The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	802612	867762	5086302	protease,transposase	Escherichia_phage(30.77%)	56	NA	NA
QAU15289.1|802612_803107_+|protease	hydrogenase 2 maturation protease	protease	NA	NA	NA	NA
QAU15290.1|803099_803588_+	hydrogenase-2 operon protein HybE	NA	NA	NA	NA	NA
QAU15291.1|803580_803922_+	hydrogenase nickel incorporation protein	NA	NA	NA	NA	NA
QAU15292.1|803934_804183_+	hydrogenase-2 operon protein HybG	NA	NA	NA	NA	NA
QAU15293.1|804305_805172_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
QAU15294.1|805376_807236_+	bifunctional glutathionylspermidine amidase/synthase	NA	NA	NA	NA	NA
QAU15295.1|807527_809027_+	low-affinity inorganic phosphate transporter 2	NA	NA	NA	NA	NA
QAU15296.1|809075_809768_-	thymidylate kinase	NA	NA	NA	NA	NA
QAU15297.1|811279_815848_+	accessory colonization factor AcfD	NA	NA	NA	NA	NA
QAU15298.1|815922_816036_+	prepilin peptidase A domain protein	NA	NA	NA	NA	NA
QAU15299.1|816045_816855_+	prepilin peptidase	NA	NA	NA	NA	NA
QAU15300.1|816920_817331_+	hypothetical protein	NA	NA	NA	NA	NA
QAU15301.1|817348_818308_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
QAU15302.1|818337_820398_+	type II secretion system protein GspD	NA	NA	NA	NA	NA
QAU15303.1|820397_821891_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
QAU15304.1|821890_823114_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
QAU15305.1|823130_823586_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
QAU15306.1|823589_824153_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
QAU15307.1|824149_824521_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
QAU15308.1|824517_825123_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
QAU15309.1|825119_826097_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
QAU15310.1|826093_827272_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
QAU15311.1|827273_827810_+	type II secretion system protein	NA	NA	NA	NA	NA
QAU15312.1|828744_829761_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
QAU15313.1|830436_830808_+	hypothetical protein	NA	NA	NA	NA	NA
QAU15314.1|830834_832580_+	polysaccharide export protein	NA	NA	NA	NA	NA
QAU15315.1|832646_833447_+	ABC transporter	NA	NA	NA	NA	NA
QAU15316.1|833458_834109_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	1.5e-07
QAU15317.1|834122_835325_+	sugar transporter	NA	NA	NA	NA	NA
QAU15318.1|835465_838195_+	family 2 glycosyl transferase	NA	A0A0E3FKP5	Synechococcus_phage	35.4	1.4e-06
QAU19075.1|838200_840615_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
QAU15319.1|840631_841834_+	hypothetical protein	NA	NA	NA	NA	NA
QAU15320.1|842030_843197_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.5	4.2e-117
QAU15321.1|843832_844738_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
QAU15322.1|844841_846863_+	glycosyltransferase	NA	NA	NA	NA	NA
QAU15323.1|846850_847882_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
QAU15324.1|847945_848962_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
QAU15325.1|849350_850436_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.4	1.3e-96
QAU15326.1|850435_851323_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.5	4.3e-29
QAU15327.1|851403_852282_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	2.4e-104
QAU15328.1|852348_852900_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	4.7e-50
QAU15329.1|852949_855097_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
QAU15330.1|856258_857479_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
QAU19076.1|857501_857738_-	hypothetical protein	NA	NA	NA	NA	NA
QAU15331.1|857840_858017_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
QAU15332.1|858460_858838_-	toxin	NA	NA	NA	NA	NA
QAU15333.1|859368_859590_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
QAU15334.1|859658_860135_-	DNA repair protein RadC	NA	NA	NA	NA	NA
QAU15335.1|860150_860636_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
QAU15336.1|860690_861509_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	3.9e-45
QAU19077.1|861529_861664_-	cytoplasmic protein	NA	NA	NA	NA	NA
QAU15337.1|861663_861822_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
QAU15338.1|861892_864739_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
QAU19078.1|865140_865401_+|transposase	transposase	transposase	NA	NA	NA	NA
QAU15339.1|865584_866858_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
QAU15340.1|866823_867762_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	1375993	1410484	5086302	integrase,tail,terminase	Escherichia_phage(48.57%)	38	1358895:1358910	1397411:1397426
1358895:1358910	attL	GCGTGAAATTGATGAC	NA	NA	NA	NA
QAU15779.1|1375993_1377460_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
QAU15780.1|1377528_1379106_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
QAU15781.1|1379298_1380549_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	3.0e-238
QAU15782.1|1380552_1380747_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	9.7e-27
QAU15783.1|1380743_1381394_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	100.0	5.0e-128
QAU19101.1|1381386_1381638_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
QAU15784.1|1381795_1382044_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
QAU15785.1|1382093_1383035_-	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	100.0	4.5e-178
QAU15786.1|1383031_1383853_-	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	100.0	1.2e-163
QAU15787.1|1383849_1384149_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.4e-45
QAU15788.1|1384457_1385042_-	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
QAU15789.1|1385196_1385427_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
QAU15790.1|1385577_1385778_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
QAU15791.1|1385793_1386609_+	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
QAU15792.1|1386605_1387391_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
QAU15793.1|1387508_1387856_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	5.9e-59
QAU15794.1|1387917_1388397_+	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	54.2	1.5e-28
QAU15795.1|1388393_1388939_+	hypothetical protein	NA	J9Q748	Salmonella_phage	83.2	3.2e-83
QAU15796.1|1388935_1389235_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.4e-56
QAU15797.1|1389236_1390001_+	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	95.6	2.4e-68
QAU15798.1|1390174_1390438_+	hypothetical protein	NA	NA	NA	NA	NA
QAU15799.1|1390514_1391444_+	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	50.6	7.9e-66
QAU15800.1|1391936_1392611_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
QAU15801.1|1392607_1394077_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	97.4	1.2e-289
QAU15802.1|1394081_1394687_-	hypothetical protein	NA	NA	NA	NA	NA
QAU15803.1|1395448_1395655_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
QAU15804.1|1395669_1397349_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.1e-302
QAU15805.1|1397345_1397642_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
1397411:1397426	attR	GCGTGAAATTGATGAC	NA	NA	NA	NA
QAU15806.1|1397644_1398340_+	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
QAU15807.1|1398354_1399341_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	94.5	2.5e-179
QAU15808.1|1399392_1399830_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	94.5	1.9e-70
QAU15809.1|1399840_1400176_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
QAU15810.1|1400232_1400838_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
QAU15811.1|1400837_1403309_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
QAU15812.1|1403308_1403773_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.1e-84
QAU15813.1|1403772_1404348_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
QAU15814.1|1404347_1407095_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.5	1.2e-117
QAU15815.1|1407094_1410484_+	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.8	3.4e-183
>prophage 3
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	1414619	1421375	5086302	holin	Escherichia_phage(87.5%)	9	NA	NA
QAU15822.1|1414619_1414877_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
QAU19104.1|1417281_1417578_+	hypothetical protein	NA	NA	NA	NA	NA
QAU15823.1|1417800_1418205_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
QAU15824.1|1418191_1418500_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
QAU15825.1|1418489_1419119_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	1.8e-114
QAU15826.1|1419115_1419598_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	90.0	3.2e-71
QAU15827.1|1419817_1420357_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	96.6	2.9e-44
QAU15828.1|1420372_1420888_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
QAU15829.1|1421201_1421375_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 4
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	1814216	1823658	5086302		Enterobacteria_phage(85.71%)	10	NA	NA
QAU16166.1|1814216_1815143_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
QAU16167.1|1815147_1815879_+	ABC transporter permease	NA	NA	NA	NA	NA
QAU16168.1|1815859_1815967_-	protein YohO	NA	NA	NA	NA	NA
QAU16169.1|1816026_1816758_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
QAU16170.1|1816979_1818665_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
QAU16171.1|1818661_1819381_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
QAU16172.1|1819427_1819898_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
QAU16173.1|1819938_1820400_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
QAU16174.1|1820524_1822525_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
QAU16175.1|1822521_1823658_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
>prophage 5
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	1835568	1901410	5086302	portal,plate,holin,tRNA,tail,integrase,terminase,head,capsid,lysis	Escherichia_phage(42.55%)	76	1862715:1862742	1896337:1896364
QAU16181.1|1835568_1837602_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
QAU16182.1|1837733_1838843_+	protein mrp	NA	NA	NA	NA	NA
QAU16183.1|1839105_1839387_+	DUF2574 family protein	NA	NA	NA	NA	NA
QAU16184.1|1839682_1840225_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
QAU16185.1|1840305_1840980_+	fimbrial assembly protein	NA	NA	NA	NA	NA
QAU16186.1|1840995_1843476_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
QAU19112.1|1843486_1844521_+	pilus assembly protein	NA	NA	NA	NA	NA
QAU16187.1|1844602_1844941_-	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
QAU16188.1|1845159_1845963_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
QAU16189.1|1846083_1846356_+	transcriptional regulator	NA	NA	NA	NA	NA
QAU16190.1|1846578_1847367_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
QAU16191.1|1847363_1848164_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
QAU16192.1|1848228_1849047_+	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
QAU16193.1|1849098_1849845_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QAU16194.1|1849818_1850784_-	sugar kinase	NA	NA	NA	NA	NA
QAU16195.1|1850780_1851785_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	9.9e-14
QAU16196.1|1851781_1853059_-	MFS transporter	NA	NA	NA	NA	NA
QAU16197.1|1853315_1854368_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
QAU16198.1|1854594_1855449_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
QAU16199.1|1855477_1856740_+	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
QAU16200.1|1856749_1857202_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
QAU16201.1|1857232_1857517_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
QAU16202.1|1857520_1858876_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
QAU16203.1|1858924_1859965_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
QAU16204.1|1860064_1860844_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
QAU16205.1|1860925_1861825_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
QAU16206.1|1862239_1862557_+	hypothetical protein	NA	NA	NA	NA	NA
QAU16207.1|1862544_1862724_+	hypothetical protein	NA	NA	NA	NA	NA
1862715:1862742	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
QAU16208.1|1862821_1863835_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
QAU16209.1|1863950_1864250_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
QAU16210.1|1864371_1864647_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
QAU19113.1|1864824_1865325_+	replication protein B	NA	M1SV55	Escherichia_phage	99.4	1.0e-91
QAU16211.1|1865388_1865613_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
QAU16212.1|1865612_1865915_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	97.0	2.5e-45
QAU16213.1|1865914_1866139_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	5.0e-35
QAU16214.1|1866135_1866414_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.8	2.0e-41
QAU16215.1|1866410_1867418_+	hypothetical protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	8.5e-66
QAU16216.1|1867414_1869706_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
QAU16217.1|1869702_1870032_+	DUF3850 domain-containing protein	NA	Q7Y4B7	Escherichia_virus	97.3	3.3e-35
QAU16218.1|1870070_1870832_-	hypothetical protein	NA	P79670	Escherichia_phage	99.2	1.0e-140
QAU16219.1|1871006_1872767_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
QAU16220.1|1873149_1874184_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
QAU16221.1|1874183_1875956_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
QAU16222.1|1876129_1876984_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
QAU16223.1|1877042_1878116_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.7	3.0e-202
QAU16224.1|1878119_1878863_+|terminase	terminase	terminase	Q858W5	Yersinia_virus	98.8	4.6e-125
QAU16225.1|1878962_1879472_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
QAU16226.1|1879471_1879675_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
QAU16227.1|1879678_1879960_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
QAU16228.1|1879959_1880457_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
QAU16229.1|1880471_1880897_+	protein lysA	NA	Q858W1	Yersinia_virus	88.7	3.3e-59
QAU16230.1|1880884_1881310_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.0	1.2e-64
QAU16231.1|1881281_1881455_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
QAU16232.1|1881417_1881885_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	2.5e-81
QAU16233.1|1881877_1882330_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	1.2e-75
QAU16234.1|1882396_1883032_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	97.2	3.6e-110
QAU16235.1|1883028_1883376_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
QAU16236.1|1883380_1884289_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
QAU16237.1|1884281_1884812_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	2.3e-102
QAU16238.1|1884822_1886997_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	80.0	0.0e+00
QAU16239.1|1886998_1887526_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	86.3	1.5e-85
QAU16240.1|1887820_1889122_+	hypothetical protein	NA	NA	NA	NA	NA
QAU16241.1|1889632_1890823_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
QAU16242.1|1890835_1891354_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
QAU16243.1|1891410_1891686_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
QAU16244.1|1891718_1891838_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
QAU16245.1|1891830_1894278_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.3	0.0e+00
QAU16246.1|1894292_1894772_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	7.3e-84
QAU16247.1|1894771_1895935_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.5	3.1e-205
QAU16248.1|1895980_1896235_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
QAU16249.1|1896508_1897870_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.5	2.5e-217
1896337:1896364	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
QAU16250.1|1897972_1898269_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
QAU16251.1|1898270_1898567_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
QAU16252.1|1898775_1899108_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
QAU16253.1|1899287_1900010_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
QAU16254.1|1900006_1901410_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 6
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	1947761	1955279	5086302		Escherichia_phage(42.86%)	7	NA	NA
QAU16286.1|1947761_1949156_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
QAU16287.1|1949313_1950309_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
QAU16288.1|1950540_1951434_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
QAU16289.1|1951805_1952891_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
QAU16290.1|1952890_1953790_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
QAU16291.1|1953847_1954726_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
QAU16292.1|1954730_1955279_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
>prophage 7
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	2430312	2528298	5086302	portal,transposase,tail,integrase,protease,terminase,lysis	Enterobacteria_phage(35.59%)	107	2425602:2425618	2459050:2459066
2425602:2425618	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
QAU16721.1|2430312_2432739_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
QAU19146.1|2432937_2433243_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
QAU16722.1|2433350_2434061_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
QAU16723.1|2434063_2434624_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
QAU16724.1|2434658_2435000_-	DUF1283 family protein	NA	NA	NA	NA	NA
QAU16725.1|2435134_2435461_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
QAU16726.1|2435666_2436881_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
QAU16727.1|2436892_2437912_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
QAU16728.1|2437969_2438098_+	transporter	NA	NA	NA	NA	NA
QAU16729.1|2438099_2438876_-|integrase	site-specific integrase	integrase	Q859D2	Escherichia_coli_phage	64.4	1.9e-97
QAU16730.1|2438910_2440482_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
QAU16731.1|2440501_2440849_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
QAU16732.1|2440848_2441526_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
QAU19147.1|2442121_2442358_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
QAU16733.1|2442445_2444917_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
QAU16734.1|2445009_2445201_-	DUF1482 family protein	NA	NA	NA	NA	NA
QAU16735.1|2445197_2445386_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
QAU16736.1|2445888_2446089_+	hypothetical protein	NA	NA	NA	NA	NA
QAU16737.1|2446057_2446423_-	hypothetical protein	NA	NA	NA	NA	NA
QAU16738.1|2446434_2446587_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
QAU16739.1|2446779_2447187_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
QAU16740.1|2447264_2447492_+	transcriptional regulator	NA	NA	NA	NA	NA
QAU16741.1|2447475_2447997_+	hypothetical protein	NA	NA	NA	NA	NA
QAU16742.1|2447977_2448943_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
QAU16743.1|2448983_2449385_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
QAU16744.1|2449584_2450607_+	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
QAU16745.1|2451259_2451463_+	hypothetical protein	NA	NA	NA	NA	NA
QAU16746.1|2451469_2451577_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
QAU16747.1|2451621_2451834_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
QAU16748.1|2452050_2452302_+	hypothetical protein	NA	NA	NA	NA	NA
QAU16749.1|2452368_2452647_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
QAU16750.1|2452648_2453698_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
QAU16751.1|2453710_2454067_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
QAU16752.1|2454081_2454903_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
QAU16753.1|2455436_2455763_+	hypothetical protein	NA	NA	NA	NA	NA
QAU16754.1|2455798_2455930_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
QAU16755.1|2456296_2456725_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
QAU19148.1|2456896_2457271_+	tolA family protein	NA	NA	NA	NA	NA
QAU16756.1|2457522_2457738_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
QAU16757.1|2457742_2458054_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	1.5e-24
QAU16758.1|2458050_2458584_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
QAU16759.1|2458580_2459078_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2459050:2459066	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
QAU19149.1|2459441_2459654_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
QAU19150.1|2459664_2459853_+	cold-shock protein	NA	NA	NA	NA	NA
QAU19151.1|2460000_2460156_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19152.1|2460328_2460502_+	protein GnsB	NA	NA	NA	NA	NA
QAU16760.1|2460797_2461004_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
QAU16761.1|2461556_2462051_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
QAU16762.1|2462050_2464153_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
QAU16763.1|2464149_2464362_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
QAU16764.1|2464361_2465870_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
QAU16765.1|2465814_2467842_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
QAU16766.1|2467927_2468251_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
QAU16767.1|2468243_2468519_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	3.8e-45
QAU16768.1|2468530_2469121_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
QAU16769.1|2469117_2469519_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
QAU16770.1|2469529_2470273_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
QAU19153.1|2470333_2470720_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
QAU16771.1|2470728_2471046_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	4.4e-53
QAU16772.1|2471029_2474095_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.1	0.0e+00
QAU16773.1|2474094_2474424_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
QAU16774.1|2474433_2475132_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
QAU16775.1|2475137_2475881_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
QAU16776.1|2475778_2476426_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
QAU16777.1|2476486_2479966_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
QAU16778.1|2480033_2480633_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
QAU16779.1|2480697_2483070_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
QAU16780.1|2483066_2483345_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
QAU16781.1|2483355_2484396_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.5	4.5e-155
QAU16782.1|2484438_2484732_+	hypothetical protein	NA	NA	NA	NA	NA
QAU16783.1|2484959_2485550_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
QAU16784.1|2485866_2486100_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
QAU16785.1|2486168_2486282_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
QAU16786.1|2486886_2488170_+	MFS transporter	NA	NA	NA	NA	NA
QAU16787.1|2488259_2489720_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
QAU16788.1|2489755_2489959_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
QAU16789.1|2490135_2490822_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
QAU16790.1|2490910_2491657_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
QAU16791.1|2491793_2493839_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
QAU16792.1|2494204_2494597_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
QAU16793.1|2494851_2495742_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.0	1.4e-19
QAU16794.1|2495960_2496056_-	protein MgtS	NA	NA	NA	NA	NA
QAU16795.1|2496182_2497370_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
QAU16796.1|2497564_2498464_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
QAU16797.1|2498494_2498713_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
QAU16798.1|2498744_2499128_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
QAU16799.1|2499148_2499583_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
QAU16800.1|2499794_2500460_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
QAU16801.1|2500484_2501675_-	sugar efflux transporter	NA	NA	NA	NA	NA
QAU16802.1|2501824_2502940_-	putative protein YneK	NA	NA	NA	NA	NA
QAU16803.1|2503017_2503899_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QAU16804.1|2503999_2505388_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
QAU16805.1|2505451_2506378_+	glutaminase 2	NA	NA	NA	NA	NA
QAU16806.1|2506377_2506737_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
QAU16807.1|2506875_2508294_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
QAU16808.1|2508521_2509973_+	tagaturonate reductase	NA	NA	NA	NA	NA
QAU16809.1|2510169_2511084_+	hypothetical protein	NA	NA	NA	NA	NA
QAU16810.1|2511087_2511846_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
QAU16811.1|2511902_2512193_-	autoinducer 2-degrading protein LsrG	NA	NA	NA	NA	NA
QAU16812.1|2512216_2513092_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
QAU16813.1|2513118_2514141_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
QAU16814.1|2514152_2515145_-	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
QAU16815.1|2515144_2516173_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
QAU16816.1|2516166_2517702_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	3.2e-16
QAU16817.1|2517950_2518904_+	LsrR family transcriptional regulator	NA	NA	NA	NA	NA
QAU16818.1|2518982_2520575_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
QAU16819.1|2527025_2528298_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 8
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	3154632	3244040	5086302	portal,plate,tRNA,tail,protease,integrase,terminase,head,capsid,lysis	Salmonella_phage(61.4%)	93	3209736:3209762	3244115:3244141
QAU17362.1|3154632_3155925_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
QAU17363.1|3156015_3157359_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	7.3e-81
QAU19182.1|3157369_3157981_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
QAU17364.1|3158139_3162210_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
QAU17365.1|3162344_3162839_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
QAU17366.1|3163382_3164348_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
QAU17367.1|3164470_3166237_+	ATP-binding/permease CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
QAU17368.1|3166237_3167959_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
QAU17369.1|3168000_3168705_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
QAU17370.1|3168989_3169208_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
QAU17371.1|3169955_3172232_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
QAU17372.1|3172262_3172583_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
QAU17373.1|3172905_3173130_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
QAU17374.1|3173202_3175149_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	6.5e-38
QAU17375.1|3175145_3176261_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
QAU17376.1|3176375_3177368_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
QAU17377.1|3177364_3179023_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
QAU17378.1|3179448_3180144_+	aquaporin	NA	NA	NA	NA	NA
QAU17379.1|3180601_3181501_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
QAU17380.1|3181465_3181645_-	hypothetical protein	NA	NA	NA	NA	NA
QAU17381.1|3181643_3183296_+	hydroxylamine reductase	NA	NA	NA	NA	NA
QAU17382.1|3183307_3184276_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
QAU17383.1|3184408_3186127_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
QAU17384.1|3186163_3187165_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
QAU17385.1|3187175_3188606_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
QAU19183.1|3188704_3189718_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
QAU17386.1|3189714_3190545_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
QAU17387.1|3190541_3190865_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
QAU17388.1|3190919_3191108_+	hypothetical protein	NA	NA	NA	NA	NA
QAU17389.1|3191075_3192845_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
QAU17390.1|3193492_3194008_+	lipoprotein	NA	NA	NA	NA	NA
QAU17391.1|3194225_3194954_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
QAU17392.1|3194971_3195703_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAU17393.1|3195709_3196426_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
QAU17394.1|3196425_3197094_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
QAU17395.1|3197319_3198051_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAU17396.1|3198079_3199207_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
QAU17397.1|3199247_3199736_-	DUF2593 family protein	NA	NA	NA	NA	NA
QAU17398.1|3199795_3200641_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
QAU17399.1|3200637_3201591_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
QAU17400.1|3201600_3202734_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
QAU17401.1|3202828_3203941_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
QAU17402.1|3204291_3204768_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
QAU17403.1|3204855_3205758_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
QAU17404.1|3205818_3206541_-	nitroreductase NfsA	NA	NA	NA	NA	NA
QAU17405.1|3206524_3206812_-	DUF1418 family protein	NA	NA	NA	NA	NA
QAU17406.1|3206971_3207229_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
QAU17407.1|3207258_3207636_-	hypothetical protein	NA	NA	NA	NA	NA
QAU17408.1|3207905_3209591_+	transporter	NA	NA	NA	NA	NA
3209736:3209762	attL	GTGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
QAU19184.1|3209826_3210045_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
QAU17409.1|3210135_3211236_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	1.0e-176
QAU17410.1|3211232_3211718_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	79.4	1.6e-65
QAU17411.1|3211714_3214792_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
QAU17412.1|3214784_3214904_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
QAU17413.1|3214918_3215221_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.5e-39
QAU17414.1|3215275_3215791_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
QAU17415.1|3215800_3216973_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
QAU17416.1|3217106_3217709_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	3.7e-93
QAU17417.1|3217708_3219250_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.2	7.6e-199
QAU17418.1|3219246_3219852_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.2e-110
QAU17419.1|3219844_3220753_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
QAU17420.1|3220739_3221099_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
QAU17421.1|3221095_3221674_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
QAU17422.1|3221777_3222584_+	hypothetical protein	NA	NA	NA	NA	NA
QAU17423.1|3222525_3222972_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.0e-60
QAU17424.1|3222964_3223396_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
QAU17425.1|3223361_3223562_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.3	3.9e-23
QAU17426.1|3223491_3223920_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
QAU17427.1|3223916_3224294_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	8.8e-16
QAU19185.1|3224295_3224769_-	lysozyme	NA	E5G6N1	Salmonella_phage	90.4	8.3e-80
QAU17428.1|3224788_3225004_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
QAU17429.1|3225007_3225211_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
QAU17430.1|3225210_3225675_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
QAU17431.1|3225770_3226421_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.8	9.6e-111
QAU17432.1|3226424_3227483_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
QAU17433.1|3227499_3228333_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
QAU17434.1|3228475_3230242_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
QAU17435.1|3230241_3231276_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.5	2.3e-167
QAU17436.1|3231312_3233094_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
QAU17437.1|3233627_3234686_+	hypothetical protein	NA	NA	NA	NA	NA
QAU17438.1|3234860_3235166_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
QAU19186.1|3235104_3235293_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
QAU17439.1|3235446_3237861_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
QAU17440.1|3237857_3238715_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
QAU17441.1|3238711_3238939_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
QAU17442.1|3238938_3239172_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
QAU17443.1|3239239_3239581_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
QAU17444.1|3239544_3239745_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
QAU17445.1|3239752_3240262_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
QAU17446.1|3240294_3240516_-	regulator	NA	NA	NA	NA	NA
QAU17447.1|3240611_3241208_+	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.4e-39
QAU17448.1|3241228_3242905_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
QAU17449.1|3242987_3244040_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	4.8e-104
3244115:3244141	attR	GTGGGTTTTTTGTTGCCTGAAATTTAT	NA	NA	NA	NA
>prophage 9
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	3538268	3623493	5086302	transposase,tail,protease,integrase,terminase,head,capsid,lysis	Enterobacteria_phage(52.46%)	89	3572532:3572578	3623507:3623553
QAU17706.1|3538268_3539381_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
QAU17707.1|3539573_3539726_-	protein HokE	NA	NA	NA	NA	NA
QAU17708.1|3540177_3541296_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
QAU17709.1|3541361_3541610_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
QAU17710.1|3541674_3542058_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
QAU17711.1|3542136_3542790_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
QAU17712.1|3542897_3544145_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
QAU17713.1|3544212_3545589_-	phenylalanine transporter	NA	NA	NA	NA	NA
QAU17714.1|3545690_3548834_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	5.7e-60
QAU17715.1|3548845_3550069_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
QAU17716.1|3550084_3550417_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
QAU17717.1|3550440_3551823_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
QAU17718.1|3551979_3552663_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
QAU17719.1|3552652_3554101_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	2.3e-11
QAU17720.1|3554844_3556746_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	6.0e-28
QAU17721.1|3556773_3557235_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
QAU17722.1|3557254_3562108_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.8	9.9e-19
QAU17723.1|3562104_3562494_+	hypothetical protein	NA	NA	NA	NA	NA
QAU17724.1|3563347_3564484_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
QAU17725.1|3564681_3565602_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
QAU17726.1|3567681_3570654_+	phage receptor	NA	NA	NA	NA	NA
QAU17727.1|3570654_3571545_+	DUF4434 family protein	NA	NA	NA	NA	NA
QAU17728.1|3571727_3572489_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
3572532:3572578	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
QAU17729.1|3572906_3573584_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
QAU17730.1|3573583_3573931_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
QAU17731.1|3573950_3575522_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
QAU17732.1|3575708_3576662_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
QAU17733.1|3576910_3577660_-	transcriptional regulator	NA	NA	NA	NA	NA
QAU17734.1|3578672_3579713_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	91.9	2.1e-176
QAU17735.1|3579725_3579995_-	hypothetical protein	NA	NA	NA	NA	NA
QAU17736.1|3579994_3582352_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	2.2e-117
QAU17737.1|3582416_3583016_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
QAU17738.1|3583171_3584444_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
QAU17739.1|3587959_3588592_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
QAU17740.1|3588528_3589272_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
QAU17741.1|3589277_3589976_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
QAU17742.1|3589975_3590305_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	96.3	3.4e-56
QAU17743.1|3590301_3592863_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
QAU17744.1|3592855_3593290_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
QAU17745.1|3593271_3593694_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.8e-71
QAU17746.1|3593709_3594450_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	1.7e-127
QAU17747.1|3594457_3594853_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
QAU17748.1|3594849_3595428_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
QAU17749.1|3595439_3595793_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
QAU17750.1|3595804_3596203_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
QAU17751.1|3596244_3597270_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	1.0e-191
QAU17752.1|3597325_3597658_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
QAU17753.1|3597667_3598987_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
QAU17754.1|3600564_3600771_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
QAU17755.1|3600767_3602693_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
QAU17756.1|3602667_3603213_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
QAU17757.1|3603328_3603586_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	97.1	8.9e-12
QAU17758.1|3603601_3603835_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
QAU17759.1|3603891_3604302_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
QAU17760.1|3604653_3604806_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
QAU17761.1|3604834_3605041_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
QAU17762.1|3605257_3605755_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
QAU17763.1|3605754_3605970_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
QAU19199.1|3606157_3606889_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAU17764.1|3607240_3608200_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
QAU17765.1|3608392_3608917_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
QAU17766.1|3609072_3609450_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.3	8.1e-54
QAU17767.1|3609535_3609676_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
QAU17768.1|3609672_3610035_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
QAU17769.1|3610031_3610322_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
QAU17770.1|3610314_3610485_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
QAU17771.1|3610484_3610940_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
QAU17772.1|3610936_3611038_-	hypothetical protein	NA	NA	NA	NA	NA
QAU17773.1|3611127_3611484_-	hypothetical protein	NA	NA	NA	NA	NA
QAU17774.1|3611945_3612269_-	hypothetical protein	NA	NA	NA	NA	NA
QAU17775.1|3612380_3613907_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
QAU17776.1|3613964_3614072_-	hypothetical protein	NA	NA	NA	NA	NA
QAU17777.1|3614163_3614496_-	multidrug SMR transporter	NA	NA	NA	NA	NA
QAU17778.1|3614563_3614866_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	93.5	1.7e-41
QAU17779.1|3614862_3615564_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
QAU19200.1|3615560_3616490_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
QAU17780.1|3616576_3617116_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
QAU17781.1|3617185_3617416_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
QAU19201.1|3617520_3618210_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
QAU17782.1|3618804_3619011_+	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	83.8	7.1e-28
QAU17783.1|3619087_3619384_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
QAU17784.1|3619389_3620175_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	6.9e-148
QAU17785.1|3620171_3620852_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
QAU19202.1|3620848_3621031_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
QAU17786.1|3621003_3621195_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
QAU17787.1|3621586_3621805_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	5.4e-34
QAU17788.1|3621852_3622131_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
QAU17789.1|3622102_3622474_+	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
QAU17790.1|3622329_3623493_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
3623507:3623553	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 10
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	3888740	3935764	5086302	integrase,transposase,plate	Enterobacteria_phage(20.0%)	50	3888636:3888655	3901849:3901868
3888636:3888655	attL	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
QAU19211.1|3888740_3890075_+|integrase	integrase	integrase	NA	NA	NA	NA
QAU18026.1|3890155_3890833_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	1.7e-46
QAU18027.1|3890880_3892722_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	4.2e-18
QAU18028.1|3892756_3892954_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18029.1|3893109_3894141_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18030.1|3894155_3894539_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18031.1|3894543_3894741_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
QAU18032.1|3895722_3896025_-	transporter	NA	NA	NA	NA	NA
QAU18033.1|3896024_3896228_-	ABC transporter ATPase	NA	NA	NA	NA	NA
QAU18034.1|3896285_3896666_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18035.1|3896800_3897370_-	transcriptional regulator	NA	NA	NA	NA	NA
QAU18036.1|3897613_3897814_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18037.1|3899227_3899464_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18038.1|3899919_3900471_-	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	60.0	1.2e-05
QAU18039.1|3901476_3901791_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18040.1|3902039_3903293_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	3.4e-96
3901849:3901868	attR	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
QAU18041.1|3903304_3904408_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	2.4e-61
QAU18042.1|3904695_3905751_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
QAU18043.1|3905789_3906191_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
QAU18044.1|3906248_3907493_-	esterase	NA	NA	NA	NA	NA
QAU18045.1|3907584_3908043_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
QAU18046.1|3908303_3909761_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
QAU19212.1|3909808_3910051_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19213.1|3910067_3910577_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
QAU18047.1|3910638_3911253_-	peptide chain release factor H	NA	NA	NA	NA	NA
QAU18048.1|3911249_3912401_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	30.9	3.5e-31
QAU18049.1|3912579_3913032_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAU18050.1|3913041_3913440_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
QAU18051.1|3913442_3913736_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
QAU18052.1|3913787_3914843_-	DNA polymerase IV	NA	NA	NA	NA	NA
QAU18053.1|3914913_3915684_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
QAU18054.1|3915643_3917383_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
QAU18055.1|3917480_3918254_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
QAU18056.1|3918439_3918700_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
QAU19214.1|3918791_3918980_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
QAU18057.1|3919135_3919876_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
QAU18058.1|3919846_3920614_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
QAU18059.1|3920729_3921308_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	2.5e-14
QAU18060.1|3921547_3923992_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
QAU18061.1|3924034_3924508_-	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
QAU18062.1|3924661_3925432_+	amidohydrolase	NA	NA	NA	NA	NA
QAU18063.1|3925895_3927108_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
QAU18064.1|3927295_3927814_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
QAU18065.1|3928510_3929011_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
QAU18066.1|3929045_3929270_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18067.1|3929320_3930796_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
QAU18068.1|3930802_3931216_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
QAU18069.1|3931219_3933070_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
QAU18070.1|3933033_3934116_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
QAU18071.1|3934651_3935764_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	4283141	4335227	5086302	transposase,holin	Stx2-converting_phage(40.0%)	58	NA	NA
QAU18361.1|4283141_4284414_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	4.7e-170
QAU18362.1|4284339_4284558_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18363.1|4284554_4284929_-	toxin	NA	NA	NA	NA	NA
QAU18364.1|4285018_4285387_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
QAU18365.1|4285549_4285771_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	7.2e-10
QAU18366.1|4285833_4286310_-	DNA repair protein RadC	NA	NA	NA	NA	NA
QAU18367.1|4286325_4286799_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
QAU18368.1|4287140_4287959_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	4.2e-47
QAU19231.1|4287979_4288114_-	cytoplasmic protein	NA	NA	NA	NA	NA
QAU18369.1|4288113_4288272_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
QAU18370.1|4288342_4291189_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
QAU18371.1|4291561_4292434_-	GTPase family protein	NA	NA	NA	NA	NA
QAU18372.1|4292518_4293436_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18373.1|4293568_4293784_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18374.1|4294269_4294467_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18375.1|4294637_4295240_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18376.1|4295334_4295613_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
QAU18377.1|4295581_4295740_-	transcriptional regulator	NA	NA	NA	NA	NA
QAU18378.1|4295681_4295948_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18379.1|4296284_4296425_+	hemolysin activation protein	NA	NA	NA	NA	NA
QAU18380.1|4296770_4296971_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18381.1|4297169_4297739_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
QAU18382.1|4297998_4298400_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18383.1|4298387_4298822_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18384.1|4298821_4299058_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18385.1|4299176_4299557_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
QAU18386.1|4299553_4299901_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
QAU18387.1|4299950_4301336_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	2.2e-258
QAU18388.1|4301574_4302933_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
QAU18389.1|4303311_4303503_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
QAU18390.1|4303665_4303923_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
QAU18391.1|4306115_4307060_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
QAU18392.1|4307240_4308380_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	7.9e-68
QAU18393.1|4308533_4310531_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
QAU18394.1|4310475_4310634_+|holin	choline transporter	holin	NA	NA	NA	NA
QAU18395.1|4310593_4311871_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
QAU18396.1|4312118_4312775_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
QAU18397.1|4312832_4312937_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
QAU18398.1|4312955_4313084_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
QAU18399.1|4313174_4313456_-	hypothetical protein	NA	NA	NA	NA	NA
QAU19232.1|4313854_4314055_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18400.1|4314182_4314281_+	acetolactate synthase	NA	NA	NA	NA	NA
QAU18401.1|4314282_4315065_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
QAU18402.1|4315370_4316291_+	ribokinase	NA	NA	NA	NA	NA
QAU18403.1|4316318_4317635_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
QAU18404.1|4317646_4318660_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
QAU18405.1|4319144_4319336_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	65.6	8.3e-15
QAU18406.1|4319582_4320839_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
QAU18407.1|4320851_4321139_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
QAU18408.1|4321154_4321598_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
QAU18409.1|4321868_4322900_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
QAU18410.1|4323838_4324972_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
QAU18411.1|4326622_4326970_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
QAU18412.1|4326966_4327371_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
QAU18413.1|4329499_4330456_-	thioesterase	NA	NA	NA	NA	NA
QAU18414.1|4330465_4331731_-	MFS transporter	NA	NA	NA	NA	NA
QAU18415.1|4332032_4333040_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
QAU18416.1|4333655_4335227_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
>prophage 12
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	4485827	4544498	5086302	integrase,transposase	Stx2-converting_phage(28.57%)	54	4504460:4504473	4545456:4545469
QAU18556.1|4485827_4486799_-|transposase	IS481-like element ISEc18 family transposase	transposase	NA	NA	NA	NA
QAU18557.1|4487175_4488390_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
QAU18558.1|4488411_4490058_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18559.1|4490069_4491953_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18560.1|4491964_4493008_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18561.1|4493004_4498515_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	21.9	2.3e-48
QAU18562.1|4498764_4499874_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	24.8	1.4e-05
QAU18563.1|4499939_4500722_-	EAL domain-containing protein	NA	NA	NA	NA	NA
QAU18564.1|4500774_4501767_-	nuclease PIN	NA	NA	NA	NA	NA
QAU18565.1|4501789_4502308_-	fimbrial protein	NA	NA	NA	NA	NA
QAU18566.1|4502391_4502955_-	nuclease PIN	NA	NA	NA	NA	NA
QAU18567.1|4502991_4503723_-	molecular chaperone	NA	NA	NA	NA	NA
QAU19238.1|4503791_4506251_-	PapC/FimD family outer membrane usher protein	NA	NA	NA	NA	NA
4504460:4504473	attL	TGTTCACGCCGGCA	NA	NA	NA	NA
QAU18568.1|4506422_4507010_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
QAU18569.1|4507095_4507602_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
QAU19239.1|4507646_4507904_-	transcriptional regulator	NA	NA	NA	NA	NA
QAU18570.1|4509564_4510812_-	two-component system response regulator PgtA	NA	NA	NA	NA	NA
QAU18571.1|4510801_4512811_-	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
QAU19240.1|4512807_4514025_-	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
QAU18572.1|4514423_4515788_+	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
QAU18573.1|4515830_4516196_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18574.1|4516736_4517750_-	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
QAU18575.1|4517761_4519078_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
QAU18576.1|4519105_4520026_-	ribokinase	NA	NA	NA	NA	NA
QAU18577.1|4520329_4521112_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
QAU18578.1|4521113_4521212_-	acetolactate synthase	NA	NA	NA	NA	NA
QAU19241.1|4521339_4521540_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18579.1|4521893_4522133_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18580.1|4522259_4522454_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18581.1|4522506_4522770_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18582.1|4522841_4524114_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
QAU18583.1|4524436_4524634_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
QAU18584.1|4524880_4525306_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18585.1|4525302_4525686_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18586.1|4526057_4526657_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
QAU18587.1|4526888_4527029_-	hemolysin activation protein	NA	NA	NA	NA	NA
QAU19242.1|4527115_4527238_-	hemolysin expression modulating protein	NA	NA	NA	NA	NA
QAU19243.1|4527324_4527516_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18588.1|4528105_4528897_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19244.1|4529111_4529309_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18589.1|4529280_4529487_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
QAU18590.1|4529580_4530183_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18591.1|4530085_4530283_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18592.1|4532149_4533325_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18593.1|4533671_4534097_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
QAU18594.1|4534093_4534444_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
QAU18595.1|4534474_4536088_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	2.3e-182
QAU18596.1|4536675_4537611_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18597.1|4537607_4539920_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAU18598.1|4540224_4540827_-|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
QAU19245.1|4540973_4541189_+	resolvase	NA	NA	NA	NA	NA
QAU19246.1|4541225_4542326_+	hsdR	NA	NA	NA	NA	NA
QAU18599.1|4542561_4543245_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18600.1|4543385_4544498_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
4545456:4545469	attR	TGTTCACGCCGGCA	NA	NA	NA	NA
>prophage 13
CP034389	Escherichia coli strain RS571 chromosome, complete genome	5086302	4650114	4695532	5086302	tail,plate,tRNA	Burkholderia_phage(30.0%)	46	NA	NA
QAU18693.1|4650114_4651152_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
QAU18694.1|4651513_4652518_-	DUF2713 family protein	NA	NA	NA	NA	NA
QAU18695.1|4652835_4653351_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
QAU18696.1|4653392_4653602_-	CsbD family protein	NA	NA	NA	NA	NA
QAU18697.1|4653717_4655043_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
QAU18698.1|4655115_4655724_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
QAU18699.1|4655833_4656202_-	diacylglycerol kinase	NA	NA	NA	NA	NA
QAU18700.1|4656372_4658796_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
QAU18701.1|4658950_4659823_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
QAU18702.1|4659835_4660333_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
QAU18703.1|4662363_4663284_-	maltose operon protein MalM	NA	NA	NA	NA	NA
QAU18704.1|4663526_4664867_-	maltoporin	NA	NA	NA	NA	NA
QAU18705.1|4664938_4666054_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
QAU18706.1|4666418_4667609_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
QAU18707.1|4667762_4669307_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
QAU18708.1|4669321_4670212_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
QAU18709.1|4670305_4670716_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
QAU18710.1|4670929_4671208_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18711.1|4671254_4673351_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
QAU18712.1|4673350_4674088_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18713.1|4674084_4674723_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
QAU18714.1|4674836_4675079_-	hypothetical protein	NA	NA	NA	NA	NA
QAU18715.1|4675433_4677083_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
QAU18716.1|4677607_4678957_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
QAU18717.1|4679011_4679359_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
QAU18718.1|4679896_4680184_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
QAU18719.1|4680186_4680792_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
QAU18720.1|4680804_4681119_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
QAU18721.1|4681263_4681719_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18722.1|4681715_4681913_+	hypothetical protein	NA	NA	NA	NA	NA
QAU18723.1|4681902_4683327_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
QAU18724.1|4683326_4683851_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
QAU18725.1|4683901_4684219_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
QAU18726.1|4684178_4684307_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
QAU18727.1|4684408_4686784_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	26.0	1.0e-56
QAU18728.1|4686783_4687737_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
QAU18729.1|4687736_4687946_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
QAU18730.1|4687933_4688974_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
QAU18731.1|4688983_4689685_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
QAU18732.1|4689783_4690143_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
QAU18733.1|4690133_4691249_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.4	1.7e-99
QAU18734.1|4691241_4691958_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
QAU18735.1|4691960_4693571_+	short-chain fatty acid transporter	NA	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
QAU18736.1|4693567_4694275_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
QAU18737.1|4694271_4694727_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
QAU18738.1|4694740_4695532_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 1
CP034390	Escherichia coli strain RS571 plasmid pRS571-MCR-1.1, complete sequence	257270	61126	111583	257270	transposase	Escherichia_phage(37.5%)	52	NA	NA
QAU19319.1|61126_62740_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	2.3e-182
QAU19320.1|62746_63622_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19506.1|63788_65288_-	kinase	NA	NA	NA	NA	NA
QAU19321.1|65313_66951_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
QAU19322.1|66950_67991_-	VWA domain-containing protein	NA	NA	NA	NA	NA
QAU19507.1|68076_68715_-	VWA domain-containing protein	NA	NA	NA	NA	NA
QAU19323.1|68714_69356_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
QAU19324.1|69378_70017_-	VWA domain-containing protein	NA	NA	NA	NA	NA
QAU19325.1|70479_70947_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
QAU19326.1|70964_72173_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
QAU19327.1|72183_73140_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
QAU19328.1|73139_74219_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
QAU19329.1|74220_74994_-	hypothetical protein	NA	NA	NA	NA	NA
QAU19330.1|74986_76129_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
QAU19331.1|76138_77197_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
QAU19332.1|77520_78102_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
QAU19333.1|78101_79259_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
QAU19334.1|79281_79737_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
QAU19335.1|79759_80800_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
QAU19336.1|80848_81427_+	TerD family protein	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
QAU19337.1|81494_82070_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
QAU19338.1|82498_83740_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
QAU19339.1|84302_84584_-	hypothetical protein	NA	NA	NA	NA	NA
QAU19340.1|84633_84825_-	hypothetical protein	NA	NA	NA	NA	NA
QAU19341.1|84916_85288_-	hypothetical protein	NA	NA	NA	NA	NA
QAU19342.1|85630_86023_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19343.1|86001_86313_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19508.1|86626_86920_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAU19344.1|86924_88250_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
QAU19345.1|88310_88517_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19346.1|88618_89029_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19347.1|89041_89857_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
QAU19348.1|90110_90536_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19349.1|91084_91393_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19350.1|91408_92266_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
QAU19351.1|92327_92531_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19352.1|93219_93924_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAU19353.1|94217_95033_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
QAU19354.1|95368_96205_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
QAU19355.1|96204_97008_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
QAU19356.1|97482_98499_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
QAU19357.1|98663_101729_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.0	3.6e-06
QAU19358.1|101721_102744_-	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
QAU19509.1|102744_103497_-	tetrathionate reductase subunit TtrB	NA	NA	NA	NA	NA
QAU19510.1|103706_105440_+	sensor histidine kinase	NA	NA	NA	NA	NA
QAU19359.1|105414_105999_+	two-component system response regulator TtrR	NA	NA	NA	NA	NA
QAU19360.1|106091_106295_+	fumarate hydratase FumD	NA	NA	NA	NA	NA
QAU19361.1|106403_107420_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
QAU19362.1|107451_108195_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	8.6e-132
QAU19363.1|109409_110270_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
QAU19364.1|110282_110825_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
QAU19365.1|110878_111583_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
CP034390	Escherichia coli strain RS571 plasmid pRS571-MCR-1.1, complete sequence	257270	128799	160680	257270	integrase,transposase	Escherichia_phage(46.15%)	30	123124:123154	163105:163135
123124:123154	attL	CCGCAGAATTCGGAAAAAATCGTACGCTAAG	NA	NA	NA	NA
QAU19382.1|128799_129504_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
QAU19383.1|132105_132411_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QAU19384.1|132438_133653_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
QAU19385.1|133869_134754_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
QAU19386.1|134784_135708_-|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
QAU19387.1|135831_136668_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
QAU19388.1|136667_137471_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
QAU19389.1|138611_139535_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
QAU19390.1|139696_140512_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
QAU19391.1|140662_141367_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
QAU19392.1|142515_143307_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
QAU19393.1|143476_143809_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
QAU19394.1|143948_144134_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19395.1|144988_145780_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	7.0e-15
QAU19396.1|146248_146494_-	hypothetical protein	NA	NA	NA	NA	NA
QAU19397.1|146531_147395_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
QAU19398.1|147540_147780_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
QAU19399.1|147852_148557_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAU19400.1|149145_149937_-	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
QAU19401.1|149994_150603_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
QAU19402.1|150698_151541_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
QAU19403.1|153600_154305_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAU19404.1|154426_155332_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
QAU19405.1|155328_156567_+	MFS transporter	NA	NA	NA	NA	NA
QAU19406.1|156566_157151_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAU19407.1|157096_157453_+	hypothetical protein	NA	NA	NA	NA	NA
QAU19408.1|157643_158408_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
QAU19409.1|158550_158817_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
QAU19410.1|159037_159511_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
QAU19411.1|159666_160680_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.1	1.5e-70
163105:163135	attR	CTTAGCGTACGATTTTTTCCGAATTCTGCGG	NA	NA	NA	NA
