The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	255993	334206	5452210	protease,lysis,capsid,holin,head,tail,terminase,portal,plate,transposase,integrase	Shigella_phage(52.73%)	90	297085:297131	336529:336575
QAV71921.1|255993_257325_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
QAV71922.1|257327_257852_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
QAV71923.1|259153_260236_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
QAV71924.1|260199_262050_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
QAV71925.1|262053_262467_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
QAV71926.1|262557_263949_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
QAV71927.1|263999_264224_-	hypothetical protein	NA	NA	NA	NA	NA
QAV71928.1|264258_264759_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
QAV71929.1|265455_265974_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
QAV71930.1|266183_268325_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
QAV71931.1|268400_272624_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
QAV71932.1|272825_273089_+	dCTP deaminase	NA	NA	NA	NA	NA
QAV71933.1|273003_273189_-	hypothetical protein	NA	NA	NA	NA	NA
QAV71934.1|273269_274442_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
QAV71935.1|274559_275330_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
QAV71936.1|275483_275957_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
QAV71937.1|275999_278444_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
QAV71938.1|278683_279262_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
QAV71939.1|279366_280134_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
QAV71940.1|280104_280845_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
QAV71941.1|281000_281261_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
QAV71942.1|281279_281540_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
QAV71943.1|281725_282499_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
QAV71944.1|283316_285056_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
QAV71945.1|285015_285786_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
QAV71946.1|285856_286912_+	DNA polymerase IV	NA	NA	NA	NA	NA
QAV71947.1|286963_287257_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
QAV71948.1|287259_287658_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
QAV71949.1|287667_288120_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAV71950.1|288426_288693_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76643.1|288625_289162_+	peptide chain release factor H	NA	NA	NA	NA	NA
QAV71951.1|289218_290676_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
QAV71952.1|290936_291395_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
QAV71953.1|291486_292731_+	esterase FrsA	NA	NA	NA	NA	NA
QAV71954.1|292788_293190_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
QAV71955.1|293228_294284_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
QAV71956.1|294571_295675_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
QAV71957.1|295686_296940_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
297085:297131	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT	NA	NA	NA	NA
QAV71958.1|297144_298308_-|integrase	integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
QAV71959.1|298184_298619_-	DNA-binding protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
QAV71960.1|298534_298840_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
QAV71961.1|298839_299202_-	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
QAV71962.1|299192_299729_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
QAV71963.1|299784_300006_-	hypothetical protein	NA	S5FNS4	Shigella_phage	95.9	2.4e-37
QAV71964.1|300242_300488_+	hypothetical protein	NA	NA	NA	NA	NA
QAV71965.1|300405_300702_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
QAV71966.1|300979_301672_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
QAV71967.1|301769_302030_+	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
QAV71968.1|302022_302574_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
QAV71969.1|302749_302929_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
QAV71970.1|302918_303860_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
QAV71971.1|303856_304351_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
QAV71972.1|304350_305004_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
QAV71973.1|305000_305327_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
QAV71974.1|305323_305713_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
QAV71975.1|305732_306542_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
QAV71976.1|306549_307539_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
QAV71977.1|307552_308305_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
QAV76644.1|308519_309059_+	hypothetical protein	NA	NA	NA	NA	NA
QAV71978.1|309202_309436_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76645.1|309714_310008_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
QAV71979.1|310144_310480_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
QAV71980.1|310483_310960_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
QAV71981.1|311176_311359_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
QAV71982.1|311449_311743_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
QAV71983.1|311835_311976_+	Rz1 lytic protein	NA	U5P461	Shigella_phage	81.0	3.5e-10
QAV71984.1|312441_313655_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
QAV71985.1|314057_314552_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
QAV76646.1|314785_316282_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
QAV71986.1|316429_317656_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
QAV71987.1|317648_318251_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
QAV71988.1|318261_319491_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
QAV71989.1|319569_319893_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
QAV71990.1|319889_320300_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
QAV71991.1|320274_320781_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
QAV71992.1|320777_321338_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
QAV71993.1|321346_321517_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
QAV71994.1|321500_322997_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
QAV71995.1|322996_323353_+|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
QAV71996.1|323352_323622_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
QAV71997.1|323588_323777_+	hypothetical protein	NA	NA	NA	NA	NA
QAV71998.1|323763_325599_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
QAV71999.1|325659_326988_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
QAV72000.1|326984_328064_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
QAV72001.1|328063_328612_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	3.6e-95
QAV76647.1|328611_329037_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
QAV72002.1|329023_330082_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
QAV72003.1|330072_330657_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	98.5	7.8e-112
QAV72004.1|332817_333372_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
QAV72005.1|333432_334206_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
336529:336575	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT	NA	NA	NA	NA
>prophage 2
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	916849	954015	5452210	protease,lysis,holin,tail,terminase,portal,integrase	Enterobacteria_phage(51.22%)	49	906291:906305	938580:938594
906291:906305	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
QAV72483.1|916849_917731_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
QAV72484.1|917893_918112_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
QAV72485.1|918151_918319_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
QAV72486.1|918251_918437_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72487.1|918561_919164_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72488.1|919374_919596_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
QAV72489.1|919694_919976_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
QAV72490.1|919986_920178_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
QAV76666.1|920150_920333_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
QAV72491.1|920329_921010_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
QAV72492.1|921707_921890_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
QAV72493.1|921886_922057_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
QAV76665.1|922049_922670_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
QAV72494.1|922666_923332_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
QAV72495.1|923543_924503_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
QAV72496.1|924840_924963_+	YlcG family protein	NA	NA	NA	NA	NA
QAV72497.1|924977_925667_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
QAV72498.1|925850_926594_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72499.1|926679_926838_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
QAV72500.1|926918_927317_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
QAV72501.1|927459_927675_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
QAV72502.1|927674_928172_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
QAV72503.1|928168_928636_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
QAV72504.1|928623_928776_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
QAV76667.1|929182_929461_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72505.1|929940_932043_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
QAV72506.1|932039_932252_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
QAV72507.1|932179_933304_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
QAV72508.1|933425_933761_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
QAV72509.1|933705_935733_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
QAV72510.1|935819_936143_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
QAV72511.1|936135_936411_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
QAV72512.1|936422_937001_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
QAV72513.1|936997_937399_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
QAV72514.1|937409_938153_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
QAV76668.1|938213_938600_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
938580:938594	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
QAV72515.1|938608_938938_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
QAV72516.1|938909_941975_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
QAV72517.1|941974_942304_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
QAV72518.1|942313_943012_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
QAV72519.1|943017_943761_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
QAV72520.1|943697_944306_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.6	7.1e-100
QAV72521.1|947850_948450_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
QAV72522.1|948509_949826_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
QAV72523.1|949827_950097_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
QAV72524.1|950273_951254_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
QAV72525.1|951287_952307_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
QAV76669.1|952803_952965_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
QAV72526.1|953133_954015_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
>prophage 3
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	1171651	1241357	5452210	protease,capsid,holin,head,tail,portal,transposase,integrase	Escherichia_phage(26.09%)	87	1180139:1180154	1201505:1201520
QAV72708.1|1171651_1173412_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
QAV72709.1|1173597_1174050_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
QAV72710.1|1174125_1175166_-	porin OmpA	NA	NA	NA	NA	NA
QAV72711.1|1175522_1176032_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
QAV72712.1|1176250_1176880_+	TfoX family DNA transformation protein	NA	NA	NA	NA	NA
QAV72713.1|1176842_1179005_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
QAV72714.1|1179014_1179461_-	YccF domain-containing protein	NA	NA	NA	NA	NA
QAV76675.1|1179583_1181638_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1180139:1180154	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
QAV72715.1|1181669_1182128_-	methylglyoxal synthase	NA	NA	NA	NA	NA
QAV72716.1|1182223_1182886_-	DUF2057 family protein	NA	NA	NA	NA	NA
QAV72717.1|1183058_1183472_+	CoA-binding protein	NA	NA	NA	NA	NA
QAV72718.1|1183516_1183834_-	heat shock protein HspQ	NA	NA	NA	NA	NA
QAV72719.1|1183891_1185082_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
QAV72720.1|1185176_1185455_+	acylphosphatase	NA	NA	NA	NA	NA
QAV72721.1|1185451_1185781_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
QAV72722.1|1185871_1186531_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
QAV76676.1|1186736_1186949_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72723.1|1186938_1187958_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.7e-85
QAV72724.1|1187935_1188178_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
QAV72725.1|1188245_1190717_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
QAV72726.1|1190810_1191002_-	DUF1482 family protein	NA	NA	NA	NA	NA
QAV72727.1|1190998_1191187_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
QAV72728.1|1191453_1191759_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72729.1|1191760_1191946_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72730.1|1192132_1192522_-	hypothetical protein	NA	NA	NA	NA	NA
QAV72731.1|1192663_1192819_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
QAV72732.1|1192876_1193095_-	hypothetical protein	NA	NA	NA	NA	NA
QAV72733.1|1193096_1193384_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
QAV72734.1|1193383_1193575_-	antitoxin	NA	NA	NA	NA	NA
QAV72735.1|1193602_1194004_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
QAV72736.1|1194112_1194385_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
QAV72737.1|1194368_1194794_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
QAV72738.1|1195000_1195456_-	hypothetical protein	NA	NA	NA	NA	NA
QAV76677.1|1195534_1196626_+	DNA-binding protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
QAV72739.1|1196632_1197379_+	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
QAV72740.1|1197400_1198171_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
QAV72741.1|1198186_1198600_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
QAV72742.1|1198951_1199725_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
QAV72743.1|1199736_1199928_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72744.1|1200090_1200228_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
QAV72745.1|1200272_1200485_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
QAV72746.1|1200652_1200931_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
QAV72747.1|1200932_1201982_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1201505:1201520	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
QAV72748.1|1201994_1202366_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
QAV72749.1|1202355_1202727_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
QAV72750.1|1202878_1203697_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QAV72751.1|1203983_1204223_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
QAV72752.1|1204317_1205031_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAV72753.1|1205476_1205680_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
QAV72754.1|1205797_1207648_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
QAV72755.1|1207823_1209036_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
QAV72756.1|1209241_1209556_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
QAV72757.1|1210083_1210269_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
QAV72758.1|1210490_1210604_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
QAV72759.1|1210824_1211358_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
QAV72760.1|1211390_1211585_-	hypothetical protein	NA	NA	NA	NA	NA
QAV72761.1|1211517_1211790_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72762.1|1211738_1212083_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72763.1|1212045_1212252_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
QAV72764.1|1213002_1213278_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
QAV72765.1|1213353_1213734_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
QAV72766.1|1213730_1214078_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
QAV72767.1|1214127_1215666_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
QAV72768.1|1215715_1215958_+	DNA packaging protein	NA	NA	NA	NA	NA
QAV72769.1|1217843_1218050_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
QAV72770.1|1218046_1219639_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
QAV72771.1|1221169_1221517_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
QAV72772.1|1221574_1221841_+|capsid	major capsid protein E	capsid	NA	NA	NA	NA
QAV72773.1|1221822_1222563_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
QAV72774.1|1222576_1223008_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
QAV72775.1|1223034_1223448_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
QAV72776.1|1223428_1226008_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
QAV72777.1|1226004_1226334_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
QAV72778.1|1226333_1227032_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
QAV72779.1|1227042_1227786_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	8.6e-148
QAV76678.1|1227731_1228364_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
QAV76679.1|1228317_1228524_+	hypothetical protein	NA	NA	NA	NA	NA
QAV72780.1|1228554_1229082_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
QAV72781.1|1229215_1232689_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
QAV72782.1|1232756_1233356_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
QAV72783.1|1233420_1234734_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
QAV72784.1|1234735_1235005_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
QAV72785.1|1236338_1236521_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
QAV72786.1|1237138_1238257_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
QAV72787.1|1238253_1240047_+	hydrogenase 1 large subunit	NA	NA	NA	NA	NA
QAV72788.1|1240065_1240773_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
QAV72789.1|1240769_1241357_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	1496126	1616675	5452210	protease,capsid,lysis,holin,head,tail,terminase,portal,tRNA,transposase,integrase	Enterobacteria_phage(37.61%)	158	1562037:1562052	1590291:1590306
QAV73028.1|1496126_1496948_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
QAV73029.1|1497103_1498150_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
QAV73030.1|1498146_1498941_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
QAV73031.1|1499107_1500226_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
QAV73032.1|1500194_1500464_-	excisionase	NA	NA	NA	NA	NA
QAV76693.1|1500525_1500915_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
QAV73033.1|1501047_1501563_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76694.1|1501677_1501830_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
QAV73034.1|1502145_1502622_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
QAV73035.1|1502746_1503070_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
QAV73036.1|1503053_1503479_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
QAV73037.1|1503547_1504585_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
QAV76695.1|1504616_1505039_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
QAV73038.1|1505072_1505789_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
QAV73039.1|1505785_1506103_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
QAV73040.1|1506099_1506402_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
QAV73041.1|1506391_1506709_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
QAV73042.1|1506662_1506980_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
QAV73043.1|1506966_1507404_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
QAV73044.1|1507405_1507597_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
QAV73045.1|1507599_1508187_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
QAV73046.1|1508302_1508407_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73047.1|1508595_1508808_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
QAV73048.1|1508975_1509254_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
QAV73049.1|1509255_1510305_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
QAV73050.1|1510317_1510692_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
QAV73051.1|1510688_1511510_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
QAV76696.1|1512130_1512274_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	67.4	8.2e-07
QAV73052.1|1512588_1514526_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
QAV73053.1|1514673_1514856_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
QAV73054.1|1514893_1515163_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
QAV73055.1|1515238_1515454_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
QAV73056.1|1515458_1515803_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
QAV73057.1|1515853_1516387_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
QAV73058.1|1516657_1517227_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
QAV73059.1|1517226_1517373_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
QAV73060.1|1517600_1517807_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
QAV73061.1|1517871_1518096_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73062.1|1518452_1518593_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73063.1|1518722_1518908_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
QAV73064.1|1518949_1519315_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
QAV73065.1|1519283_1519415_+	DNase	NA	H6WZK7	Escherichia_phage	100.0	2.4e-05
QAV73066.1|1519606_1520170_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
QAV73067.1|1520166_1521828_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
QAV73068.1|1521891_1523829_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
QAV73069.1|1523873_1524095_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
QAV73070.1|1524040_1526542_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
QAV73071.1|1526621_1526948_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
QAV73072.1|1526957_1527308_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
QAV73073.1|1527304_1527751_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
QAV73074.1|1527747_1528092_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
QAV73075.1|1528150_1528867_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
QAV73076.1|1528881_1529256_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
QAV76697.1|1529351_1529561_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
QAV73077.1|1529608_1532851_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
QAV73078.1|1532843_1533185_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
QAV73079.1|1533184_1533883_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
QAV73080.1|1533899_1534154_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
QAV73081.1|1534263_1534374_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
QAV73082.1|1534676_1535555_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
QAV73083.1|1535608_1536346_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
QAV76698.1|1536291_1536528_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
QAV73084.1|1536540_1536630_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73085.1|1536649_1538998_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
QAV73086.1|1539588_1542990_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
QAV73087.1|1543366_1543558_-	hypothetical protein	NA	NA	NA	NA	NA
QAV73088.1|1545093_1545219_+	NleB	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
QAV73089.1|1545298_1545574_-	secretion protein EspO	NA	NA	NA	NA	NA
QAV73090.1|1545634_1546996_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
QAV73091.1|1547116_1547329_-	hypothetical protein	NA	NA	NA	NA	NA
QAV73092.1|1547359_1548223_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
QAV73093.1|1548206_1549343_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
QAV73094.1|1549592_1550819_+	peptidase T	NA	NA	NA	NA	NA
QAV73095.1|1550867_1551989_-	cupin domain-containing protein	NA	NA	NA	NA	NA
QAV73096.1|1552350_1553564_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
QAV73097.1|1553562_1554780_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
QAV73098.1|1555144_1555333_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
QAV73099.1|1555382_1555709_-	hypothetical protein	NA	NA	NA	NA	NA
QAV73100.1|1556137_1556335_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
QAV73101.1|1556327_1556540_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73102.1|1556529_1556994_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73103.1|1556986_1557220_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73104.1|1557225_1557525_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
QAV73105.1|1557521_1558922_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
QAV73106.1|1559122_1559374_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73107.1|1559370_1559781_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
QAV73108.1|1559791_1560064_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
QAV73109.1|1560020_1560149_+	trigger factor	NA	NA	NA	NA	NA
QAV73110.1|1560190_1560415_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73111.1|1560666_1560873_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73112.1|1560872_1561928_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
QAV73113.1|1561940_1562276_+|head	head decoration protein	head	NA	NA	NA	NA
1562037:1562052	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
QAV73114.1|1562288_1562702_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
QAV73115.1|1562907_1563450_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
QAV73116.1|1563705_1563987_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73117.1|1564587_1566048_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
QAV73118.1|1566047_1566719_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
QAV73119.1|1566887_1568258_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
QAV73120.1|1568261_1568903_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
QAV73121.1|1568938_1570045_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
QAV73122.1|1570098_1570560_-	NUDIX hydrolase	NA	NA	NA	NA	NA
QAV73123.1|1570569_1571223_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
QAV73124.1|1571394_1572645_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
QAV73125.1|1572758_1573901_-|integrase	integrase	integrase	O21940	Phage_21	100.0	8.1e-206
QAV73126.1|1573890_1574127_-	excisionase	NA	NA	NA	NA	NA
QAV73127.1|1574230_1575055_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
QAV73128.1|1575051_1575753_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
QAV73129.1|1575749_1576052_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
QAV73130.1|1576119_1576452_+	multidrug SMR transporter	NA	NA	NA	NA	NA
QAV73131.1|1576516_1576639_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73132.1|1576696_1578223_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
QAV73133.1|1578342_1578534_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73134.1|1578724_1579180_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
QAV73135.1|1579179_1579350_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
QAV73136.1|1579342_1579633_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
QAV73137.1|1579629_1579992_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
QAV73138.1|1579988_1580129_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
QAV73139.1|1580125_1580815_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
QAV76699.1|1581136_1581442_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
QAV73140.1|1581428_1581905_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
QAV73141.1|1582121_1582304_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
QAV73142.1|1582394_1582688_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
QAV73143.1|1582979_1583390_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
QAV73144.1|1583675_1583882_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
QAV73145.1|1584046_1584241_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
QAV73146.1|1584629_1585175_+	DNA-packaging protein NohD	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
QAV73147.1|1585149_1587075_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
QAV73148.1|1587071_1587278_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
QAV73149.1|1587274_1588876_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
QAV73150.1|1588856_1590176_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
QAV73151.1|1590185_1590518_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1590291:1590306	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
QAV73152.1|1590572_1591598_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
QAV73153.1|1591639_1592038_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
QAV73154.1|1592049_1592403_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
QAV73155.1|1592414_1592993_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
QAV73156.1|1592989_1593385_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
QAV73157.1|1593392_1594133_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
QAV73158.1|1594148_1594571_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
QAV73159.1|1594552_1594987_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
QAV73160.1|1597524_1597854_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
QAV73161.1|1597853_1598552_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
QAV73162.1|1598557_1599301_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
QAV73163.1|1599237_1599870_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
QAV73164.1|1599930_1603329_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
QAV73165.1|1603395_1603995_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
QAV73166.1|1604059_1606975_+	hypothetical protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
QAV73167.1|1606974_1607556_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
QAV73168.1|1607675_1608566_-	manganese catalase family protein	NA	NA	NA	NA	NA
QAV73169.1|1608584_1609091_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
QAV73170.1|1609127_1609628_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
QAV73171.1|1609706_1609889_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
QAV73172.1|1610386_1611055_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QAV73173.1|1611111_1611360_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
QAV73174.1|1611435_1611816_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
QAV73175.1|1611812_1612160_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
QAV73176.1|1612209_1613748_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
QAV73177.1|1614050_1615535_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
QAV73178.1|1615721_1616675_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 5
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	1701259	1826257	5452210	protease,capsid,holin,head,tail,terminase,portal,transposase,integrase	Stx2-converting_phage(39.81%)	140	1701096:1701123	1810729:1810756
1701096:1701123	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
QAV73252.1|1701259_1702390_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
QAV73253.1|1702367_1702616_-	excisionase	NA	NA	NA	NA	NA
QAV73254.1|1702680_1705152_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
QAV73255.1|1705244_1705436_-	DUF1482 family protein	NA	NA	NA	NA	NA
QAV73256.1|1705432_1705621_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
QAV76704.1|1706018_1706186_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73257.1|1706179_1706413_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73258.1|1706390_1706798_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
QAV73259.1|1706820_1707039_-	hypothetical protein	NA	NA	NA	NA	NA
QAV73260.1|1707111_1707411_-	hypothetical protein	NA	NA	NA	NA	NA
QAV73261.1|1707674_1708082_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
QAV73262.1|1708158_1708386_+	transcriptional regulator	NA	NA	NA	NA	NA
QAV73263.1|1708369_1708921_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73264.1|1708892_1709933_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
QAV76705.1|1709964_1710387_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
QAV73265.1|1710573_1711155_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
QAV73266.1|1711151_1711316_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73267.1|1712014_1712773_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
QAV73268.1|1713051_1713264_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
QAV73269.1|1713484_1713742_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73270.1|1713811_1714090_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
QAV73271.1|1714091_1715138_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
QAV73272.1|1715150_1715510_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
QAV73273.1|1715518_1716049_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
QAV73274.1|1716290_1716488_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
QAV73275.1|1716638_1717697_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
QAV76706.1|1718188_1718374_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
QAV73276.1|1718493_1720347_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
QAV73277.1|1720496_1720712_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
QAV76707.1|1720716_1721061_+	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
QAV73278.1|1721111_1721645_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
QAV73279.1|1721915_1722485_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
QAV73280.1|1722484_1722631_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
QAV73281.1|1722858_1723044_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
QAV73282.1|1723468_1723696_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
QAV73283.1|1723737_1724103_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
QAV73284.1|1724392_1724956_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
QAV73285.1|1724952_1726614_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
QAV73286.1|1726677_1728615_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
QAV73287.1|1728659_1728881_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
QAV73288.1|1728826_1731328_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
QAV73289.1|1731407_1731734_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
QAV73290.1|1731743_1732094_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
QAV73291.1|1732090_1732537_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
QAV73292.1|1732533_1732878_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
QAV73293.1|1732936_1733653_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
QAV73294.1|1733667_1734042_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
QAV76708.1|1734137_1734347_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
QAV73295.1|1734394_1737637_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
QAV73296.1|1737629_1737971_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
QAV73297.1|1737970_1738669_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
QAV73298.1|1738679_1739423_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
QAV76710.1|1739368_1740001_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
QAV73299.1|1740343_1741519_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
QAV76709.1|1741470_1743816_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
QAV73300.1|1743883_1744483_+	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
QAV73301.1|1744634_1745948_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.4	2.5e-81
QAV73302.1|1745949_1746219_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
QAV76711.1|1746363_1746906_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	67.2	1.1e-62
QAV73303.1|1747245_1748571_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
QAV76712.1|1748838_1749027_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73304.1|1750168_1750270_+	non-LEE-encoded type III effector F	NA	NA	NA	NA	NA
QAV73305.1|1751235_1752774_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
QAV73306.1|1752823_1753171_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
QAV73307.1|1753167_1753548_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
QAV73308.1|1753887_1754166_-	secretion protein EspO	NA	NA	NA	NA	NA
QAV76713.1|1754593_1754740_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73309.1|1754876_1755524_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
QAV73310.1|1755707_1756298_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
QAV76714.1|1758026_1758455_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
QAV76715.1|1759048_1759267_-	hypothetical protein	NA	NA	NA	NA	NA
QAV73311.1|1759754_1760885_-|integrase	integrase	integrase	O21940	Phage_21	50.9	4.9e-102
QAV73312.1|1760862_1761111_-	excisionase	NA	NA	NA	NA	NA
QAV73313.1|1761175_1763620_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
QAV73314.1|1763712_1763901_-	DUF1482 family protein	NA	NA	NA	NA	NA
QAV73315.1|1763897_1764086_-	cell division inhibitor	NA	NA	NA	NA	NA
QAV73316.1|1764573_1764726_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
QAV73317.1|1764894_1765284_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAV73318.1|1765386_1765662_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
QAV73319.1|1765645_1766071_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
QAV73320.1|1766093_1767047_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
QAV73321.1|1767053_1767794_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
QAV73322.1|1767823_1768594_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
QAV73323.1|1768609_1769005_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
QAV76716.1|1769061_1769418_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
QAV73324.1|1769466_1769679_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
QAV73325.1|1769714_1770086_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
QAV73326.1|1770082_1770445_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
QAV73327.1|1770560_1770665_+	hypothetical protein	NA	NA	NA	NA	NA
QAV73328.1|1770853_1771066_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
QAV73329.1|1771595_1771874_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
QAV73330.1|1772937_1773312_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
QAV73331.1|1773308_1774130_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
QAV73332.1|1774356_1774554_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
QAV73333.1|1774704_1775763_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
QAV73334.1|1776254_1778105_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
QAV73335.1|1778552_1778759_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
QAV73336.1|1778758_1779256_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
QAV73337.1|1779472_1779658_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
QAV73338.1|1780185_1780500_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
QAV73339.1|1780581_1780806_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
QAV73340.1|1780847_1781213_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
QAV73341.1|1781501_1782065_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
QAV73342.1|1782061_1783723_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
QAV73343.1|1783786_1785724_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
QAV73344.1|1785768_1785990_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
QAV73345.1|1785935_1788521_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.6	0.0e+00
QAV73346.1|1788517_1788844_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
QAV73347.1|1788853_1789204_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
QAV73348.1|1789200_1789647_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
QAV73349.1|1789643_1789988_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
QAV73350.1|1790046_1790763_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
QAV73351.1|1790777_1791152_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
QAV76717.1|1791247_1791457_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
QAV73352.1|1791504_1794747_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
QAV73353.1|1794739_1795081_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
QAV73354.1|1795080_1795779_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
QAV73355.1|1795789_1796533_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	6.6e-148
QAV76718.1|1796478_1797111_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
QAV73356.1|1797357_1801194_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	87.2	0.0e+00
QAV73357.1|1801260_1801860_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
QAV73358.1|1801924_1803238_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
QAV73359.1|1803239_1803509_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
QAV73360.1|1805157_1806371_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
QAV73361.1|1810906_1811413_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1810729:1810756	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
QAV76719.1|1811458_1811959_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
QAV73362.1|1812044_1812224_-	hypothetical protein	NA	NA	NA	NA	NA
QAV73363.1|1812604_1813411_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
QAV73364.1|1813410_1814604_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
QAV76720.1|1814615_1815974_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
QAV73365.1|1815977_1817573_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
QAV73366.1|1817572_1819135_-	anthranilate synthase component I	NA	NA	NA	NA	NA
QAV76721.1|1819226_1819271_-	trp operon leader peptide	NA	NA	NA	NA	NA
QAV73367.1|1819408_1820290_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
QAV73368.1|1820286_1820907_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
QAV73369.1|1820934_1822518_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
QAV73370.1|1822730_1823603_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
QAV73371.1|1823642_1824233_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
QAV73372.1|1824229_1824988_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
QAV73373.1|1825207_1826257_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	2098976	2190575	5452210	capsid,holin,head,tail,terminase,portal,transposase,integrase	Enterobacteria_phage(30.56%)	119	2102040:2102099	2147920:2148317
QAV73600.1|2098976_2099180_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
QAV73601.1|2099215_2100676_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
QAV73602.1|2100764_2102048_-	MFS transporter	NA	NA	NA	NA	NA
2102040:2102099	attL	GAAATCCATAATTCATAGATGTTTTTTACTATTCTGTGGGTTTTTGGGTGTTTTCTAAGT	NA	NA	NA	NA
QAV76729.1|2102107_2102422_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
QAV73603.1|2102418_2102553_-|capsid	capsid protein	capsid	NA	NA	NA	NA
QAV73604.1|2102583_2103225_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
QAV73605.1|2103306_2103936_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
QAV73606.1|2104008_2104584_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
QAV73607.1|2104697_2104967_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
QAV73608.1|2104968_2106282_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
QAV73609.1|2106346_2106946_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
QAV73610.1|2107013_2110493_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
QAV76730.1|2110739_2111372_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
QAV73611.1|2111317_2112061_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
QAV73612.1|2112071_2112770_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
QAV73613.1|2112769_2113099_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
QAV73614.1|2113095_2115708_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
QAV73615.1|2115688_2116102_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
QAV73616.1|2116128_2116551_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
QAV73617.1|2116564_2117317_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
QAV73618.1|2117324_2117720_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
QAV73619.1|2117716_2118250_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
QAV73620.1|2118264_2118618_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
QAV73621.1|2118629_2119028_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
QAV73622.1|2119069_2120095_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	9.6e-190
QAV73623.1|2120150_2120483_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
QAV73624.1|2120492_2121812_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
QAV73625.1|2121792_2123394_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
QAV73626.1|2123390_2123597_-|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
QAV73627.1|2123593_2125519_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
QAV73628.1|2125493_2126039_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
QAV73629.1|2126152_2126410_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
QAV73630.1|2126425_2126650_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
QAV73631.1|2126731_2127046_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
QAV73632.1|2127571_2127757_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
QAV73633.1|2127979_2128126_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
QAV73634.1|2128125_2128695_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
QAV73635.1|2128965_2129499_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
QAV76731.1|2129549_2129894_-	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
QAV73636.1|2129898_2130105_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
QAV73637.1|2130553_2132404_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
QAV73638.1|2132881_2133313_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
QAV73639.1|2133763_2134477_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAV73640.1|2134612_2134810_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
QAV73641.1|2135034_2135589_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
QAV73642.1|2135651_2135957_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
QAV73643.1|2135969_2137019_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
QAV73644.1|2137020_2137293_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
QAV73645.1|2137414_2137759_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
QAV73646.1|2137878_2138091_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
QAV73647.1|2138324_2138882_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
QAV73648.1|2138883_2139102_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
QAV73649.1|2139229_2139541_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
QAV73650.1|2139533_2139761_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
QAV73651.1|2139757_2140039_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
QAV73652.1|2140071_2140788_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
QAV76732.1|2140821_2141244_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
QAV73653.1|2141275_2142319_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
QAV73654.1|2142387_2142813_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
QAV73655.1|2142796_2143039_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
QAV76733.1|2143430_2143769_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
QAV76734.1|2144061_2144214_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
QAV73656.1|2144225_2144864_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
QAV73657.1|2144864_2145074_-	hypothetical protein	NA	NA	NA	NA	NA
QAV73658.1|2145638_2145827_+	cell division inhibitor	NA	NA	NA	NA	NA
QAV73659.1|2145823_2146012_+	DUF1482 family protein	NA	NA	NA	NA	NA
QAV73660.1|2146104_2147349_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
QAV73661.1|2147345_2147882_+|integrase	site-specific integrase	integrase	Q859D2	Escherichia_coli_phage	63.0	4.8e-60
QAV76735.1|2147987_2148302_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
QAV73662.1|2149264_2149645_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
2147920:2148317	attR	GAAATCCATAATTCATAGATGTTTTTTACTATTCTGTGGGTTTTTGGGTGTTTTCTAAGTTTTTTCAGATGGTTGTATTTTTTCTAAAAATCCCTAATCTCGATTTTGCTGTTTATTTGAGGCCTTTTTATGTCCCATATATGCCCCACAGATACCCCGCAGCCAAAATCAACAAAATGCCAAAAGGTTCTGTTCCTGCCCTGCAACAAGAAATGCTGCGACGTGTCAGTAAACGTTATGACGATGTAGAAGTGATCATCAAATCCACCAGCAACGATGGCCTTTCAGTTACTCGCACCGCCGATAAAGATTCTGCAAAAACTTTTGTTCAGGAGACGCTGAAAGATACCTGGGAGTCTGCTGACGAGTGGTTTGTTCGCTAATTAACGAGTAAAATC	NA	NA	NA	NA
QAV73663.1|2149641_2149989_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
QAV73664.1|2150038_2151577_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
QAV73665.1|2152159_2152810_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
QAV73666.1|2152794_2153142_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
QAV73667.1|2153519_2154095_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
QAV73668.1|2154208_2154478_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
QAV73669.1|2154479_2155649_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	97.2	3.6e-84
QAV73670.1|2155713_2156313_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
QAV73671.1|2156380_2156596_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
QAV73672.1|2156598_2159859_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
QAV73673.1|2160024_2161237_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
QAV73674.1|2161359_2161797_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
QAV73675.1|2161796_2162138_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
QAV73676.1|2162130_2165373_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
QAV76736.1|2165420_2165630_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
QAV73677.1|2165725_2166100_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
QAV73678.1|2166105_2166822_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
QAV73679.1|2166880_2167225_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
QAV73680.1|2167221_2167668_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
QAV73681.1|2167664_2168015_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
QAV73682.1|2168024_2168351_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
QAV73683.1|2168347_2170933_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.6	0.0e+00
QAV73684.1|2170878_2171100_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
QAV73685.1|2171144_2173082_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
QAV73686.1|2173145_2174807_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.5	0.0e+00
QAV73687.1|2174803_2175367_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
QAV73688.1|2175656_2176022_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
QAV73689.1|2176063_2176291_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
QAV73690.1|2176715_2176901_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
QAV73691.1|2177128_2177275_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
QAV73692.1|2177274_2177844_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
QAV73693.1|2178114_2178648_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
QAV76737.1|2178698_2179043_-	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
QAV73694.1|2179047_2179254_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
QAV73695.1|2179702_2181553_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
QAV73696.1|2182031_2182460_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
QAV73697.1|2182942_2183065_-	antiterminator	NA	NA	NA	NA	NA
QAV73698.1|2183095_2183785_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
QAV73699.1|2183781_2184141_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
QAV73700.1|2184153_2185203_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
QAV73701.1|2185204_2185483_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
QAV73702.1|2185650_2185863_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
QAV73703.1|2186051_2186156_-	hypothetical protein	NA	NA	NA	NA	NA
QAV76738.1|2186271_2186856_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
QAV73704.1|2186912_2187308_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
QAV73705.1|2188118_2188859_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
QAV73706.1|2188865_2189828_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
QAV73707.1|2189850_2190276_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
QAV73708.1|2190272_2190575_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 7
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	2497522	2555263	5452210	transposase,tail,tRNA,integrase	Enterobacteria_phage(63.33%)	63	2497366:2497381	2555342:2555357
2497366:2497381	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
QAV73999.1|2497522_2498494_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
QAV74000.1|2498658_2501088_-	Trimethylamine-N-oxide reductase 2	NA	NA	NA	NA	NA
QAV74001.1|2501112_2502213_-	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
QAV74002.1|2502600_2503347_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
QAV74003.1|2503360_2503927_-	VOC family protein	NA	NA	NA	NA	NA
QAV74004.1|2504142_2505876_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
QAV74005.1|2506052_2506541_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
QAV76754.1|2506660_2507053_-	flagellar protein FlhE	NA	NA	NA	NA	NA
QAV74006.1|2507052_2509131_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
QAV74007.1|2510472_2511117_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
QAV74008.1|2511127_2511517_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
QAV74009.1|2511531_2512581_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
QAV74010.1|2512583_2513444_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
QAV74011.1|2513462_2515064_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
QAV74012.1|2515109_2516771_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
QAV74013.1|2516913_2517417_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
QAV74014.1|2517437_2519402_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
QAV74015.1|2519406_2520333_-	motility protein MotB	NA	NA	NA	NA	NA
QAV74016.1|2520329_2521217_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
QAV74017.1|2521343_2521922_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
QAV74018.1|2521924_2522275_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
QAV74019.1|2523054_2523483_+	universal stress protein UspC	NA	NA	NA	NA	NA
QAV74020.1|2523489_2524914_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
QAV74021.1|2524888_2525689_-	trehalose-phosphatase	NA	NA	NA	NA	NA
QAV76755.1|2525855_2526842_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
QAV74022.1|2526856_2528371_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
QAV74023.1|2528440_2529430_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAV74024.1|2530226_2530730_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
QAV74025.1|2530809_2531061_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
QAV76756.1|2531175_2531262_-	stress response protein AzuC	NA	NA	NA	NA	NA
QAV74026.1|2531523_2531847_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74027.1|2532017_2532515_+	non-heme ferritin	NA	NA	NA	NA	NA
QAV74028.1|2532551_2532791_-	DUF2492 family protein	NA	NA	NA	NA	NA
QAV74029.1|2532982_2534194_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
QAV74030.1|2534255_2534921_-	YecA family protein	NA	NA	NA	NA	NA
QAV74031.1|2535277_2536279_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
QAV74032.1|2536284_2536632_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
QAV74033.1|2536661_2537312_-	hypothetical protein	NA	NA	NA	NA	NA
QAV74034.1|2537327_2537732_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
QAV74035.1|2537821_2537959_-	hypothetical protein	NA	NA	NA	NA	NA
QAV74036.1|2538030_2538234_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
QAV74037.1|2538255_2538606_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
QAV74038.1|2538616_2538895_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
QAV74039.1|2538906_2539149_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
QAV74040.1|2539145_2539259_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
QAV74041.1|2539351_2539768_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74042.1|2539791_2539995_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
QAV74043.1|2539991_2540258_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
QAV74044.1|2540254_2540554_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
QAV74045.1|2540876_2541107_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
QAV74046.1|2541179_2541545_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
QAV74047.1|2541551_2544374_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
QAV74048.1|2544450_2545410_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
QAV74049.1|2545414_2545729_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
QAV74050.1|2546934_2547351_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
QAV74051.1|2547394_2547967_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
QAV74052.1|2548123_2548612_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
QAV74053.1|2551414_2551543_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
QAV74054.1|2551578_2551944_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
QAV74055.1|2551998_2552511_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
QAV74056.1|2552510_2553695_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
QAV74057.1|2553852_2554176_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
QAV74058.1|2554126_2555263_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2555342:2555357	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 8
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	2579166	2654017	5452210	capsid,holin,head,tail,portal,terminase,transposase,integrase	Escherichia_phage(31.25%)	91	2579639:2579653	2658590:2658604
QAV76759.1|2579166_2579418_+|integrase	integrase	integrase	S4TSP2	Salmonella_phage	52.3	6.5e-07
QAV74085.1|2579337_2579652_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
2579639:2579653	attL	TGTATCGCTGACATT	NA	NA	NA	NA
QAV74086.1|2579866_2581525_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
QAV74087.1|2581517_2582513_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
QAV74088.1|2582505_2583192_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
QAV76760.1|2583253_2584627_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
QAV74089.1|2584645_2585089_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
QAV74090.1|2585085_2586213_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
QAV74091.1|2586317_2586782_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
QAV74092.1|2586786_2587791_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
QAV74093.1|2587787_2588201_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
QAV76761.1|2588203_2588569_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
QAV74094.1|2588568_2589306_+	flagellar biosynthesis protein FliP	NA	NA	NA	NA	NA
QAV74095.1|2589315_2589585_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
QAV74096.1|2589592_2590378_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
QAV74097.1|2590667_2591291_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
QAV74098.1|2591334_2591577_-	protein DsrB	NA	NA	NA	NA	NA
QAV74099.1|2591509_2591698_-	hypothetical protein	NA	NA	NA	NA	NA
QAV76762.1|2591685_2591913_+	stress-induced protein YodD	NA	NA	NA	NA	NA
QAV74100.1|2592210_2593026_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
QAV74101.1|2593022_2594717_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
QAV74102.1|2594887_2595070_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
QAV74103.1|2595148_2596066_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
QAV74104.1|2596238_2597159_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
QAV74105.1|2597147_2597618_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
QAV74106.1|2597598_2599017_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
QAV74107.1|2599083_2599779_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
QAV74108.1|2602531_2603383_+	protein deglycase HchA	NA	NA	NA	NA	NA
QAV74109.1|2603490_2604849_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
QAV76763.1|2604848_2605520_-	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
QAV74110.1|2605652_2606066_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
QAV74111.1|2606173_2607178_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
QAV74112.1|2607178_2607814_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
QAV74113.1|2608049_2608721_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
QAV74114.1|2609063_2609594_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
QAV74115.1|2610163_2610523_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74116.1|2610730_2611384_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
QAV74117.1|2611708_2612722_+	Tir-cytoskeleton coupling protein TccP	NA	NA	NA	NA	NA
QAV74118.1|2612847_2613117_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
QAV74119.1|2613118_2614288_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
QAV74120.1|2614352_2614952_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
QAV76764.1|2615019_2617533_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
QAV76765.1|2618733_2619366_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	1.7e-104
QAV74121.1|2619311_2620055_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
QAV74122.1|2620065_2620764_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
QAV74123.1|2620763_2621093_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
QAV74124.1|2621089_2623669_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
QAV74125.1|2623649_2624063_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
QAV74126.1|2624089_2624521_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
QAV74127.1|2624534_2625275_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
QAV74128.1|2625256_2625523_-|capsid	major capsid protein E	capsid	NA	NA	NA	NA
QAV74129.1|2625580_2625928_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
QAV74130.1|2625964_2627470_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
QAV74131.1|2627459_2629052_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
QAV74132.1|2629048_2629255_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
QAV74133.1|2631139_2631649_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
QAV74134.1|2632043_2632268_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
QAV74135.1|2632349_2632664_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
QAV74136.1|2633190_2633376_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
QAV74137.1|2633603_2633735_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
QAV74138.1|2633747_2633930_-	hypothetical protein	NA	NA	NA	NA	NA
QAV74139.1|2634085_2634619_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
QAV74140.1|2634669_2635014_-	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
QAV74141.1|2635018_2635225_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
QAV74142.1|2635544_2636757_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
QAV74143.1|2636839_2638690_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
QAV74144.1|2640076_2640199_-	antiterminator	NA	NA	NA	NA	NA
QAV74145.1|2640229_2640919_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
QAV74146.1|2640915_2641275_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
QAV74147.1|2641287_2642337_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
QAV74148.1|2642338_2642617_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
QAV74149.1|2642557_2642743_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74150.1|2642784_2642997_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
QAV74151.1|2643183_2643288_-	hypothetical protein	NA	NA	NA	NA	NA
QAV74152.1|2643397_2643970_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	92.2	2.5e-46
QAV74153.1|2644096_2644408_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
QAV76766.1|2644404_2644557_-	hypothetical protein	NA	NA	NA	NA	NA
QAV74154.1|2644589_2644946_-	eae-like protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
QAV74155.1|2644942_2645167_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
QAV74156.1|2645188_2645887_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
QAV76767.1|2645921_2646344_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
QAV74157.1|2646375_2647413_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
QAV74158.1|2647481_2647907_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
QAV74159.1|2647903_2648131_-	cell division protein	NA	NA	NA	NA	NA
QAV76768.1|2648228_2648873_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
QAV74160.1|2649147_2649300_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
QAV74161.1|2649780_2649969_+	cell division inhibitor	NA	NA	NA	NA	NA
QAV74162.1|2649965_2650154_+	DUF1482 family protein	NA	NA	NA	NA	NA
QAV74163.1|2650249_2652721_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
QAV74164.1|2652779_2652983_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
QAV74165.1|2652982_2654017_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.1e-99
2658590:2658604	attR	AATGTCAGCGATACA	NA	NA	NA	NA
>prophage 9
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	2812054	2925285	5452210	protease,capsid,holin,head,tail,tRNA,portal,plate,terminase,transposase	Enterobacteria_phage(33.63%)	145	NA	NA
QAV74298.1|2812054_2814088_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
QAV74299.1|2818050_2819331_+	WGR domain-containing protein	NA	NA	NA	NA	NA
QAV74300.1|2820703_2821234_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
QAV74301.1|2821424_2821673_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
QAV74302.1|2821674_2823765_+|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
QAV74303.1|2823835_2824768_+	transcriptional regulator	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
QAV74304.1|2824770_2824992_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74305.1|2825004_2825259_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74306.1|2825260_2825542_+	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
QAV74307.1|2825538_2825811_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74308.1|2825815_2826109_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74309.1|2826120_2826651_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
QAV74310.1|2826748_2827291_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
QAV74311.1|2827294_2827828_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	9.1e-67
QAV74312.1|2827827_2828343_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
QAV74313.1|2828346_2828898_+	AsnC family protein	NA	NA	NA	NA	NA
QAV74314.1|2828894_2829080_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74315.1|2829118_2829451_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74316.1|2829443_2829641_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
QAV74317.1|2829630_2829927_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74318.1|2829923_2830433_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
QAV74319.1|2830502_2830928_+	transcriptional regulator	NA	NA	NA	NA	NA
QAV74320.1|2830999_2831500_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
QAV74321.1|2831534_2831963_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76779.1|2831946_2832165_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74322.1|2832174_2832402_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
QAV74323.1|2832382_2832691_+	DUF2730 family protein	NA	NA	NA	NA	NA
QAV74324.1|2832687_2832978_+	ArsR family transcriptional regulator	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
QAV74325.1|2832980_2833562_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
QAV74326.1|2833561_2835226_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
QAV74327.1|2835225_2836815_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
QAV74328.1|2836798_2838124_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
QAV74329.1|2838242_2838716_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
QAV74330.1|2838892_2840017_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
QAV74331.1|2840016_2840964_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
QAV74332.1|2841007_2841412_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74333.1|2841408_2841828_+	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	53.6	1.4e-33
QAV74334.1|2841824_2842385_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
QAV74335.1|2842385_2842631_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
QAV74336.1|2842627_2844130_+|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
QAV74337.1|2844138_2844504_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
QAV74338.1|2844518_2844995_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
QAV74339.1|2844936_2845119_+	hypothetical protein	NA	C9DGQ0	Escherichia_phage	54.8	3.2e-08
QAV74340.1|2845121_2847197_+|tail	tail tape measure protein	tail	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
QAV76780.1|2847183_2848533_+	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
QAV74341.1|2848516_2849641_+|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
QAV74342.1|2849630_2850245_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
QAV74343.1|2850237_2850675_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
QAV76781.1|2850674_2851757_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
QAV74344.1|2851747_2852308_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
QAV74345.1|2852307_2853219_+|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
QAV74346.1|2853253_2853775_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
QAV74347.1|2853854_2854058_-|tail	phage tail protein	tail	NA	NA	NA	NA
QAV74348.1|2854280_2854841_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
QAV74349.1|2856578_2858117_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
QAV74350.1|2858166_2858514_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
QAV74351.1|2858510_2858891_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
QAV76782.1|2859163_2859430_+	hypothetical protein	NA	Q5MBW4	Stx1-converting_phage	82.8	8.6e-34
QAV74352.1|2859576_2859759_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
QAV74353.1|2859794_2860040_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
QAV74354.1|2860078_2860543_-	hypothetical protein	NA	NA	NA	NA	NA
QAV74355.1|2860657_2860858_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
QAV74356.1|2860811_2861549_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
QAV74357.1|2862272_2865902_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
QAV74358.1|2865963_2866281_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74359.1|2867521_2868610_+	MoxR family ATPase	NA	NA	NA	NA	NA
QAV74360.1|2868620_2870150_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74361.1|2870168_2870900_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74362.1|2870892_2872029_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
QAV74363.1|2872025_2874029_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
QAV74364.1|2874153_2874615_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
QAV74365.1|2874656_2875127_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
QAV74366.1|2875173_2875893_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
QAV74367.1|2875889_2877575_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
QAV74368.1|2878089_2878338_+	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
QAV74369.1|2878334_2878469_-|capsid	capsid protein	capsid	NA	NA	NA	NA
QAV74370.1|2878499_2879141_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
QAV74371.1|2879222_2879624_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	99.2	2.2e-73
QAV74372.1|2879799_2880069_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
QAV74373.1|2880070_2881240_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
QAV74374.1|2881304_2881904_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
QAV76783.1|2881971_2884485_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
QAV76784.1|2885685_2886318_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	1.7e-104
QAV74375.1|2886263_2887007_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
QAV74376.1|2887017_2887716_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
QAV74377.1|2887715_2888045_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
QAV74378.1|2888041_2890687_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
QAV74379.1|2890730_2891039_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
QAV74380.1|2891065_2891488_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
QAV74381.1|2891501_2892254_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
QAV74382.1|2892261_2892660_-|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
QAV74383.1|2892672_2893296_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
QAV74384.1|2893298_2893580_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
QAV74385.1|2893572_2893899_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
QAV74386.1|2893986_2896011_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
QAV74387.1|2895955_2897458_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
QAV74388.1|2897457_2897670_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
QAV74389.1|2897666_2899790_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
QAV74390.1|2899786_2900263_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
QAV74391.1|2900780_2900966_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
QAV74392.1|2901193_2901340_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
QAV74393.1|2901339_2901909_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
QAV74394.1|2902179_2902713_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
QAV74395.1|2902717_2902933_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
QAV74396.1|2903010_2903256_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
QAV74397.1|2903296_2903476_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
QAV74398.1|2903613_2905560_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
QAV74399.1|2906363_2906516_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
QAV74400.1|2906530_2906776_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
QAV74401.1|2906764_2907199_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
QAV74402.1|2907284_2907425_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
QAV74403.1|2907421_2907784_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
QAV74404.1|2907780_2908071_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
QAV74405.1|2908063_2908234_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
QAV74406.1|2908233_2908689_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
QAV74407.1|2908685_2908787_-	hypothetical protein	NA	NA	NA	NA	NA
QAV74408.1|2908877_2909159_-	hypothetical protein	NA	NA	NA	NA	NA
QAV76785.1|2909202_2909400_-	hypothetical protein	NA	NA	NA	NA	NA
QAV74409.1|2909627_2909912_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
QAV74410.1|2909908_2910610_-	Replication protein P	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
QAV76786.1|2910606_2911536_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
QAV74411.1|2911622_2912162_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
QAV74412.1|2912525_2913218_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
QAV74413.1|2913324_2914932_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
QAV74414.1|2915435_2915726_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
QAV74415.1|2915801_2916098_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
QAV74416.1|2916103_2916889_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
QAV74417.1|2916885_2917563_+	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	99.6	6.0e-132
QAV74418.1|2917562_2917745_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
QAV74419.1|2917717_2917909_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
QAV74420.1|2917919_2918201_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
QAV74421.1|2918299_2918521_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
QAV74422.1|2918517_2919465_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
QAV74423.1|2919466_2919643_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
QAV74424.1|2919612_2919900_+	hypothetical protein	NA	NA	NA	NA	NA
QAV74425.1|2919976_2920333_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
QAV74426.1|2920329_2920692_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
QAV74427.1|2920779_2921022_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
QAV74428.1|2921025_2921160_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
QAV74429.1|2921178_2921433_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
QAV74430.1|2921466_2922753_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
QAV74431.1|2922773_2923475_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
QAV74432.1|2923534_2923642_+	protein YohO	NA	NA	NA	NA	NA
QAV74433.1|2923622_2924354_-	ABC transporter permease	NA	NA	NA	NA	NA
QAV74434.1|2924358_2925285_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 10
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	3169564	3174951	5452210	integrase	Enterobacteria_phage(50.0%)	6	3160015:3160031	3171979:3171995
3160015:3160031	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
QAV74638.1|3169564_3170497_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
QAV76793.1|3170808_3171966_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
QAV74639.1|3172140_3173277_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3171979:3171995	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
QAV74640.1|3173286_3173967_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
QAV74641.1|3173953_3174421_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
QAV76794.1|3174420_3174951_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 11
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	3453886	3467323	5452210	tail,holin	Enterobacteria_phage(40.0%)	20	NA	NA
QAV74882.1|3453886_3454369_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
QAV74883.1|3455214_3455463_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
QAV74884.1|3455858_3455978_+	ferredoxin	NA	NA	NA	NA	NA
QAV74885.1|3455964_3456555_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
QAV74886.1|3456737_3457388_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
QAV74887.1|3457466_3458525_+	type III effector	NA	NA	NA	NA	NA
QAV74888.1|3458654_3459077_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
QAV74889.1|3459237_3459507_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
QAV74890.1|3459508_3460075_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
QAV74891.1|3460124_3460472_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
QAV74892.1|3460468_3460849_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
QAV74893.1|3460924_3461155_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.3	2.8e-33
QAV76803.1|3461205_3461550_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
QAV74894.1|3461554_3461770_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
QAV74895.1|3461919_3463773_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
QAV74896.1|3464180_3464348_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
QAV74897.1|3464433_3465177_-	hypothetical protein	NA	NA	NA	NA	NA
QAV74898.1|3465429_3466053_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
QAV74899.1|3466049_3466715_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
QAV74900.1|3466711_3467323_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
>prophage 12
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	5054093	5071208	5452210	transposase,integrase,tRNA,tail	Stx2-converting_phage(38.89%)	21	5055374:5055389	5075353:5075368
QAV76866.1|5054093_5054627_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
QAV76293.1|5055044_5055326_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5055374:5055389	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
QAV76294.1|5055670_5055868_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
QAV76295.1|5056014_5056194_-	methyltransferase	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
QAV76296.1|5056203_5056488_-	class I SAM-dependent methyltransferase	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
QAV76297.1|5056484_5056835_-	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
QAV76298.1|5057304_5058843_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
QAV76299.1|5058892_5059240_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
QAV76300.1|5059236_5059617_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
QAV76301.1|5061133_5061733_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
QAV76302.1|5061797_5063111_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
QAV76303.1|5063112_5063382_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
QAV76304.1|5063493_5064066_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
QAV76305.1|5064138_5064768_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
QAV76306.1|5064849_5065491_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
QAV76307.1|5065651_5065900_-	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
QAV76308.1|5065961_5067059_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
QAV76309.1|5067147_5068185_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
QAV76310.1|5068318_5068561_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
QAV76311.1|5068726_5069710_-	quinone oxidoreductase	NA	NA	NA	NA	NA
QAV76312.1|5069792_5071208_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
5075353:5075368	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 13
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	5208088	5267116	5452210	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
QAV76433.1|5208088_5209348_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
QAV76434.1|5209350_5210355_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
QAV76435.1|5210436_5210634_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
QAV76436.1|5210737_5212036_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
QAV76437.1|5212240_5212666_+	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
QAV76438.1|5212704_5215146_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
QAV76439.1|5215326_5216058_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
QAV76440.1|5216184_5216586_+	DUF2170 family protein	NA	NA	NA	NA	NA
QAV76441.1|5216604_5217303_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
QAV76442.1|5217353_5218013_+	DUF2491 family protein	NA	NA	NA	NA	NA
QAV76443.1|5218030_5218429_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
QAV76444.1|5218438_5219077_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
QAV76445.1|5219079_5220243_+	glutathionylspermidine synthase preATP-grasp family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
QAV76446.1|5220326_5221952_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
QAV76447.1|5222068_5222344_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
QAV76448.1|5222492_5222822_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
QAV76449.1|5223003_5223753_+	esterase	NA	NA	NA	NA	NA
QAV76450.1|5223749_5224505_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
QAV76451.1|5226031_5227429_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
QAV76452.1|5227444_5227750_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
QAV76453.1|5227759_5228224_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
QAV76454.1|5228237_5228888_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
QAV76455.1|5228897_5229752_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
QAV76456.1|5229751_5230438_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
QAV76457.1|5230566_5230842_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
QAV76458.1|5231168_5231564_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
QAV76459.1|5231570_5231885_+	primosomal replication protein N	NA	NA	NA	NA	NA
QAV76460.1|5231889_5232117_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
QAV76461.1|5232158_5232608_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
QAV76462.1|5232678_5233473_-	DUF2686 family protein	NA	NA	NA	NA	NA
QAV76463.1|5234095_5234527_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
QAV76464.1|5234534_5235743_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
QAV76465.1|5235877_5236516_-	cell division protein YtfB	NA	NA	NA	NA	NA
QAV76466.1|5236733_5237354_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
QAV76467.1|5237662_5239075_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
QAV76468.1|5239119_5239782_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
QAV76872.1|5239889_5240855_-	DMT family transporter	NA	NA	NA	NA	NA
QAV76469.1|5240962_5241823_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
QAV76470.1|5241911_5242292_+	transcriptional regulator	NA	NA	NA	NA	NA
QAV76471.1|5242409_5244353_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
QAV76472.1|5244542_5245283_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
QAV76473.1|5245494_5246433_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76474.1|5246495_5247050_-	YtfJ family protein	NA	NA	NA	NA	NA
QAV76475.1|5247374_5247581_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
QAV76476.1|5247676_5249020_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
QAV76477.1|5249342_5249981_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
QAV76478.1|5250186_5251920_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
QAV76479.1|5251916_5255696_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
QAV76480.1|5255698_5256040_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
QAV76481.1|5256251_5256503_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
QAV76482.1|5256496_5256847_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
QAV76483.1|5256926_5257457_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
QAV76484.1|5257766_5258723_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAV76485.1|5258862_5260365_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
QAV76873.1|5260378_5261401_+	ABC transporter permease	NA	NA	NA	NA	NA
QAV76486.1|5261387_5262383_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
QAV76487.1|5262415_5263414_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
QAV76488.1|5263589_5264963_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
QAV76489.1|5265118_5265670_-	ribosome-associated protein	NA	NA	NA	NA	NA
QAV76490.1|5265763_5267116_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 14
CP035366	Escherichia coli O157:H7 strain C1-057 chromosome, complete genome	5452210	5299554	5312130	5452210	integrase	Enterobacteria_phage(81.82%)	17	5294587:5294602	5313082:5313097
5294587:5294602	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
QAV76517.1|5299554_5300829_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
QAV76518.1|5300996_5301302_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAV76876.1|5301378_5302113_+	restriction endonuclease	NA	NA	NA	NA	NA
QAV76519.1|5302150_5303395_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
QAV76520.1|5303404_5303668_-	hypothetical protein	NA	NA	NA	NA	NA
QAV76521.1|5303720_5304293_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
QAV76522.1|5304366_5304867_-	transactivation protein	NA	NA	NA	NA	NA
QAV76523.1|5304863_5305598_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
QAV76524.1|5306149_5306416_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
QAV76525.1|5306412_5307003_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
QAV76526.1|5306995_5307283_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
QAV76527.1|5307275_5307731_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
QAV76528.1|5307866_5308187_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76529.1|5308201_5310535_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
QAV76530.1|5310595_5310829_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76531.1|5310749_5311085_+|integrase	integrase	integrase	Q38404	Enterobacteria_phage	100.0	2.7e-24
QAV76877.1|5311302_5312130_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	40.4	4.3e-55
5313082:5313097	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 1
CP035367	Escherichia coli O157:H7 strain C1-057 plasmid pC1-057, complete sequence	97494	29207	88852	97494	integrase,transposase,protease	Escherichia_phage(23.81%)	57	25777:25790	33479:33492
25777:25790	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
QAV76911.1|29207_30014_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
QAV76969.1|30690_30771_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
QAV76912.1|31331_32544_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
QAV76913.1|32608_33364_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
QAV76914.1|33951_35118_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
33479:33492	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
QAV76915.1|35117_36089_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
QAV76916.1|36387_36660_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76970.1|36697_37600_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
QAV76917.1|37603_37909_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76918.1|37985_38669_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
QAV76919.1|38669_38891_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76920.1|38784_39339_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
QAV76972.1|40033_40606_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
QAV76971.1|40701_41004_+	antirestriction protein	NA	NA	NA	NA	NA
QAV76921.1|41470_41662_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76973.1|41780_42170_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76922.1|42137_42395_-	hypothetical protein	NA	NA	NA	NA	NA
QAV76923.1|42657_42888_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76924.1|42939_44301_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
QAV76925.1|44347_44911_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
QAV76926.1|44996_45440_-	hypothetical protein	NA	NA	NA	NA	NA
QAV76927.1|45509_45716_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
QAV76928.1|45741_46194_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
QAV76929.1|46250_46484_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
QAV76930.1|46549_48508_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
QAV76974.1|48562_48997_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
QAV76931.1|48993_49755_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
QAV76932.1|49986_50145_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
QAV76933.1|50326_52300_+	NikB	NA	NA	NA	NA	NA
QAV76934.1|52367_52799_+	tolA family protein	NA	NA	NA	NA	NA
QAV76935.1|54550_64060_+	toxin B	NA	NA	NA	NA	NA
QAV76936.1|64812_66025_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
QAV76937.1|65991_66102_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.1e-07
QAV76938.1|66367_66748_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
QAV76939.1|66744_67092_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
QAV76940.1|67141_68680_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
QAV76941.1|70081_70828_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
QAV76942.1|70886_71747_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
QAV76943.1|71849_72410_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
QAV76944.1|72542_72755_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
QAV76945.1|72999_73461_+	endonuclease	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
QAV76946.1|73506_73716_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
QAV76947.1|73753_74092_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76948.1|74331_74586_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
QAV76976.1|74629_74740_-	replication protein RepA	NA	NA	NA	NA	NA
QAV76975.1|74821_74896_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
QAV76949.1|74888_75746_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
QAV76950.1|76107_76302_+	replication protein	NA	NA	NA	NA	NA
QAV76951.1|76317_76449_-	replication protein RepA4	NA	NA	NA	NA	NA
QAV76952.1|76656_76941_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
QAV76953.1|76940_77216_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
QAV76954.1|77310_77517_+	hypothetical protein	NA	NA	NA	NA	NA
QAV76955.1|79219_81430_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
QAV76956.1|81473_81863_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
QAV76957.1|82873_82969_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.8e-07
QAV76958.1|83088_86991_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
QAV76959.1|87313_88852_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
