870.1|1311574_1312594_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
QAV87871.1|1312618_1313698_+	mannonate dehydratase	NA	NA	NA	NA	NA
QAV87872.1|1313694_1314531_+	SDR family NAD(P)-dependent oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
QAV87873.1|1314578_1315847_+	MFS transporter	NA	NA	NA	NA	NA
QAV87874.1|1315934_1316936_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
QAV87875.1|1317010_1318453_+	tagaturonate reductase	NA	NA	NA	NA	NA
QAV87876.1|1318449_1319943_+	altronate dehydratase	NA	NA	NA	NA	NA
QAV87877.1|1319981_1320746_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
QAV87878.1|1320964_1321429_-	hypothetical protein	NA	NA	NA	NA	NA
QAV87879.1|1321577_1322849_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
QAV87880.1|1322994_1324131_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
QAV87881.1|1324120_1324255_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
QAV87882.1|1324284_1324542_-	hypothetical protein	NA	NA	NA	NA	NA
QAV87883.1|1324662_1325616_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.5	1.6e-66
QAV87884.1|1325654_1326032_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	43.3	1.4e-16
QAV87885.1|1326136_1326739_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	49.2	2.2e-45
QAV87886.1|1326815_1327652_+	manganese catalase family protein	NA	NA	NA	NA	NA
QAV87887.1|1327695_1328292_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	6.2e-40
QAV87888.1|1328454_1328796_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.6	4.5e-19
QAV87889.1|1328974_1329154_+	hypothetical protein	NA	NA	NA	NA	NA
QAV87890.1|1329140_1329977_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	46.4	3.0e-24
QAV87891.1|1329876_1330677_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	1.1e-60
QAV87892.1|1330676_1330844_+	hypothetical protein	NA	NA	NA	NA	NA
QAV87893.1|1330928_1331279_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
QAV87894.1|1331275_1331482_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.6e-11
QAV87895.1|1331597_1332107_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.1e-21
QAV87896.1|1332224_1333022_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
QAV87897.1|1333018_1334320_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
QAV87898.1|1334323_1335811_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.3e-139
QAV87899.1|1335830_1336658_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
QAV87900.1|1336683_1337619_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
QAV87901.1|1337640_1338024_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
QAV87902.1|1338020_1338377_+	DUF3599 family protein	NA	NA	NA	NA	NA
QAV87903.1|1338373_1338859_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
QAV87904.1|1338871_1339312_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
QAV87905.1|1339315_1339534_+	hypothetical protein	NA	NA	NA	NA	NA
QAV87906.1|1339530_1340931_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	39.1	5.1e-77
QAV87907.1|1340932_1341376_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	44.5	1.9e-25
QAV87908.1|1341467_1341914_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
QAV90686.1|1341955_1342096_+	hypothetical protein	NA	NA	NA	NA	NA
QAV87909.1|1342096_1347100_+|portal	phage portal protein	portal	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.4e-37
QAV87910.1|1347092_1347752_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
QAV87911.1|1347767_1348745_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
QAV87912.1|1348744_1349011_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
QAV87913.1|1349068_1349494_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	38.3	2.1e-13
QAV87914.1|1349486_1350533_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
QAV87915.1|1350516_1351095_+	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.0e-15
QAV87916.1|1351091_1351364_+	hypothetical protein	NA	NA	NA	NA	NA
QAV87917.1|1351366_1353430_+|terminase	terminase	terminase	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
QAV87918.1|1353441_1353771_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	42.3	1.0e-15
QAV87919.1|1353767_1353932_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
QAV87920.1|1353978_1354818_+|portal	phage portal protein	portal	NA	NA	NA	NA
QAV87921.1|1354870_1355140_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
QAV87922.1|1355152_1355416_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
QAV87923.1|1355428_1356322_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
QAV87924.1|1356359_1356497_-	hypothetical protein	NA	NA	NA	NA	NA
QAV87925.1|1356582_1356753_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
QAV87926.1|1356752_1357499_-	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
QAV87927.1|1357608_1358610_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
QAV87928.1|1358622_1359240_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
QAV87929.1|1359515_1360832_-	amino acid permease	NA	NA	NA	NA	NA
QAV87930.1|1361220_1362171_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
QAV90687.1|1362386_1364537_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
QAV87931.1|1364548_1365520_+	glycosyltransferase	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.9e-62
QAV87932.1|1366037_1367396_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.8e-25
>prophage 3
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	1798451	1891604	4110403	integrase,terminase,coat,protease,portal,plate,tail,head,capsid,tRNA,holin	Bacillus_phage(73.08%)	107	1809934:1809953	1886993:1887012
QAV88353.1|1798451_1798985_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
QAV88354.1|1800152_1800608_-	hypothetical protein	NA	NA	NA	NA	NA
QAV88355.1|1800762_1801320_-	hypothetical protein	NA	NA	NA	NA	NA
QAV88356.1|1801440_1802055_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
QAV88357.1|1802193_1802550_-	hypothetical protein	NA	NA	NA	NA	NA
QAV88358.1|1802628_1803453_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
QAV88359.1|1803563_1804892_-|protease	serine protease	protease	A0A1B0T6A2	Bacillus_phage	33.6	9.3e-28
QAV88360.1|1805627_1806335_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
QAV88361.1|1806404_1806857_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
QAV88362.1|1806870_1807224_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
QAV88363.1|1807237_1807555_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
QAV88364.1|1807691_1807967_-	hypothetical protein	NA	NA	NA	NA	NA
QAV88365.1|1808055_1808469_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88366.1|1808568_1809513_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
QAV88367.1|1809552_1809774_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
1809934:1809953	attL	ATATTATGTATAAAATGAAT	NA	NA	NA	NA
QAV88368.1|1809969_1810242_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88369.1|1810323_1810554_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88370.1|1810796_1811189_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
QAV88371.1|1811148_1813251_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
QAV88372.1|1813268_1814258_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
QAV88373.1|1814307_1814928_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
QAV88374.1|1814991_1815759_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
QAV90699.1|1816399_1817368_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
QAV88375.1|1817500_1818763_+	GTPase HflX	NA	NA	NA	NA	NA
QAV88376.1|1818780_1820046_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
QAV88377.1|1820155_1820563_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
QAV88378.1|1820621_1821956_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
QAV88379.1|1822068_1823223_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	9.1e-64
QAV88380.1|1823235_1824294_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JAE0	uncultured_Caudovirales_phage	33.3	2.2e-11
QAV88381.1|1824290_1824632_-	XRE family transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.0	1.6e-08
QAV88382.1|1824727_1824964_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAV88383.1|1825070_1825832_+	Rha family transcriptional regulator	NA	A8ATN0	Listeria_phage	44.7	1.8e-44
QAV88384.1|1825846_1826158_+	DNA-binding protein	NA	NA	NA	NA	NA
QAV88385.1|1826176_1826416_+	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	55.3	6.8e-06
QAV88386.1|1826412_1826688_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	45.3	6.8e-18
QAV88387.1|1826677_1826905_+	hypothetical protein	NA	D6R417	Bacillus_phage	87.5	9.3e-05
QAV88388.1|1827004_1827559_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	96.2	3.1e-94
QAV88389.1|1827562_1828501_+	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	92.0	1.7e-161
QAV88390.1|1828490_1828688_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	87.5	1.1e-17
QAV88391.1|1828711_1829149_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	94.5	1.6e-77
QAV88392.1|1829209_1831630_+	DNA primase	NA	D6R422	Bacillus_phage	93.9	0.0e+00
QAV88393.1|1831872_1832310_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	96.6	3.2e-78
QAV88394.1|1832306_1832846_+	nuclease	NA	Q9ZXC2	Bacillus_phage	96.1	3.0e-94
QAV88395.1|1832880_1833396_+	hypothetical protein	NA	D6R425	Bacillus_phage	97.1	2.6e-95
QAV88396.1|1833396_1833588_+	hypothetical protein	NA	D6R426	Bacillus_phage	80.4	8.1e-18
QAV88397.1|1833553_1834009_+	hypothetical protein	NA	D9J0I1	Brochothrix_phage	41.2	1.1e-15
QAV88398.1|1834005_1834209_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88399.1|1834294_1834708_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	98.5	3.6e-63
QAV88400.1|1835149_1835881_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88401.1|1836206_1836767_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88402.1|1836917_1837142_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88403.1|1837216_1837561_+	hypothetical protein	NA	NA	NA	NA	NA
QAV90700.1|1837550_1837916_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	53.3	6.1e-30
QAV88404.1|1838142_1838658_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.2e-33
QAV88405.1|1838654_1840364_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.4	1.3e-204
QAV88406.1|1840376_1840568_+	DUF1056 family protein	NA	NA	NA	NA	NA
QAV88407.1|1840568_1841876_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.4	1.6e-104
QAV88408.1|1841823_1842561_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	57.1	2.6e-56
QAV88409.1|1842600_1843887_+|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.7	1.3e-79
QAV88410.1|1843913_1844375_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	59.5	1.0e-10
QAV88411.1|1844392_1844695_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	4.7e-12
QAV88412.1|1844684_1844999_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	37.3	9.9e-13
QAV88413.1|1844998_1845397_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88414.1|1845393_1845786_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88415.1|1845800_1846412_+|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	35.1	3.6e-11
QAV88416.1|1846478_1846856_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88417.1|1847055_1851543_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	1.5e-66
QAV88418.1|1851536_1852376_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	59.0	8.9e-93
QAV88419.1|1852390_1854094_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.6	9.7e-179
QAV88420.1|1855737_1856859_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.8	9.8e-196
QAV88421.1|1856874_1857174_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	4.5e-39
QAV88422.1|1857170_1857341_+	XkdX family protein	NA	NA	NA	NA	NA
QAV88423.1|1857394_1857817_+|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
QAV88424.1|1857860_1858640_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	58.8	1.6e-64
QAV88425.1|1858680_1858980_-	hypothetical protein	NA	NA	NA	NA	NA
QAV88426.1|1858986_1860834_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	61.3	5.1e-125
QAV88427.1|1861181_1862294_+	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	67.6	1.1e-138
QAV88428.1|1862458_1862647_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	55.0	2.9e-12
QAV88429.1|1862843_1863881_-	DUF4917 family protein	NA	NA	NA	NA	NA
QAV88430.1|1864672_1864966_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88431.1|1865212_1865557_+	hypothetical protein	NA	O64021	Bacillus_phage	81.6	2.7e-32
QAV90701.1|1866123_1866558_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
QAV88432.1|1867940_1868477_+	N-acetyltransferase	NA	NA	NA	NA	NA
QAV88433.1|1868555_1869458_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QAV88434.1|1869535_1869916_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88435.1|1870457_1870688_+	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
QAV88436.1|1870684_1871323_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
QAV90702.1|1871834_1872077_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88437.1|1872187_1872352_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88438.1|1872491_1872962_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88439.1|1873758_1875150_+	MFS transporter	NA	NA	NA	NA	NA
QAV88440.1|1875180_1876782_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
QAV88441.1|1876918_1878073_-	ROK family protein	NA	NA	NA	NA	NA
QAV88442.1|1878310_1879648_+	xylose isomerase	NA	NA	NA	NA	NA
QAV88443.1|1879798_1881298_+	xylulokinase	NA	NA	NA	NA	NA
QAV88444.1|1881781_1882417_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	68.1	5.0e-72
QAV88445.1|1882829_1884245_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
QAV90703.1|1884346_1885531_-	alanine racemase	NA	NA	NA	NA	NA
QAV88446.1|1885995_1886457_+	DUF2691 family protein	NA	NA	NA	NA	NA
QAV88447.1|1886486_1886921_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	91.5	3.8e-71
QAV88448.1|1887521_1887785_-	hypothetical protein	NA	NA	NA	NA	NA
1886993:1887012	attR	ATATTATGTATAAAATGAAT	NA	NA	NA	NA
QAV88449.1|1888191_1888356_+	hypothetical protein	NA	NA	NA	NA	NA
QAV88450.1|1888630_1889470_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	5.6e-164
QAV88451.1|1889592_1889880_-	hypothetical protein	NA	NA	NA	NA	NA
QAV88452.1|1889922_1890642_-	hypothetical protein	NA	NA	NA	NA	NA
QAV88453.1|1890801_1891158_-	hypothetical protein	NA	NA	NA	NA	NA
QAV88454.1|1891403_1891604_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
>prophage 4
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	2037951	2045978	4110403	holin	Bacillus_phage(85.71%)	9	NA	NA
QAV88577.1|2037951_2038245_-	YolD-like family protein	NA	O64030	Bacillus_phage	97.9	9.7e-47
QAV88578.1|2038739_2039099_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	98.3	2.2e-61
QAV90713.1|2039358_2039442_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
QAV88579.1|2040300_2040879_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	91.1	1.5e-99
QAV88580.1|2040934_2041393_-	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	82.2	9.2e-68
QAV88581.1|2041485_2041944_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
QAV88582.1|2041953_2043756_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	87.0	1.3e-218
QAV88583.1|2043856_2044414_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	93.5	8.5e-100
QAV88584.1|2044541_2045978_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.3	1.5e-07
>prophage 5
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	2257067	2263162	4110403		Staphylococcus_phage(66.67%)	8	NA	NA
QAV88820.1|2257067_2257661_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
QAV88821.1|2257650_2258406_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
QAV88822.1|2258685_2259210_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
QAV88823.1|2259223_2259598_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
QAV88824.1|2259710_2260175_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
QAV88825.1|2260207_2261404_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
QAV88826.1|2261418_2262066_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
QAV88827.1|2262076_2263162_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	1.5e-55
>prophage 6
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	2936734	2997868	4110403	terminase,coat,protease,portal,plate,tail,head,capsid,holin	Bacillus_phage(55.17%)	54	NA	NA
QAV89508.1|2936734_2937790_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
QAV89509.1|2937804_2938938_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
QAV89510.1|2939127_2940201_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
QAV89511.1|2940280_2940748_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
QAV89512.1|2940778_2943175_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.2	5.8e-12
QAV89513.1|2943161_2944616_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
QAV89514.1|2944612_2945644_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
QAV89515.1|2945667_2946810_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
QAV89516.1|2946806_2948690_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
QAV89517.1|2956426_2957005_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
QAV89518.1|2957046_2957568_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAV89519.1|2957585_2959115_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.9	2.7e-07
QAV89520.1|2959135_2959660_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89521.1|2959827_2960316_+	DinB family protein	NA	NA	NA	NA	NA
QAV89522.1|2960321_2960900_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
QAV90744.1|2960987_2962196_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
QAV89523.1|2962212_2963685_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
QAV89524.1|2963883_2964426_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
QAV89525.1|2964623_2965169_+	hypothetical protein	NA	NA	NA	NA	NA
QAV89526.1|2965534_2966203_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
QAV89527.1|2966209_2967547_+	Ktr system potassium uptake protein B	NA	NA	NA	NA	NA
QAV89528.1|2967582_2967846_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89529.1|2967954_2968803_-	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	41.1	1.0e-24
QAV89530.1|2968963_2970499_-	MFS transporter	NA	NA	NA	NA	NA
QAV89531.1|2971017_2971503_+	cysteine dioxygenase	NA	NA	NA	NA	NA
QAV89532.1|2971785_2972601_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	31.4	1.6e-17
QAV89533.1|2972729_2972924_+	XRE family transcriptional regulator	NA	L0L8F4	Bacillus_phage	38.1	1.6e-05
QAV89534.1|2972920_2973550_-	hypothetical protein	NA	Q0H249	Geobacillus_phage	57.8	1.5e-60
QAV89535.1|2973536_2974691_-	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	45.5	1.2e-84
QAV90745.1|2974687_2974975_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89536.1|2975255_2975480_+	transcriptional regulator	NA	B3RH35	Bacillus_virus	63.0	8.3e-22
QAV89537.1|2975525_2975861_+	YolD-like family protein	NA	O64030	Bacillus_phage	39.4	3.6e-13
QAV89538.1|2975878_2976184_-	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	50.0	5.3e-11
QAV89539.1|2976308_2976566_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	3.3e-22
QAV89540.1|2976585_2977530_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	61.3	8.8e-89
QAV89541.1|2977602_2977806_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	46.5	1.9e-09
QAV89542.1|2977830_2978001_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	66.0	1.4e-10
QAV89543.1|2978001_2978295_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	80.2	2.7e-41
QAV89544.1|2978310_2979534_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	74.9	7.0e-163
QAV89545.1|2981165_2982692_-	hypothetical protein	NA	A0A0U4JID8	Exiguobacterium_phage	35.5	1.7e-49
QAV89546.1|2982701_2983520_-|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	44.7	9.7e-60
QAV89547.1|2983519_2989012_-|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	47.0	5.1e-112
QAV90746.1|2989673_2990261_-|tail	phage tail protein	tail	A6XMK3	Bacillus_virus	28.4	6.8e-07
QAV89548.1|2990278_2990623_-	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	48.7	8.8e-23
QAV90747.1|2990619_2991021_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89549.1|2991044_2991386_-|head,tail	head-tail adaptor protein	head,tail	A6M954	Geobacillus_virus	46.7	1.2e-19
QAV89550.1|2991390_2991630_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	48.6	2.4e-11
QAV89551.1|2991632_2992121_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89552.1|2992161_2993316_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	63.1	6.0e-132
QAV89553.1|2993315_2994062_-|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	50.6	2.3e-60
QAV89554.1|2994015_2995314_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	44.4	1.6e-88
QAV89555.1|2995325_2997107_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	67.0	7.3e-246
QAV89556.1|2997081_2997405_-|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZN8	Paenibacillus_phage	73.1	2.2e-31
QAV89557.1|2997526_2997868_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	56.4	2.9e-26
>prophage 7
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	3003241	3040721	4110403	integrase	Bacillus_phage(45.16%)	52	3003623:3003637	3043686:3043700
QAV89561.1|3003241_3003559_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	47.1	1.1e-11
3003623:3003637	attL	CCTGCCGAATTTCAA	NA	NA	NA	NA
QAV89562.1|3003656_3003878_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAV89563.1|3004279_3004483_+	hypothetical protein	NA	NA	NA	NA	NA
QAV89564.1|3004588_3005026_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	67.1	1.8e-49
QAV89565.1|3005328_3005757_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAV89566.1|3005788_3005968_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89567.1|3006035_3006500_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89568.1|3006533_3007172_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	40.7	1.4e-13
QAV89569.1|3007171_3007555_-	RNA polymerase subunit sigma	NA	A0A0N9RZI0	Paenibacillus_phage	41.7	1.1e-16
QAV89570.1|3007590_3008769_-	hypothetical protein	NA	A0A0N9ST12	Paenibacillus_phage	64.3	7.5e-146
QAV89571.1|3008885_3009275_+	hypothetical protein	NA	NA	NA	NA	NA
QAV89572.1|3009247_3010501_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	74.4	1.1e-136
QAV89573.1|3010497_3011067_-	dephospho-CoA kinase	NA	J9Q953	Bacillus_phage	41.5	4.0e-36
QAV89574.1|3011063_3011822_-	CHAP domain-containing protein	NA	A0A1P8CWY7	Bacillus_phage	39.5	1.8e-23
QAV89575.1|3011837_3012428_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	58.8	6.6e-26
QAV89576.1|3012397_3013219_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	67.9	1.2e-86
QAV89577.1|3013200_3013779_-	HNH endonuclease	NA	B5LPN5	Bacillus_virus	50.3	3.3e-38
QAV89578.1|3013690_3014056_-	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	69.8	2.8e-43
QAV90749.1|3014161_3015127_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	77.4	1.6e-141
QAV89579.1|3016910_3017597_-	HNH endonuclease	NA	L0LCB9	Bacillus_phage	57.1	1.3e-46
QAV89580.1|3018382_3018751_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	51.7	4.8e-27
QAV89581.1|3018908_3019103_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89582.1|3019099_3019381_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89583.1|3019377_3019575_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89584.1|3019575_3020112_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	45.3	3.5e-10
QAV89585.1|3020108_3020321_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89586.1|3020320_3021379_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.4	2.8e-83
QAV89587.1|3021379_3023665_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.9	1.6e-123
QAV89588.1|3024017_3025283_-	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	27.6	3.5e-32
QAV89589.1|3025296_3025566_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89590.1|3025565_3026000_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89591.1|3026034_3026793_-	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	49.6	8.7e-55
QAV89592.1|3027037_3027556_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89593.1|3027850_3028486_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89594.1|3028748_3029987_-	hypothetical protein	NA	A0A288WG12	Bacillus_phage	29.8	8.1e-50
QAV89595.1|3030102_3030312_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAV89596.1|3030343_3030610_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAV89597.1|3030606_3031620_-	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	49.1	9.1e-76
QAV89598.1|3031731_3033126_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.9	1.4e-127
QAV89599.1|3033122_3033836_-	hypothetical protein	NA	B4XYT8	Lactobacillus_phage	41.3	6.3e-15
QAV89600.1|3033832_3034345_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89601.1|3034341_3035142_-	DNA replication protein	NA	A0A142F1P9	Bacillus_phage	42.3	7.5e-49
QAV89602.1|3035161_3035365_-	hypothetical protein	NA	A0A1P8CX62	Bacillus_phage	58.8	3.7e-13
QAV89603.1|3035361_3036006_-	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	58.1	6.7e-40
QAV89604.1|3036034_3036418_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	44.5	2.1e-20
QAV89605.1|3036398_3036755_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	32.8	1.4e-07
QAV89606.1|3036756_3036966_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89607.1|3036981_3037482_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89608.1|3037517_3037841_-	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	32.2	4.1e-06
QAV89609.1|3038200_3038578_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAV89610.1|3038574_3039522_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89611.1|3039662_3040721_-|integrase	integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	27.7	4.5e-17
3043686:3043700	attR	CCTGCCGAATTTCAA	NA	NA	NA	NA
>prophage 8
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	3399277	3424149	4110403	integrase,portal,tail,capsid,holin	Bacillus_phage(28.0%)	32	3393577:3393591	3425632:3425646
3393577:3393591	attL	ATCAACGTTTGCGCC	NA	NA	NA	NA
QAV90767.1|3399277_3399511_-	helix-turn-helix domain-containing protein	NA	B3RH35	Bacillus_virus	62.0	4.3e-21
QAV89948.1|3399789_3400068_+	hypothetical protein	NA	NA	NA	NA	NA
QAV89949.1|3400080_3401265_+	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	53.4	1.3e-108
QAV89950.1|3401251_3401884_+	hypothetical protein	NA	Q0H249	Geobacillus_phage	56.7	1.0e-61
QAV89951.1|3401925_3402228_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89952.1|3402349_3402607_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.6e-22
QAV89953.1|3402626_3403574_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.7	2.5e-91
QAV89954.1|3403646_3403850_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	46.5	1.9e-09
QAV89955.1|3403874_3404045_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	68.1	5.0e-11
QAV89956.1|3404045_3404339_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	80.2	1.6e-41
QAV90768.1|3404354_3405542_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	73.2	4.4e-154
QAV89957.1|3405614_3407192_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	87.2	3.9e-259
QAV89958.1|3407204_3408599_-	endopeptidase	NA	A6M966	Geobacillus_virus	30.3	3.0e-37
QAV89959.1|3408613_3410032_-|tail	phage tail protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	42.4	1.3e-56
QAV89960.1|3410035_3412858_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.4	6.7e-68
QAV89961.1|3412862_3413084_-	hypothetical protein	NA	NA	NA	NA	NA
QAV90769.1|3413179_3413536_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89962.1|3413622_3414192_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	63.0	1.0e-52
QAV89963.1|3414232_3414607_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89964.1|3414611_3415019_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	55.5	2.1e-31
QAV89965.1|3415015_3415354_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	47.3	8.1e-21
QAV89966.1|3415354_3415747_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.5	7.5e-18
QAV89967.1|3415764_3415956_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89968.1|3416012_3416921_-|capsid	phage major capsid protein	capsid	A0A0N9S7T7	Paenibacillus_phage	52.5	1.9e-80
QAV89969.1|3416952_3417513_-	ribonucleoside-triphosphate reductase	NA	M1NRH2	Streptococcus_phage	30.8	6.1e-05
QAV89970.1|3417618_3418431_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.7	1.1e-74
QAV89971.1|3418430_3420101_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.3	1.5e-155
QAV89972.1|3420105_3420540_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.3	1.5e-27
QAV89973.1|3420556_3422317_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	44.8	1.4e-132
QAV89974.1|3422400_3422949_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	7.0e-38
QAV89975.1|3422978_3423188_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89976.1|3423882_3424149_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	56.3	9.2e-20
3425632:3425646	attR	ATCAACGTTTGCGCC	NA	NA	NA	NA
>prophage 9
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	3433090	3440151	4110403	integrase,protease	Bacillus_phage(42.86%)	8	3430156:3430169	3447968:3447981
3430156:3430169	attL	AATACAAAATAAGT	NA	NA	NA	NA
QAV89989.1|3433090_3434071_-|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	23.9	7.4e-06
QAV89990.1|3434701_3435511_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	59.7	5.9e-94
QAV89991.1|3435597_3436020_-	hypothetical protein	NA	NA	NA	NA	NA
QAV89992.1|3436035_3436218_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	7.4e-21
QAV90770.1|3436391_3437126_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	32.1	6.3e-18
QAV89993.1|3437285_3438275_-	DNA integration/recombination/inversion protein	NA	A0A0U4IBS1	Pseudomonas_phage	28.1	2.7e-08
QAV89994.1|3438820_3439414_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.8	2.6e-54
QAV89995.1|3439476_3440151_-	beta-phosphoglucomutase	NA	A7ITQ4	Paramecium_bursaria_Chlorella_virus	26.3	4.2e-08
3447968:3447981	attR	AATACAAAATAAGT	NA	NA	NA	NA
>prophage 10
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	3731783	3751502	4110403	tRNA,bacteriocin,protease	Staphylococcus_phage(50.0%)	21	NA	NA
QAV90277.1|3731783_3733454_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
QAV90278.1|3733450_3733879_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
QAV90279.1|3734191_3734323_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
QAV90280.1|3734279_3734432_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
QAV90281.1|3734456_3735803_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
QAV90282.1|3735815_3735977_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
QAV90283.1|3735973_3736693_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
QAV90284.1|3736685_3737996_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
QAV90780.1|3737985_3739146_+	insulinase family protein	NA	NA	NA	NA	NA
QAV90285.1|3739150_3740431_+	insulinase family protein	NA	NA	NA	NA	NA
QAV90286.1|3740427_3741129_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
QAV90287.1|3741134_3742511_-	YncE family protein	NA	NA	NA	NA	NA
QAV90288.1|3742549_3743905_-	YncE family protein	NA	NA	NA	NA	NA
QAV90289.1|3744134_3745280_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
QAV90290.1|3745263_3745383_+	phosphatase RapF inhibitor	NA	NA	NA	NA	NA
QAV90291.1|3745673_3746042_+	hypothetical protein	NA	NA	NA	NA	NA
QAV90292.1|3745976_3746849_-	agmatinase	NA	NA	NA	NA	NA
QAV90293.1|3746909_3747740_-	spermidine synthase	NA	NA	NA	NA	NA
QAV90294.1|3747942_3750018_+	penicillin-binding protein	NA	NA	NA	NA	NA
QAV90295.1|3750310_3750829_-	hypothetical protein	NA	NA	NA	NA	NA
QAV90296.1|3750842_3751502_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 11
CP035390	Bacillus subtilis strain SRCM103641 chromosome, complete genome	4110403	3781059	3831175	4110403	holin,coat	Enterobacteria_phage(25.0%)	52	NA	NA
QAV90325.1|3781059_3781515_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
QAV90326.1|3781507_3782359_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	3.7e-38
QAV90327.1|3782372_3783320_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
QAV90328.1|3783319_3784060_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	41.9	5.9e-48
QAV90329.1|3784084_3785104_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAV90330.1|3785106_3785829_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAV90331.1|3785821_3786943_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAV90332.1|3786942_3787812_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAV90333.1|3787812_3788982_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
QAV90334.1|3789002_3790427_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
QAV90335.1|3790431_3791202_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
QAV90336.1|3791194_3791374_-	hypothetical protein	NA	NA	NA	NA	NA
QAV90337.1|3791521_3792067_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
QAV90338.1|3792110_3792482_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
QAV90339.1|3792543_3793866_-	purine permease	NA	NA	NA	NA	NA
QAV90340.1|3793885_3794203_-	hypothetical protein	NA	NA	NA	NA	NA
QAV90341.1|3794370_3795741_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
QAV90342.1|3795765_3796443_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
QAV90343.1|3796456_3797263_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
QAV90344.1|3797454_3798270_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
QAV90345.1|3798360_3798609_-	hypothetical protein	NA	NA	NA	NA	NA
QAV90346.1|3798702_3800142_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	27.0	1.6e-20
QAV90347.1|3800138_3801524_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
QAV90348.1|3801825_3802596_+	transporter	NA	NA	NA	NA	NA
QAV90349.1|3802634_3803465_-	transcription antiterminator	NA	NA	NA	NA	NA
QAV90350.1|3803504_3803807_-	hypothetical protein	NA	NA	NA	NA	NA
QAV90351.1|3804336_3806757_+	peptidase S8	NA	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
QAV90352.1|3806794_3807796_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
QAV90353.1|3807969_3808719_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
QAV90354.1|3808824_3810006_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
QAV90355.1|3810215_3811361_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAV90356.1|3811589_3811853_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
QAV90357.1|3811894_3812269_-	quinol oxidase subunit 4	NA	NA	NA	NA	NA
QAV90358.1|3812270_3812885_-	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
QAV90359.1|3812898_3814848_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
QAV90781.1|3814875_3815841_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
QAV90360.1|3816356_3816602_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
QAV90361.1|3816672_3818214_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
QAV90362.1|3818217_3819390_-	galactokinase	NA	NA	NA	NA	NA
QAV90363.1|3819470_3819854_-	GtrA family protein	NA	NA	NA	NA	NA
QAV90364.1|3819871_3820543_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAV90365.1|3820897_3821056_+	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
QAV90366.1|3821498_3821807_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
QAV90367.1|3821803_3823345_+	cation acetate symporter	NA	NA	NA	NA	NA
QAV90368.1|3823357_3823978_-	DsbA family protein	NA	NA	NA	NA	NA
QAV90369.1|3824261_3825512_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
QAV90370.1|3825530_3826688_-	Efem/EfeO family lipoprotein	NA	NA	NA	NA	NA
QAV90371.1|3826684_3828130_-	iron transporter	NA	NA	NA	NA	NA
QAV90372.1|3828286_3828955_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
QAV90373.1|3828951_3829770_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
QAV90374.1|3829777_3830683_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QAV90375.1|3830788_3831175_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
