The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026366	Micrococcus luteus strain SB1254 chromosome, complete genome	2553002	119430	185795	2553002	transposase,tRNA,holin	Corynebacterium_phage(27.27%)	56	NA	NA
QAV28009.1|119430_121257_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
QAV28010.1|121379_122312_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAV28011.1|122286_123438_-	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase	NA	NA	NA	NA	NA
QAV28012.1|123576_124944_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
QAV28013.1|126314_127937_-	cation acetate symporter	NA	NA	NA	NA	NA
QAV28014.1|127933_128308_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
QAV28015.1|128509_129388_-	CoA ester lyase	NA	NA	NA	NA	NA
QAV28016.1|129384_129915_-	dehydratase	NA	NA	NA	NA	NA
QAV28017.1|129916_131104_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
QAV28018.1|131119_133258_-	acetyl/propionyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
QAV28019.1|133265_134882_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	62.5	2.4e-17
QAV28020.1|134995_135643_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAV28021.1|135702_136221_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAV28022.1|136326_137766_-	branched-chain alpha-keto acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
QAV28023.1|137762_138830_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
QAV28024.1|138826_139981_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
QAV28025.1|140136_140736_-	cell division protein DivIVA	NA	NA	NA	NA	NA
QAV28026.1|141646_142204_-	ribosome recycling factor	NA	NA	NA	NA	NA
QAV29929.1|142257_143025_-	UMP kinase	NA	NA	NA	NA	NA
QAV28027.1|143232_144069_-	elongation factor Ts	NA	NA	NA	NA	NA
QAV28028.1|144172_145030_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
QAV28029.1|145434_146109_+	M23 family peptidase	NA	NA	NA	NA	NA
QAV29930.1|146044_147241_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
QAV28030.1|147553_148438_+	peptidoglycan endopeptidase	NA	C1KFN7	Lactobacillus_virus	39.0	6.6e-14
QAV28031.1|148618_149839_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
QAV28032.1|149963_150470_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
QAV28033.1|150611_151535_-|holin	phage holin family protein	holin	NA	NA	NA	NA
QAV28034.1|151666_152500_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	45.8	5.2e-61
QAV28035.1|152580_153651_-	nucleoside hydrolase	NA	NA	NA	NA	NA
QAV28036.1|153647_154577_-	NAD(P)-dependent dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	48.4	5.3e-62
QAV28037.1|154657_155314_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
QAV28038.1|155401_156247_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
QAV28039.1|156918_157524_-	cadmium transporter	NA	NA	NA	NA	NA
QAV28040.1|157520_157838_-	transcriptional regulator	NA	NA	NA	NA	NA
QAV28041.1|159455_160709_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.5	2.4e-81
QAV28042.1|160860_161100_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28043.1|161268_161706_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28044.1|161788_163528_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
QAV28045.1|163541_164264_+	aquaporin family protein	NA	NA	NA	NA	NA
QAV28046.1|164337_165849_+	glycerol kinase	NA	NA	NA	NA	NA
QAV28047.1|165963_166185_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28048.1|166271_167177_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
QAV28049.1|167763_169107_-|transposase	IS256-like element ISMlu11 family transposase	transposase	A0A218MNI5	uncultured_virus	38.1	1.4e-36
QAV28050.1|169174_169762_-	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	38.8	1.2e-24
QAV28051.1|169758_170109_-	hypothetical protein	NA	B6ETC4	Enterobacteria_phage	46.2	2.9e-13
QAV28052.1|170126_171347_+|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	8.7e-81
QAV28053.1|176246_176747_-	signal peptidase (SPase) II	NA	NA	NA	NA	NA
QAV29931.1|176900_178898_-	cation-transporting P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.9	3.4e-90
QAV29932.1|178852_179215_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
QAV28054.1|179367_180117_+	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
QAV28055.1|180159_180900_+	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
QAV29933.1|181069_181621_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28056.1|181675_182053_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
QAV28057.1|182083_182992_+	cation transporter	NA	NA	NA	NA	NA
QAV28058.1|183202_184210_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
QAV28059.1|184541_185795_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.5	2.4e-81
>prophage 2
CP026366	Micrococcus luteus strain SB1254 chromosome, complete genome	2553002	272926	316396	2553002	transposase,tRNA	Corynebacterium_phage(22.22%)	37	NA	NA
QAV28127.1|272926_273502_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
QAV28128.1|273509_274112_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
QAV29941.1|274297_275425_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28129.1|275776_277180_+	chain length determinant protein	NA	A0A1X9I5E1	Streptococcus_phage	27.3	1.6e-06
QAV28130.1|277351_277909_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28131.1|278206_279640_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
QAV28132.1|279653_280649_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.8	3.3e-78
QAV28133.1|280698_281511_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28134.1|281736_282990_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.3	1.5e-80
QAV28135.1|283024_283891_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28136.1|283981_284989_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
QAV28137.1|285115_286105_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28138.1|286175_287114_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
QAV28139.1|287117_288086_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	32.0	1.4e-36
QAV28140.1|288082_289063_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
QAV29942.1|289059_289497_-	acetyltransferase	NA	NA	NA	NA	NA
QAV28141.1|289568_290546_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28142.1|290542_291706_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
QAV28143.1|291842_292712_+	glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	57.9	9.2e-93
QAV28144.1|292815_293610_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28145.1|293721_294864_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
QAV28146.1|294873_295836_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
QAV28147.1|295852_296890_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
QAV28148.1|296886_298017_-	glycosyl transferase	NA	NA	NA	NA	NA
QAV28149.1|298013_300257_-	acetylneuraminic acid synthetase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	32.6	8.6e-26
QAV28150.1|300253_301045_-	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
QAV28151.1|301041_302163_-	RNA-binding protein	NA	NA	NA	NA	NA
QAV28152.1|302159_303221_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28153.1|303217_304141_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
QAV28154.1|305685_306765_+	catalase	NA	NA	NA	NA	NA
QAV28155.1|306789_307506_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28156.1|309126_310413_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
QAV28157.1|310602_311784_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.5	1.4e-30
QAV28158.1|311796_313050_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.0	4.4e-80
QAV28159.1|313445_314396_-|transposase	transposase	transposase	NA	NA	NA	NA
QAV28160.1|314392_314710_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAV29943.1|315245_316396_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.0e-38
>prophage 3
CP026366	Micrococcus luteus strain SB1254 chromosome, complete genome	2553002	1078778	1163906	2553002	transposase,integrase	Corynebacterium_phage(25.0%)	78	1101480:1101502	1152159:1152181
QAV28762.1|1078778_1080122_+|transposase	IS256-like element ISMlu11 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	2.5e-36
QAV28763.1|1080205_1081459_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	42.7	8.9e-81
QAV29977.1|1081747_1082989_+|transposase	transposase	transposase	NA	NA	NA	NA
QAV28764.1|1082975_1083899_+	ATP-binding protein	NA	H7BVK2	unidentified_phage	28.7	2.0e-05
QAV28765.1|1084127_1085573_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.2	2.5e-42
QAV28766.1|1085648_1087037_+	flavoprotein oxidoreductase	NA	NA	NA	NA	NA
QAV28767.1|1087122_1087521_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
QAV28768.1|1087700_1088060_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
QAV28769.1|1088056_1088659_+	cadmium transporter	NA	NA	NA	NA	NA
QAV28770.1|1089007_1089394_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28771.1|1089893_1090295_-	hypothetical protein	NA	NA	NA	NA	NA
QAV29978.1|1090522_1091815_+	MFS transporter	NA	NA	NA	NA	NA
QAV28772.1|1091954_1092530_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28773.1|1092705_1093338_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
QAV28774.1|1093365_1094787_-	flavoprotein	NA	NA	NA	NA	NA
QAV28775.1|1094779_1095793_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	52.1	9.1e-76
QAV28776.1|1095807_1096248_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	39.4	2.5e-14
QAV28777.1|1096291_1096735_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
QAV28778.1|1096763_1097885_-	arsenical-resistance protein	NA	NA	NA	NA	NA
QAV28779.1|1098019_1098331_+	transcriptional regulator	NA	NA	NA	NA	NA
QAV28780.1|1098369_1099485_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	44.7	1.7e-59
QAV28781.1|1099656_1100910_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.5	2.4e-81
1101480:1101502	attL	TGTCGAGATGCAGCGAAGAGTTC	NA	NA	NA	NA
QAV28782.1|1102000_1103254_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.3	1.5e-80
QAV28783.1|1103344_1104811_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
QAV28784.1|1105559_1106510_-|transposase	transposase	transposase	NA	NA	NA	NA
QAV28785.1|1106506_1106824_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAV28786.1|1107345_1108599_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.3	1.5e-80
QAV28787.1|1108696_1109449_-	N-acetyltransferase	NA	NA	NA	NA	NA
QAV28788.1|1109625_1110075_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
QAV28789.1|1110084_1110531_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28790.1|1111117_1112074_-	EamA family transporter	NA	NA	NA	NA	NA
QAV28791.1|1113749_1114520_-	transcriptional regulator	NA	NA	NA	NA	NA
QAV28792.1|1114694_1115594_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAV28793.1|1115904_1116648_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.4e-25
QAV28794.1|1116647_1117970_+	permease	NA	NA	NA	NA	NA
QAV28795.1|1118013_1119036_+	YdcF family protein	NA	NA	NA	NA	NA
QAV28796.1|1119261_1120050_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
QAV28797.1|1121394_1122738_-|transposase	IS256-like element ISMlu11 family transposase	transposase	A0A218MNI5	uncultured_virus	38.1	1.4e-36
QAV28798.1|1122800_1123508_+	transcriptional regulator	NA	NA	NA	NA	NA
QAV28799.1|1123524_1124157_+	LysE family translocator	NA	NA	NA	NA	NA
QAV28800.1|1124638_1125052_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
QAV28801.1|1126044_1126491_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
QAV29979.1|1126633_1127647_+|integrase	integrase	integrase	A0A220NQQ9	Corynebacterium_phage	32.3	2.9e-13
QAV29980.1|1127838_1129119_+|integrase	integrase	integrase	NA	NA	NA	NA
QAV28802.1|1129118_1129508_+|transposase	transposase	transposase	NA	NA	NA	NA
QAV29981.1|1129639_1129912_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28803.1|1130425_1130782_+	nucleoid-associated protein Lsr2	NA	A0A068F3E9	Mycobacterium_phage	33.3	2.0e-06
QAV28804.1|1130891_1132127_+	divalent metal cation transporter	NA	NA	NA	NA	NA
QAV28805.1|1132143_1132824_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
QAV28806.1|1133030_1133600_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAV28807.1|1133617_1135159_-	MFS transporter	NA	NA	NA	NA	NA
QAV28808.1|1135363_1135939_+	resolvase	NA	G8I4U3	Mycobacterium_phage	37.9	3.3e-22
QAV28809.1|1136034_1136340_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28810.1|1136468_1137476_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
QAV29982.1|1137752_1138903_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	3.5e-39
QAV28811.1|1139282_1140176_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28812.1|1140175_1141672_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28813.1|1141668_1142742_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28814.1|1142741_1144943_-|integrase	integrase	integrase	NA	NA	NA	NA
QAV28815.1|1144927_1145674_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28816.1|1146861_1147551_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28817.1|1147635_1148982_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28818.1|1149084_1149579_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28819.1|1149723_1150566_-	chromosome condensation regulator	NA	NA	NA	NA	NA
QAV28820.1|1150562_1151276_-	sulfatase	NA	A0A075BUR2	Microcystis_phage	38.9	6.5e-20
QAV28821.1|1151395_1152025_-	hypothetical protein	NA	NA	NA	NA	NA
QAV28822.1|1152329_1152995_+	BioY family protein	NA	NA	NA	NA	NA
1152159:1152181	attR	GAACTCTTCGCTGCATCTCGACA	NA	NA	NA	NA
QAV28823.1|1152991_1153753_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
QAV28824.1|1153752_1154388_+	cobalt transporter	NA	NA	NA	NA	NA
QAV28825.1|1154424_1154877_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
QAV28826.1|1155002_1155824_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28827.1|1155830_1158362_-	ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.4	2.5e-21
QAV28828.1|1158455_1159022_-	DinB family protein	NA	NA	NA	NA	NA
QAV28829.1|1159305_1160451_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.5	1.8e-35
QAV28830.1|1160536_1161646_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
QAV28831.1|1161898_1162183_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28832.1|1162391_1162574_+	hypothetical protein	NA	NA	NA	NA	NA
QAV28833.1|1163011_1163906_-|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	1.1e-16
>prophage 4
CP026366	Micrococcus luteus strain SB1254 chromosome, complete genome	2553002	2325886	2377685	2553002	protease,tRNA,head,integrase,capsid	Gordonia_phage(20.83%)	55	2353990:2354008	2361790:2361808
QAV29722.1|2325886_2328565_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	37.4	7.6e-162
QAV30034.1|2328925_2329261_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29723.1|2329344_2329962_-	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
QAV29724.1|2330024_2331323_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	8.0e-133
QAV29725.1|2331490_2332156_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	47.4	3.8e-38
QAV29726.1|2332197_2332815_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.9	1.2e-41
QAV29727.1|2333079_2334444_-	trigger factor	NA	NA	NA	NA	NA
QAV29728.1|2334643_2335537_-	KR domain-containing protein	NA	NA	NA	NA	NA
QAV29729.1|2335806_2336718_-	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	27.9	4.4e-05
QAV29730.1|2336718_2337192_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
QAV30035.1|2337278_2338832_-	4-hydroxyacetophenone monooxygenase	NA	NA	NA	NA	NA
QAV29731.1|2338858_2339713_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
QAV29732.1|2339843_2340665_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29733.1|2340802_2343442_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	27.3	1.3e-41
QAV29734.1|2343532_2344606_+	hemoglobin	NA	NA	NA	NA	NA
QAV29735.1|2344644_2345355_-	hypothetical protein	NA	NA	NA	NA	NA
QAV29736.1|2346641_2348324_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.7	3.1e-44
QAV29737.1|2348422_2348971_-	single-stranded DNA-binding protein	NA	A0A1V0E648	Streptomyces_phage	45.0	5.4e-14
QAV29738.1|2349359_2350805_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29739.1|2350841_2352227_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
QAV29740.1|2352223_2353951_-	hypothetical protein	NA	NA	NA	NA	NA
QAV29741.1|2353947_2355603_-	hypothetical protein	NA	NA	NA	NA	NA
2353990:2354008	attL	GGCCAGGCCGGCGCGCACG	NA	NA	NA	NA
QAV29742.1|2355693_2356320_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	27.7	8.3e-11
QAV29743.1|2356611_2357802_+|integrase	site-specific integrase	integrase	A0A1B3AYT2	Gordonia_phage	34.9	3.2e-43
QAV29744.1|2357902_2358175_-	DUF3263 domain-containing protein	NA	NA	NA	NA	NA
QAV29745.1|2358205_2358619_-	ImmA/IrrE family metallo-endopeptidase	NA	Q854V5	Mycobacterium_virus	43.2	1.5e-13
QAV29746.1|2359479_2359776_+	XRE family transcriptional regulator	NA	A0A2D1GA98	Mycobacterium_phage	51.6	4.3e-18
QAV29747.1|2359772_2360558_+	phage antirepressor protein	NA	M4ZRI7	Bacillus_phage	39.3	1.0e-37
QAV29748.1|2360554_2360863_+	hypothetical protein	NA	A0A2P1CIN2	Microbacterium_phage	62.1	6.2e-28
QAV29749.1|2360859_2361108_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29750.1|2361104_2361374_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29751.1|2361431_2361686_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29752.1|2362012_2362441_-	hypothetical protein	NA	NA	NA	NA	NA
2361790:2361808	attR	CGTGCGCGCCGGCCTGGCC	NA	NA	NA	NA
QAV29753.1|2362455_2362797_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29754.1|2362796_2363147_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29755.1|2364130_2364322_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29756.1|2364314_2364776_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29757.1|2364772_2365279_+	SAM-dependent methyltransferase	NA	A0A1B3AYU9	Gordonia_phage	72.4	5.1e-59
QAV29758.1|2365275_2365641_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29759.1|2365637_2366525_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29760.1|2366605_2366824_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29761.1|2366816_2367119_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29762.1|2367115_2367517_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29763.1|2367509_2367893_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29764.1|2367892_2369215_+	hypothetical protein	NA	A0A1C9EI32	Gordonia_phage	39.7	1.4e-39
QAV30036.1|2369243_2369525_+	VRR-NUC domain-containing protein	NA	A0A1B1INA9	uncultured_Mediterranean_phage	42.7	3.2e-15
QAV29765.1|2369738_2370389_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29766.1|2370623_2370893_+	hypothetical protein	NA	A0A2H4PD62	Mycobacterium_phage	65.0	5.5e-20
QAV29767.1|2371055_2371538_+	hypothetical protein	NA	NA	NA	NA	NA
QAV29768.1|2371524_2373027_+	hypothetical protein	NA	A0A1B3AZV7	Gordonia_phage	40.4	7.4e-90
QAV29769.1|2373043_2373352_+	hypothetical protein	NA	A0A0U4JXJ2	Arthrobacter_phage	46.2	2.4e-11
QAV29770.1|2373365_2374229_+	hypothetical protein	NA	A0A222ZFM5	Arthrobacter_phage	55.7	1.2e-81
QAV29771.1|2374225_2375662_+	hypothetical protein	NA	A0A0U4K705	Arthrobacter_phage	39.2	3.9e-64
QAV29772.1|2375561_2376332_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D8ETC5	Propionibacterium_phage	56.4	1.6e-64
QAV29773.1|2376383_2377685_+|capsid	phage major capsid protein	capsid	A0A0U4JAL0	Arthrobacter_phage	66.0	5.0e-151
