The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	355892	409407	3223191	transposase,holin	Planktothrix_phage(20.0%)	48	NA	NA
QAT39084.1|355892_357167_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	40.1	1.4e-60
QAT39085.1|357846_358611_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT39086.1|359103_359730_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
QAT39087.1|359740_360934_+	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	37.7	2.3e-41
QAT39088.1|361102_361357_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39089.1|361543_363016_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
QAT39090.1|363600_363855_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39091.1|363832_364489_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39092.1|364707_365577_+	DegV family protein	NA	NA	NA	NA	NA
QAT39093.1|365650_366274_-	bacterioferritin	NA	NA	NA	NA	NA
QAT39094.1|367008_367110_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
QAT39095.1|367701_368403_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	2.7e-34
QAT39096.1|368407_370774_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT39097.1|370982_371762_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39098.1|372080_372602_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAT39099.1|372649_373321_+	response regulator transcription factor	NA	NA	NA	NA	NA
QAT39100.1|373322_374336_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	22.5	1.4e-07
QAT39101.1|374445_375213_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.8e-28
QAT39102.1|375205_377149_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT39103.1|377282_378470_+	AI-2E family transporter	NA	NA	NA	NA	NA
QAT39104.1|378555_379608_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
QAT39105.1|379635_380259_+	DUF47 family protein	NA	NA	NA	NA	NA
QAT39106.1|380290_381100_+	HAD family phosphatase	NA	NA	NA	NA	NA
QAT39107.1|381299_382928_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	31.6	5.1e-52
QAT39108.1|383037_383778_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39109.1|384023_384494_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
QAT39110.1|384523_384805_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
QAT39111.1|384838_386203_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
QAT39112.1|386240_386897_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
QAT39113.1|387054_387243_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39114.1|387266_388418_+	AAA family ATPase	NA	NA	NA	NA	NA
QAT39115.1|388640_390044_+	PRD domain-containing protein	NA	NA	NA	NA	NA
QAT39116.1|390198_391470_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
QAT41577.1|391502_393380_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.1	1.0e-11
QAT39117.1|393408_394110_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	3.7e-36
QAT41578.1|394139_394682_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39118.1|394832_396488_-	aspartate 4-decarboxylase	NA	NA	NA	NA	NA
QAT39119.1|396675_398580_+	U32 family peptidase	NA	Q6DW11	Phage_TP	24.9	9.6e-18
QAT39120.1|398592_399891_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.1	1.5e-22
QAT39121.1|399906_400872_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
QAT39122.1|400935_401574_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
QAT39123.1|401581_401806_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39124.1|401892_403167_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT39125.1|403297_404143_-	glycosyltransferase	NA	NA	NA	NA	NA
QAT39126.1|404172_404676_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39127.1|404891_406805_+	PAS domain-containing protein	NA	NA	NA	NA	NA
QAT39128.1|407091_408147_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
QAT39129.1|408495_409407_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	656977	723991	3223191	transposase,tRNA,protease	Bacillus_phage(21.43%)	57	NA	NA
QAT39325.1|656977_658231_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39326.1|658487_658793_+	TrpR-like protein YerC/YecD	NA	NA	NA	NA	NA
QAT39327.1|658993_661234_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.0	5.1e-127
QAT39328.1|661246_663250_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	35.8	2.0e-82
QAT39329.1|663294_664569_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT39330.1|664866_665136_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39331.1|665264_665570_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
QAT39332.1|665596_667054_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
QAT39333.1|667073_668504_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
QAT39334.1|668528_668732_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39335.1|668918_669392_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39336.1|669465_671067_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39337.1|671084_671243_-	hydroxymyristoyl-ACP dehydratase	NA	NA	NA	NA	NA
QAT39338.1|671402_672821_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39339.1|672913_673903_+	AIR synthase	NA	NA	NA	NA	NA
QAT39340.1|673963_674713_+	ribonuclease PH	NA	NA	NA	NA	NA
QAT39341.1|674709_675315_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
QAT39342.1|675318_675789_+	metallophosphoesterase	NA	NA	NA	NA	NA
QAT39343.1|678384_679836_+	hypothetical protein	NA	D9J0S8	Brochothrix_phage	37.5	4.7e-17
QAT39344.1|680410_681685_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39345.1|681964_683230_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	30.2	8.1e-05
QAT39346.1|683226_684060_+	response regulator	NA	NA	NA	NA	NA
QAT39347.1|684184_685183_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
QAT39348.1|685203_686154_+	carbamate kinase	NA	NA	NA	NA	NA
QAT39349.1|686182_687577_+	amino acid permease	NA	NA	NA	NA	NA
QAT39350.1|687654_689091_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
QAT39351.1|689730_690225_+	N-acetyltransferase family protein	NA	NA	NA	NA	NA
QAT39352.1|690253_690850_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
QAT39353.1|691405_691846_-	cell wall hydrolase	NA	NA	NA	NA	NA
QAT39354.1|692291_693569_+|tRNA	serine--tRNA ligase	tRNA	A0A1V0SK42	Klosneuvirus	27.8	6.6e-47
QAT39355.1|693671_693917_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39356.1|693944_694592_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
QAT39357.1|694662_694926_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39358.1|695009_696266_-	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	27.3	1.4e-20
QAT39359.1|696445_698179_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.3	9.2e-60
QAT39360.1|698447_699017_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
QAT39361.1|699048_700161_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAT39362.1|700175_701699_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.8	9.1e-11
QAT39363.1|701700_702771_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT39364.1|702771_703701_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT39365.1|703916_704840_+	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	39.1	8.4e-52
QAT39366.1|704852_705278_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
QAT39367.1|705321_706509_+	dihydroorotase	NA	NA	NA	NA	NA
QAT39368.1|706539_707436_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
QAT39369.1|707439_708180_+	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
QAT39370.1|708212_709106_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
QAT39371.1|709126_709708_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
QAT39372.1|709721_710792_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.2	7.2e-55
QAT39373.1|710803_713980_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
QAT39374.1|714151_714919_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39375.1|715031_716324_+	trigger factor	NA	NA	NA	NA	NA
QAT39376.1|716399_716984_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.2	7.4e-54
QAT39377.1|717003_718296_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.1	4.8e-146
QAT39378.1|718427_720113_+|protease	ATP-dependent protease LonB	protease	A0A0G2YAM1	Acanthamoeba_polyphaga_mimivirus	29.8	2.2e-13
QAT39379.1|720294_722616_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.6	1.8e-175
QAT39380.1|722635_723217_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
QAT39381.1|723238_723991_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	853057	862799	3223191	tRNA	uncultured_Mediterranean_phage(66.67%)	10	NA	NA
QAT39495.1|853057_854188_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.6	9.5e-90
QAT39496.1|854238_854577_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.9	2.8e-05
QAT41602.1|854642_855008_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
QAT39497.1|855075_855213_+	six-cysteine peptide SCIFF	NA	NA	NA	NA	NA
QAT39498.1|855271_856639_+	thioether cross-link-forming SCIFF peptide maturase	NA	NA	NA	NA	NA
QAT39499.1|856723_857995_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	28.9	8.1e-05
QAT39500.1|857994_858861_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.5	6.7e-35
QAT39501.1|858992_859862_+	delta(24)-sterol C-methyltransferase	NA	NA	NA	NA	NA
QAT39502.1|859966_860485_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.3	4.9e-25
QAT39503.1|860612_862799_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	40.9	7.9e-16
>prophage 4
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	898287	962589	3223191	transposase,tail,protease	Clostridium_phage(18.18%)	58	NA	NA
QAT39537.1|898287_900261_+|tail	phage tail tape measure protein	tail	A0A2H4JDX3	uncultured_Caudovirales_phage	33.7	4.9e-49
QAT39538.1|900429_904389_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39539.1|904403_905504_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39540.1|905945_906245_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39541.1|906259_907249_+	autolysin	NA	Q0SPG7	Clostridium_phage	44.0	6.0e-40
QAT39542.1|907344_907686_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39543.1|908303_908519_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39544.1|908734_909049_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39545.1|909298_911203_+	toprim domain-containing protein	NA	NA	NA	NA	NA
QAT39546.1|911630_912041_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.6	1.4e-27
QAT39547.1|912339_913032_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39548.1|913052_914054_+	GGGtGRT protein	NA	NA	NA	NA	NA
QAT39549.1|914104_914473_-	TIGR03987 family protein	NA	NA	NA	NA	NA
QAT39550.1|914578_915205_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAT39551.1|915353_918119_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
QAT39552.1|918232_918700_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
QAT39553.1|918716_919487_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
QAT39554.1|919479_920328_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
QAT39555.1|920460_920943_+	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
QAT41605.1|920966_922007_+	serine hydrolase	NA	B5U3Z7	Mycobacterium_phage	24.9	2.3e-05
QAT39556.1|922031_922817_+	serine hydrolase	NA	NA	NA	NA	NA
QAT39557.1|922873_923950_+	dipeptide epimerase	NA	NA	NA	NA	NA
QAT39558.1|924060_926103_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
QAT39559.1|926230_926737_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
QAT39560.1|927150_928425_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	40.1	1.4e-60
QAT41606.1|928705_930076_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
QAT39561.1|930575_931907_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39562.1|932198_933005_+	DUF368 domain-containing protein	NA	NA	NA	NA	NA
QAT39563.1|933119_933902_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
QAT39564.1|933913_935281_+	MATE family efflux transporter	NA	NA	NA	NA	NA
QAT39565.1|935302_936982_+	alpha-glucosidase	NA	NA	NA	NA	NA
QAT39566.1|937053_937320_+	glutaredoxin	NA	NA	NA	NA	NA
QAT39567.1|937379_938204_+	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
QAT39568.1|938252_938825_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
QAT39569.1|939274_940549_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	40.1	1.4e-60
QAT39570.1|940671_941364_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
QAT39571.1|941568_942726_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	28.2	1.6e-28
QAT39572.1|942728_945374_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	33.8	8.0e-55
QAT39573.1|945391_945985_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
QAT39574.1|946032_946587_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	39.9	2.4e-14
QAT39575.1|946893_948288_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	33.9	5.1e-53
QAT39576.1|948517_949027_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAT39577.1|949236_949878_+	peptidoglycan endopeptidase	NA	A0A0A8WF62	Clostridium_phage	44.2	9.7e-23
QAT39578.1|950014_950719_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39579.1|950810_951074_+	DUF4321 domain-containing protein	NA	NA	NA	NA	NA
QAT39580.1|951335_951914_+	Maf-like protein	NA	NA	NA	NA	NA
QAT39581.1|951925_952612_+	JAB domain-containing protein	NA	NA	NA	NA	NA
QAT39582.1|952630_953641_+	rod shape-determining protein	NA	NA	NA	NA	NA
QAT39583.1|953644_954508_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
QAT39584.1|954517_955009_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
QAT39585.1|955024_957715_+	penicillin-binding protein	NA	NA	NA	NA	NA
QAT39586.1|957861_958494_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
QAT39587.1|958508_959309_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
QAT39588.1|959320_959590_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
QAT39589.1|959732_960854_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
QAT39590.1|960867_961245_+	methylglyoxal synthase	NA	NA	NA	NA	NA
QAT39591.1|961371_961728_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39592.1|961737_962589_+|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 5
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	1014693	1077751	3223191	transposase,tRNA,protease	Bacillus_phage(30.0%)	55	NA	NA
QAT39636.1|1014693_1015482_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QAT39637.1|1015532_1016117_-	rubrerythrin family protein	NA	NA	NA	NA	NA
QAT39638.1|1016603_1017302_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39639.1|1017352_1017892_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAT39640.1|1018086_1018911_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39641.1|1018946_1019447_+	glycosyl-4,4'-diaponeurosporenoate acyltransferase	NA	NA	NA	NA	NA
QAT39642.1|1019487_1020630_-	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
QAT39643.1|1021020_1022550_+	cardiolipin synthase	NA	NA	NA	NA	NA
QAT39644.1|1022807_1025861_+	response regulator	NA	Q9EYF3	Enterobacteria_phage	32.7	1.8e-18
QAT39645.1|1025877_1026999_+	response regulator	NA	NA	NA	NA	NA
QAT39646.1|1027192_1031395_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39647.1|1031582_1032449_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39648.1|1032527_1033265_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.6	1.1e-35
QAT39649.1|1033257_1034007_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT39650.1|1034119_1034887_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
QAT39651.1|1035062_1035620_+	methylase	NA	NA	NA	NA	NA
QAT39652.1|1035644_1036418_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
QAT39653.1|1036697_1037423_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
QAT41611.1|1037623_1039282_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
QAT39654.1|1039531_1041160_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	31.6	5.1e-52
QAT39655.1|1041352_1042393_+	exopolysaccharide biosynthesis protein	NA	A0A1P8CWN9	Bacillus_phage	29.2	7.8e-06
QAT39656.1|1042408_1043446_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39657.1|1043591_1044095_-	nitroreductase	NA	NA	NA	NA	NA
QAT39658.1|1044515_1044881_+	DUF2089 domain-containing protein	NA	NA	NA	NA	NA
QAT39659.1|1044900_1045278_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39660.1|1045289_1045541_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39661.1|1045553_1046888_+	MFS transporter	NA	NA	NA	NA	NA
QAT41612.1|1047126_1048050_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT41613.1|1048405_1049281_-	rubrerythrin family protein	NA	NA	NA	NA	NA
QAT39662.1|1049647_1051414_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.0	3.6e-27
QAT39663.1|1051403_1053176_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	33.6	9.5e-20
QAT39664.1|1053296_1054067_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39665.1|1054148_1054325_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
QAT39666.1|1054467_1054701_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39667.1|1055774_1057211_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	40.7	2.6e-108
QAT41614.1|1057566_1058490_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39668.1|1058751_1059675_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
QAT39669.1|1059668_1060766_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
QAT39670.1|1060882_1061398_-	NAD(P)H-dependent dehydrogenase/reductase	NA	A0A1V0E011	Clostridioides_phage	31.4	7.8e-15
QAT39671.1|1061586_1062516_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
QAT39672.1|1062657_1063074_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39673.1|1063132_1063366_-	small acid-soluble spore protein Tlp	NA	NA	NA	NA	NA
QAT39674.1|1063617_1064364_+	NYN domain-containing protein	NA	NA	NA	NA	NA
QAT39675.1|1064553_1065555_+	rod shape-determining protein	NA	NA	NA	NA	NA
QAT39676.1|1065586_1066609_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
QAT39677.1|1066709_1068116_+	AmmeMemoRadiSam system protein A	NA	NA	NA	NA	NA
QAT39678.1|1068281_1068746_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
QAT39679.1|1068752_1069481_+	response regulator transcription factor	NA	NA	NA	NA	NA
QAT41615.1|1069488_1070208_+	ATP-binding protein	NA	NA	NA	NA	NA
QAT39680.1|1070307_1070565_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39681.1|1070572_1071847_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT39682.1|1072123_1073644_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	28.3	2.4e-19
QAT39683.1|1073567_1075499_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.2	2.4e-16
QAT39684.1|1075608_1076112_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39685.1|1076278_1077751_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	1081648	1208770	3223191	transposase,protease,coat	Bacillus_phage(27.27%)	111	NA	NA
QAT39690.1|1081648_1082923_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT39691.1|1083055_1083904_+	DUF2837 family protein	NA	NA	NA	NA	NA
QAT39692.1|1083952_1084471_+	N-acetyltransferase	NA	NA	NA	NA	NA
QAT41616.1|1084580_1085219_+	HAD family hydrolase	NA	NA	NA	NA	NA
QAT39693.1|1085243_1086122_+	radical SAM protein	NA	NA	NA	NA	NA
QAT39694.1|1086321_1086795_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	52.7	7.3e-52
QAT41617.1|1086766_1087930_+|transposase	transposase	transposase	Q331V1	Clostridium_botulinum_C_phage	78.6	1.5e-159
QAT39695.1|1088294_1088642_+	inorganic pyrophosphatase	NA	NA	NA	NA	NA
QAT39696.1|1088763_1089465_+	HD domain-containing protein	NA	NA	NA	NA	NA
QAT39697.1|1089607_1090066_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAT39698.1|1090095_1090761_+	vancomycin resistance protein	NA	NA	NA	NA	NA
QAT39699.1|1090892_1091405_+	nitroreductase family protein	NA	NA	NA	NA	NA
QAT39700.1|1091562_1093476_+	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
QAT39701.1|1093610_1095854_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
QAT39702.1|1095853_1096552_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	8.1e-31
QAT39703.1|1096555_1097200_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAT39704.1|1097379_1099257_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	2.3e-104
QAT39705.1|1099367_1099583_+	copper chaperone	NA	NA	NA	NA	NA
QAT39706.1|1099661_1100828_-	AI-2E family transporter	NA	NA	NA	NA	NA
QAT39707.1|1101073_1101595_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
QAT39708.1|1101643_1102951_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
QAT39709.1|1102950_1104378_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
QAT39710.1|1104733_1104916_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39711.1|1105503_1106643_-	glycoside hydrolase	NA	A0A1J0GW44	Streptomyces_phage	52.3	2.6e-26
QAT39712.1|1106913_1107471_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
QAT39713.1|1107548_1107905_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39714.1|1107926_1108472_+	phosphodiesterase	NA	NA	NA	NA	NA
QAT39715.1|1108935_1109721_+	HAD family hydrolase	NA	NA	NA	NA	NA
QAT39716.1|1109861_1110347_+|coat	spore coat protein	coat	NA	NA	NA	NA
QAT39717.1|1110496_1111927_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	25.4	7.9e-25
QAT39718.1|1111953_1112745_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
QAT39719.1|1112769_1113300_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAT41618.1|1113646_1114015_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QAT39720.1|1114019_1115747_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	2.6e-38
QAT41619.1|1116643_1119049_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.1	3.6e-54
QAT39721.1|1119315_1120227_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
QAT39722.1|1120549_1122013_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.5	6.0e-20
QAT39723.1|1122087_1122765_-	cysteine hydrolase	NA	NA	NA	NA	NA
QAT39724.1|1123054_1123447_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39725.1|1123510_1123957_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39726.1|1124302_1124983_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	5.1e-30
QAT39727.1|1124982_1126980_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT39728.1|1127010_1127490_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT39729.1|1127504_1128227_+	subtilase	NA	NA	NA	NA	NA
QAT39730.1|1128335_1129691_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
QAT39731.1|1129662_1130832_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
QAT39732.1|1130930_1131611_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.9e-29
QAT39733.1|1131610_1134115_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT39734.1|1134297_1137078_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
QAT39735.1|1137298_1137793_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
QAT39736.1|1137863_1138841_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
QAT39737.1|1138885_1139692_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
QAT39738.1|1139709_1140621_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
QAT39739.1|1140741_1141116_+	DUF956 family protein	NA	NA	NA	NA	NA
QAT39740.1|1141226_1141457_-	NrdH-redoxin	NA	NA	NA	NA	NA
QAT39741.1|1141632_1142946_-	chloride channel protein	NA	NA	NA	NA	NA
QAT39742.1|1142950_1144054_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
QAT39743.1|1144071_1145151_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41620.1|1145152_1146580_-	spore germination protein	NA	NA	NA	NA	NA
QAT39744.1|1146725_1147691_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
QAT39745.1|1147666_1147975_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT39746.1|1148395_1148992_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
QAT39747.1|1148957_1150343_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
QAT39748.1|1151047_1151227_+	hypothetical protein	NA	NA	NA	NA	NA
QAT41621.1|1151833_1152856_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39749.1|1153329_1155273_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39750.1|1155381_1156347_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39751.1|1156447_1156897_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41622.1|1157130_1157550_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
QAT39752.1|1157636_1158539_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
QAT39753.1|1158764_1159028_+	YkuS family protein	NA	NA	NA	NA	NA
QAT39754.1|1159130_1159628_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39755.1|1159949_1160873_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39756.1|1161439_1162660_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39757.1|1162991_1164710_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	5.6e-49
QAT39758.1|1164713_1166567_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	1.3e-43
QAT39759.1|1166711_1167695_-	EamA family transporter	NA	NA	NA	NA	NA
QAT39760.1|1167855_1168773_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.4	1.0e-09
QAT39761.1|1169231_1170860_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	31.6	5.1e-52
QAT39762.1|1171450_1171819_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39763.1|1172284_1174189_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
QAT39764.1|1174233_1175433_+	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
QAT39765.1|1175866_1177120_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39766.1|1177422_1178457_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
QAT39767.1|1178499_1179243_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39768.1|1179264_1179993_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
QAT39769.1|1179979_1180924_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39770.1|1181190_1182075_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39771.1|1182434_1182758_+	transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	46.8	5.2e-17
QAT39772.1|1182772_1183141_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
QAT39773.1|1183166_1184912_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
QAT39774.1|1185275_1185857_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
QAT39775.1|1185962_1186109_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
QAT39776.1|1186280_1187564_+	divalent metal cation transporter	NA	NA	NA	NA	NA
QAT39777.1|1187660_1188251_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
QAT39778.1|1188280_1189519_-	MFS transporter	NA	NA	NA	NA	NA
QAT39779.1|1189783_1191055_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAT39780.1|1191327_1191981_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	73.3	1.2e-55
QAT39781.1|1192522_1194151_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	31.6	5.1e-52
QAT39782.1|1194257_1194980_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39783.1|1195056_1195848_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
QAT39784.1|1195999_1196752_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
QAT39785.1|1196863_1199269_+	glycyl radical protein	NA	Q66LZ4	Escherichia_phage	54.7	9.3e-10
QAT39786.1|1199357_1201277_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
QAT39787.1|1201529_1202447_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	4.3e-24
QAT39788.1|1202439_1203234_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT39789.1|1203822_1204053_-	DUF3892 domain-containing protein	NA	G3MB34	Bacillus_virus	48.0	7.5e-10
QAT39790.1|1204320_1206000_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.1e-33
QAT39791.1|1206037_1206484_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39792.1|1206830_1207319_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39793.1|1207930_1208770_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 7
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	1234955	1273833	3223191	transposase,protease	uncultured_Caudovirales_phage(28.57%)	43	NA	NA
QAT39816.1|1234955_1236287_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39817.1|1236420_1238073_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39818.1|1238353_1238533_+	hypothetical protein	NA	NA	NA	NA	NA
QAT41626.1|1238838_1239336_+	catalase	NA	NA	NA	NA	NA
QAT39819.1|1239438_1240056_-	hypothetical protein	NA	NA	NA	NA	NA
QAT39820.1|1240361_1240988_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
QAT39821.1|1241038_1241947_-	DMT family transporter	NA	NA	NA	NA	NA
QAT39822.1|1242051_1242669_+	flavodoxin	NA	NA	NA	NA	NA
QAT39823.1|1242749_1243706_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	NA	NA	NA	NA
QAT41627.1|1244179_1244635_+	DUF4829 domain-containing protein	NA	NA	NA	NA	NA
QAT39824.1|1244664_1245126_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
QAT39825.1|1245158_1245542_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39826.1|1245562_1246036_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39827.1|1246062_1246734_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39828.1|1246874_1247144_+	DUF1599 domain-containing protein	NA	A0A2H4J4N1	uncultured_Caudovirales_phage	55.7	4.9e-21
QAT39829.1|1247255_1247630_+	response regulator	NA	NA	NA	NA	NA
QAT41628.1|1247619_1248255_+	chemotaxis protein CheC	NA	NA	NA	NA	NA
QAT39830.1|1248247_1249180_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	7.5e-24
QAT39831.1|1249359_1250940_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAT39832.1|1251181_1251955_+	EAL domain-containing protein	NA	NA	NA	NA	NA
QAT39833.1|1251982_1253131_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
QAT39834.1|1253281_1255252_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.2	6.4e-25
QAT39835.1|1255333_1256593_-	CapA family protein	NA	A0A2H4JC87	uncultured_Caudovirales_phage	35.5	3.2e-30
QAT39836.1|1256919_1257789_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	35.1	2.8e-33
QAT39837.1|1257954_1258329_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
QAT39838.1|1258447_1258654_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39839.1|1258643_1259372_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
QAT39840.1|1259561_1260524_+	bacteriochlorophyll 4-vinyl reductase	NA	NA	NA	NA	NA
QAT39841.1|1260578_1260992_+	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
QAT39842.1|1261051_1261744_+	filamentation induced by cAMP protein fic	NA	NA	NA	NA	NA
QAT39843.1|1261880_1263233_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	29.2	1.2e-06
QAT39844.1|1263227_1264193_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
QAT39845.1|1264168_1264477_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT39846.1|1265155_1266703_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
QAT39847.1|1266971_1267988_+	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
QAT39848.1|1268554_1269307_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
QAT39849.1|1269441_1269918_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
QAT39850.1|1269914_1270352_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
QAT39851.1|1270431_1270983_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
QAT39852.1|1271893_1272139_+	hypothetical protein	NA	A0A0A8WF72	Clostridium_phage	48.8	2.9e-12
QAT39853.1|1272138_1272510_+|protease	aspartyl protease	protease	NA	NA	NA	NA
QAT39854.1|1272583_1272892_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39855.1|1272867_1273833_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	1280041	1348046	3223191	transposase	Paenibacillus_phage(18.18%)	51	NA	NA
QAT39863.1|1280041_1281514_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
QAT39864.1|1281642_1281888_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
QAT39865.1|1281980_1282487_+	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	40.1	5.5e-21
QAT39866.1|1282739_1282964_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39867.1|1283077_1284025_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39868.1|1284141_1284816_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QAT39869.1|1284877_1285195_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39870.1|1285256_1285988_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39871.1|1286010_1286511_+	N-acetyltransferase	NA	NA	NA	NA	NA
QAT39872.1|1286622_1287087_+	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	50.0	2.6e-33
QAT39873.1|1287299_1287731_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39874.1|1287755_1288040_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39875.1|1288088_1289528_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
QAT39876.1|1289697_1290951_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39877.1|1291609_1292176_+	ATPase	NA	NA	NA	NA	NA
QAT39878.1|1292412_1292958_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	45.6	4.5e-29
QAT39879.1|1293088_1297438_+	DNA polymerase III subunit alpha	NA	A0A0A7RWA3	Clostridium_phage	35.0	3.6e-28
QAT39880.1|1297461_1299729_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
QAT41629.1|1300269_1301640_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
QAT39881.1|1307227_1307449_+	hypothetical protein	NA	A0A172JI00	Bacillus_phage	47.8	5.3e-13
QAT39882.1|1307630_1309490_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
QAT39883.1|1309915_1311169_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39884.1|1311515_1312100_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
QAT39885.1|1312253_1312883_+	SOS response-associated peptidase	NA	NA	NA	NA	NA
QAT39886.1|1312933_1313143_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	44.4	7.5e-09
QAT39887.1|1313259_1314213_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
QAT39888.1|1314700_1315963_+	GTPase HflX	NA	NA	NA	NA	NA
QAT39889.1|1316053_1316881_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.0	1.0e-16
QAT39890.1|1317330_1318605_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	40.1	1.4e-60
QAT39891.1|1318984_1320238_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT39892.1|1320498_1321416_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
QAT39893.1|1321546_1322626_+	glycoside hydrolase	NA	NA	NA	NA	NA
QAT39894.1|1322674_1323967_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
QAT39895.1|1324033_1324996_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
QAT39896.1|1325514_1326768_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT39897.1|1327473_1329288_+	dextranase	NA	NA	NA	NA	NA
QAT39898.1|1329320_1331030_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39899.1|1331062_1332736_+	alpha-glucosidase	NA	NA	NA	NA	NA
QAT41630.1|1332881_1333778_+	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	55.9	4.6e-79
QAT39900.1|1334114_1335623_+	L-lactate permease	NA	NA	NA	NA	NA
QAT39901.1|1335656_1336931_+	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
QAT39902.1|1336967_1337756_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
QAT39903.1|1337789_1338998_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
QAT39904.1|1339031_1340447_+	FAD-binding protein	NA	NA	NA	NA	NA
QAT39905.1|1340527_1341697_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
QAT39906.1|1341844_1343662_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	G9E4U6	Ostreococcus_lucimarinus_virus	41.8	4.0e-106
QAT39907.1|1343695_1344265_+	nitroreductase	NA	NA	NA	NA	NA
QAT39908.1|1344426_1344942_+	hypothetical protein	NA	NA	NA	NA	NA
QAT39909.1|1345194_1345395_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.5	3.2e-17
QAT39910.1|1345521_1346433_-	cation transporter	NA	NA	NA	NA	NA
QAT41631.1|1346675_1348046_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	1509437	1517443	3223191		Grouper_iridovirus(28.57%)	9	NA	NA
QAT40071.1|1509437_1510256_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.0	2.5e-55
QAT40072.1|1510278_1511097_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	47.2	2.2e-59
QAT40073.1|1511113_1512418_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	56.2	9.2e-129
QAT40074.1|1512546_1513731_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.4	2.8e-31
QAT40075.1|1513815_1514577_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.6	2.9e-10
QAT40076.1|1514563_1515148_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	38.3	6.7e-23
QAT40077.1|1515144_1515612_-	sporulation protein YtfJ	NA	NA	NA	NA	NA
QAT40078.1|1515644_1516205_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
QAT40079.1|1516324_1517443_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	31.8	4.9e-06
>prophage 10
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	1862374	1924447	3223191	transposase,tRNA,protease	Bacillus_virus(18.18%)	56	NA	NA
QAT40375.1|1862374_1863580_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
QAT40376.1|1863967_1864516_-	BMC domain-containing protein	NA	NA	NA	NA	NA
QAT40377.1|1864533_1865859_-	proton-conducting membrane transporter	NA	NA	NA	NA	NA
QAT40378.1|1865881_1867297_-	aldehyde dehydrogenase EutE	NA	NA	NA	NA	NA
QAT40379.1|1867283_1868252_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
QAT40380.1|1868279_1868549_-	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
QAT40381.1|1868561_1869332_-	flavoprotein	NA	NA	NA	NA	NA
QAT40382.1|1869327_1870152_-	ethanolamine utilization protein EutJ	NA	NA	NA	NA	NA
QAT40383.1|1870157_1870814_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
QAT40384.1|1870829_1871234_-	BMC domain-containing protein	NA	NA	NA	NA	NA
QAT40385.1|1871248_1871668_-	propanediol dehydratase	NA	NA	NA	NA	NA
QAT40386.1|1871669_1873490_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
QAT40387.1|1873565_1874081_-	diol dehydratase small subunit	NA	NA	NA	NA	NA
QAT41664.1|1874092_1874755_-	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
QAT40388.1|1874780_1876445_-	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
QAT40389.1|1876467_1877355_-	propanediol utilization microcompartment protein PduB	NA	NA	NA	NA	NA
QAT40390.1|1877373_1877652_-	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
QAT40391.1|1877852_1879064_+	histidine kinase	NA	NA	NA	NA	NA
QAT40392.1|1879078_1879834_+	response regulator	NA	NA	NA	NA	NA
QAT40393.1|1879885_1880641_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
QAT40394.1|1880646_1882365_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.1	1.1e-09
QAT40395.1|1882528_1883644_-|transposase	transposase	transposase	D2XQ03	Bacillus_virus	66.9	1.2e-140
QAT41665.1|1884676_1885534_+	hypothetical protein	NA	NA	NA	NA	NA
QAT40396.1|1885644_1886436_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
QAT40397.1|1886492_1887938_-	FAD/NAD(P)-binding oxidoreductase	NA	NA	NA	NA	NA
QAT40398.1|1888065_1888749_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
QAT40399.1|1888750_1890943_-	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	28.0	1.8e-31
QAT40400.1|1890962_1891196_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
QAT40401.1|1891205_1891592_-	VOC family protein	NA	NA	NA	NA	NA
QAT40402.1|1891672_1892416_-	ABC transporter permease	NA	NA	NA	NA	NA
QAT40403.1|1892399_1893179_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	5.3e-31
QAT40404.1|1893195_1893768_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
QAT40405.1|1893773_1894634_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
QAT40406.1|1894614_1896066_-	menaquinone biosynthesis decarboxylase	NA	NA	NA	NA	NA
QAT40407.1|1896166_1897018_-	FMN-binding protein	NA	NA	NA	NA	NA
QAT40408.1|1897339_1899151_+	DoxX family membrane protein	NA	NA	NA	NA	NA
QAT40409.1|1899239_1899620_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
QAT40410.1|1899632_1900151_+	Gx transporter family protein	NA	NA	NA	NA	NA
QAT40411.1|1900170_1901136_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
QAT40412.1|1901355_1902246_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
QAT40413.1|1902403_1903498_+	hypothetical protein	NA	NA	NA	NA	NA
QAT41666.1|1903791_1904955_+|transposase	transposase	transposase	Q331V1	Clostridium_botulinum_C_phage	78.6	1.2e-156
QAT40414.1|1905115_1905760_+	response regulator	NA	NA	NA	NA	NA
QAT40415.1|1905845_1906109_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
QAT40416.1|1906184_1906889_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.0e-37
QAT40417.1|1906885_1908295_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	37.0	8.3e-35
QAT40418.1|1908359_1908863_+	hypothetical protein	NA	NA	NA	NA	NA
QAT40419.1|1908872_1910672_-	DNA mismatch repair protein	NA	E3T5Q7	Cafeteria_roenbergensis_virus	28.3	5.3e-18
QAT40420.1|1910931_1912185_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT40421.1|1912445_1914719_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.1	1.3e-125
QAT40422.1|1914933_1916379_+	amino acid permease	NA	NA	NA	NA	NA
QAT40423.1|1917743_1918871_+	ThiF family adenylyltransferase	NA	A0A291ATS8	Pandoravirus	28.7	1.4e-05
QAT40424.1|1918870_1920043_+	hypothetical protein	NA	NA	NA	NA	NA
QAT40425.1|1920035_1920557_+	hypothetical protein	NA	NA	NA	NA	NA
QAT40426.1|1921140_1922769_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	31.6	5.1e-52
QAT41667.1|1923076_1924447_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	2155917	2213523	3223191	transposase,integrase,protease	Bacillus_phage(14.29%)	50	2202127:2202144	2206533:2206550
QAT40619.1|2155917_2156409_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
QAT40620.1|2156410_2157796_-	Ni/Fe hydrogenase	NA	NA	NA	NA	NA
QAT40621.1|2157815_2158682_-	Ni/Fe hydrogenase	NA	NA	NA	NA	NA
QAT40622.1|2158820_2160887_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAT40623.1|2161058_2162432_+	MATE family efflux transporter	NA	NA	NA	NA	NA
QAT40624.1|2162436_2162853_-	steroid-binding protein	NA	NA	NA	NA	NA
QAT40625.1|2162896_2164165_-	hybrid sensor histidine kinase/response regulator	NA	W8CYF6	Bacillus_phage	29.3	4.3e-30
QAT40626.1|2164310_2166269_-	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
QAT40627.1|2166417_2167158_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	8.8e-28
QAT40628.1|2167177_2167945_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
QAT40629.1|2168001_2168832_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
QAT40630.1|2169203_2169854_-	hemolysin D	NA	NA	NA	NA	NA
QAT40631.1|2169875_2170487_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40632.1|2170964_2172572_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40633.1|2172978_2173902_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT40634.1|2174256_2174916_+	phosphatidic acid phosphatase	NA	NA	NA	NA	NA
QAT40635.1|2174916_2175933_+	glycosyltransferase	NA	NA	NA	NA	NA
QAT40636.1|2175961_2177080_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	67.6	2.1e-150
QAT40637.1|2177303_2178638_+	hypothetical protein	NA	NA	NA	NA	NA
QAT40638.1|2178679_2179471_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40639.1|2179513_2180395_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
QAT40640.1|2180478_2181135_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
QAT40641.1|2181256_2182540_+	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
QAT40642.1|2182575_2183286_+	aquaporin family protein	NA	NA	NA	NA	NA
QAT40643.1|2183364_2184489_-	radical SAM protein	NA	NA	NA	NA	NA
QAT40644.1|2184624_2185122_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40645.1|2185118_2185784_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41681.1|2185865_2186426_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
QAT40646.1|2186917_2187751_-	xanthine dehydrogenase	NA	NA	NA	NA	NA
QAT40647.1|2190257_2190974_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40648.1|2190974_2193641_-	DEAD/DEAH box helicase	NA	L0CLR3	Thysanoplusia_orichalcea_nucleopolyhedrovirus	27.9	3.6e-39
QAT40649.1|2193698_2194802_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
QAT40650.1|2194863_2195370_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
QAT40651.1|2195557_2195932_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
QAT40652.1|2196071_2196860_-	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	39.7	8.6e-05
QAT40653.1|2197070_2198441_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
QAT40654.1|2198433_2198763_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAT40655.1|2198902_2199316_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40656.1|2199396_2199582_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40657.1|2199606_2199999_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40658.1|2200126_2201317_-	MFS transporter	NA	NA	NA	NA	NA
QAT40659.1|2201321_2201702_-	hypothetical protein	NA	NA	NA	NA	NA
2202127:2202144	attL	CTTGGGAACAGCGTAAGT	NA	NA	NA	NA
QAT40660.1|2202164_2202698_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
QAT40661.1|2202717_2203644_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	48.7	1.0e-81
QAT40662.1|2203747_2205337_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.5	1.8e-134
QAT40663.1|2205369_2206605_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
2206533:2206550	attR	ACTTACGCTGTTCCCAAG	NA	NA	NA	NA
QAT40664.1|2209517_2210483_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
QAT40665.1|2210458_2210767_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT40666.1|2211318_2211894_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
QAT40667.1|2212269_2213523_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	2252599	2258436	3223191		Cyanophage(33.33%)	6	NA	NA
QAT40698.1|2252599_2254099_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	42.7	1.9e-61
QAT40699.1|2254118_2254733_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.2	1.1e-23
QAT40700.1|2254749_2255748_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A127KMF9	Cyanophage	45.5	3.2e-65
QAT40701.1|2255785_2257219_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.6	3.2e-58
QAT40702.1|2257245_2257956_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	44.5	2.1e-42
QAT40703.1|2257956_2258436_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	46.2	5.2e-29
>prophage 13
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	2308818	2371067	3223191	transposase,tRNA,protease,coat	Vibrio_phage(15.38%)	58	NA	NA
QAT40747.1|2308818_2310447_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	31.6	5.1e-52
QAT40748.1|2310522_2311347_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
QAT40749.1|2311337_2312033_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
QAT40750.1|2312059_2312947_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40751.1|2313021_2314104_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.0	1.1e-37
QAT40752.1|2314105_2315881_-	DNA primase	NA	A0A1S5RH70	Helicobacter_phage	24.3	1.7e-40
QAT40753.1|2316127_2317156_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
QAT40754.1|2317303_2318371_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
QAT40755.1|2318422_2321056_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	41.1	2.6e-90
QAT40756.1|2321127_2321769_-	transcriptional regulator	NA	NA	NA	NA	NA
QAT40757.1|2322081_2322639_-	DUF4342 domain-containing protein	NA	NA	NA	NA	NA
QAT40758.1|2322631_2323387_-	DNA repair protein RecO	NA	NA	NA	NA	NA
QAT40759.1|2323398_2324286_-	GTPase Era	NA	NA	NA	NA	NA
QAT40760.1|2324352_2324751_-	cytidine deaminase	NA	NA	NA	NA	NA
QAT40761.1|2324841_2325540_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
QAT40762.1|2325578_2326079_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
QAT40763.1|2326090_2328169_-	HD family phosphohydrolase	NA	NA	NA	NA	NA
QAT40764.1|2328204_2329356_-	sporulation protein YqfD	NA	NA	NA	NA	NA
QAT40765.1|2329342_2329633_-	sporulation protein YqfC	NA	NA	NA	NA	NA
QAT40766.1|2329727_2330174_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.4	8.0e-16
QAT40767.1|2330201_2330378_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
QAT40768.1|2330529_2330874_-	histidine triad nucleotide-binding protein	NA	X4YWA8	Lactococcus_phage	30.5	8.3e-05
QAT40769.1|2330915_2332229_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
QAT40770.1|2332245_2333007_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
QAT40771.1|2333021_2333957_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
QAT40772.1|2334035_2335172_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	33.4	8.5e-30
QAT40773.1|2335367_2337272_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.0	5.8e-140
QAT41691.1|2337344_2337938_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
QAT40774.1|2338084_2339122_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
QAT40775.1|2339312_2340437_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
QAT40776.1|2340452_2342264_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.2	2.9e-24
QAT40777.1|2342380_2342722_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41692.1|2342807_2343848_-	stage II sporulation protein P	NA	NA	NA	NA	NA
QAT40778.1|2344108_2345083_-	GPR endopeptidase	NA	NA	NA	NA	NA
QAT40779.1|2345290_2345557_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
QAT40780.1|2345598_2346621_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
QAT40781.1|2346635_2348234_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
QAT40782.1|2348311_2348572_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40783.1|2348655_2351070_-	cation-transporting P-type ATPase	NA	NA	NA	NA	NA
QAT41693.1|2351348_2352719_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
QAT40784.1|2353258_2353813_+	hypothetical protein	NA	NA	NA	NA	NA
QAT40785.1|2354533_2354743_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40786.1|2354887_2356747_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
QAT40787.1|2357059_2358313_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT40788.1|2358535_2359714_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
QAT40789.1|2359879_2361211_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
QAT40790.1|2361320_2361917_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	35.4	1.1e-15
QAT40791.1|2361990_2363310_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	53.9	3.5e-120
QAT40792.1|2363329_2363725_-	HNH endonuclease	NA	A0A0A7RUU3	Clostridium_phage	44.8	2.1e-20
QAT40793.1|2363861_2364191_+	hypothetical protein	NA	NA	NA	NA	NA
QAT40794.1|2364332_2365043_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
QAT41694.1|2365195_2366038_+	YitT family protein	NA	NA	NA	NA	NA
QAT40795.1|2366277_2367147_-	response regulator	NA	NA	NA	NA	NA
QAT40796.1|2367235_2367979_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.6	7.8e-16
QAT40797.1|2368134_2369019_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
QAT40798.1|2369135_2369630_+	thiol peroxidase	NA	NA	NA	NA	NA
QAT40799.1|2369726_2370365_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
QAT40800.1|2370413_2371067_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 14
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	2376521	2412285	3223191	transposase,tail,capsid,terminase,portal,plate	Clostridium_phage(45.45%)	43	NA	NA
QAT40805.1|2376521_2377994_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
QAT40806.1|2378217_2379243_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40807.1|2379269_2380274_-	exopolysaccharide biosynthesis protein	NA	A0A291LB83	Escherichia_phage	39.8	3.9e-10
QAT40808.1|2380527_2381904_-	PhoH family protein	NA	A0A141HS37	Bacillus_phage	48.0	4.5e-118
QAT40809.1|2382058_2382487_+	hypothetical protein	NA	NA	NA	NA	NA
QAT41695.1|2383249_2385577_-	hypothetical protein	NA	A0A2H4J056	uncultured_Caudovirales_phage	36.7	9.0e-135
QAT40810.1|2385582_2385777_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40811.1|2385789_2386182_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40812.1|2386471_2386672_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40813.1|2386656_2387535_-	ParM/StbA family protein	NA	G3MAP7	Bacillus_virus	24.8	7.5e-10
QAT40814.1|2387701_2387872_-	XRE family transcriptional regulator	NA	A0A2H4J765	uncultured_Caudovirales_phage	66.1	1.8e-13
QAT40815.1|2388114_2388669_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40816.1|2388734_2389514_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7RVQ3	Clostridium_phage	54.0	2.1e-43
QAT40817.1|2389526_2389760_-	hypothetical protein	NA	A0A0A7S0T7	Clostridium_phage	61.0	4.6e-23
QAT40818.1|2389806_2390043_-	XRE family transcriptional regulator	NA	A0A2K9V4D5	Faecalibacterium_phage	51.3	3.9e-14
QAT40819.1|2390330_2390510_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40820.1|2390510_2391422_-	hypothetical protein	NA	A0A2K9VH60	Faecalibacterium_phage	32.1	2.6e-21
QAT40821.1|2391478_2392171_-	hypothetical protein	NA	I1TJW8	Clostridium_phage	53.9	2.5e-64
QAT40822.1|2392210_2393269_-	RNA-dependent DNA polymerase	NA	H7BVN0	unidentified_phage	51.6	8.6e-93
QAT40823.1|2393548_2393890_-	four helix bundle protein	NA	A0A2K9VGX0	Faecalibacterium_phage	51.8	5.5e-25
QAT40824.1|2393979_2394405_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40825.1|2394415_2394961_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
QAT40826.1|2394953_2396039_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	36.0	4.7e-46
QAT40827.1|2396031_2396466_-	DUF2634 domain-containing protein	NA	A0A0A8WJ32	Clostridium_phage	45.5	4.4e-27
QAT40828.1|2396462_2396828_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
QAT40829.1|2396838_2397792_-|terminase	terminase	terminase	A0A0A7RWY4	Clostridium_phage	36.2	3.0e-52
QAT40830.1|2397804_2398533_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0A8WJR4	Clostridium_phage	45.5	1.2e-29
QAT40831.1|2398547_2400326_-	hypothetical protein	NA	A0A0A7RVT5	Clostridium_phage	56.2	8.4e-24
QAT40832.1|2400322_2400781_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40833.1|2400842_2401472_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40834.1|2401696_2402095_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40835.1|2402107_2402560_-|portal	phage portal protein	portal	A0A0A7RVT1	Clostridium_phage	47.5	8.9e-31
QAT40836.1|2402572_2403646_-|tail	phage tail sheath protein	tail	A0A0A7S0D2	Clostridium_phage	44.8	4.8e-75
QAT40837.1|2403645_2404089_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40838.1|2404092_2404554_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
QAT40839.1|2404735_2405062_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40840.1|2405058_2405622_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40841.1|2405572_2405755_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40842.1|2405813_2406929_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
QAT40843.1|2406931_2407816_-	hypothetical protein	NA	A0A1B1IQC0	uncultured_Mediterranean_phage	26.9	9.6e-13
QAT40844.1|2407876_2408068_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40845.1|2408069_2410781_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	28.0	1.3e-63
QAT40846.1|2410809_2412285_-|terminase	terminase	terminase	W8EEU4	Geobacillus_phage	49.6	5.7e-135
>prophage 15
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	2545365	2587104	3223191	transposase,tRNA,integrase	Streptococcus_phage(33.33%)	50	2567900:2567928	2587165:2587193
QAT40977.1|2545365_2545674_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT40978.1|2545649_2546615_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
QAT40979.1|2546839_2547343_-	N-acetyltransferase	NA	NA	NA	NA	NA
QAT40980.1|2547381_2547606_-	DUF2700 domain-containing protein	NA	NA	NA	NA	NA
QAT40981.1|2547747_2547987_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40982.1|2548119_2548461_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
QAT40983.1|2548943_2549294_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
QAT40984.1|2550210_2550435_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40985.1|2551011_2551302_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40986.1|2551416_2553117_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
QAT40987.1|2553150_2554029_-	DMT family transporter	NA	NA	NA	NA	NA
QAT40988.1|2554056_2555265_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
QAT40989.1|2555306_2556572_-	MFS transporter	NA	NA	NA	NA	NA
QAT40990.1|2557090_2558719_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	31.6	5.1e-52
QAT40991.1|2558817_2559459_-	hypothetical protein	NA	NA	NA	NA	NA
QAT40992.1|2559823_2560267_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAT40993.1|2560279_2561569_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	37.2	2.9e-66
QAT40994.1|2562018_2563293_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	40.1	1.4e-60
QAT40995.1|2563414_2563564_-	YvrJ family protein	NA	NA	NA	NA	NA
QAT40996.1|2563711_2563930_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
QAT40997.1|2563973_2564198_-	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
QAT40998.1|2564487_2565102_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
QAT40999.1|2565112_2565682_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
QAT41000.1|2565749_2566661_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41001.1|2566626_2567748_-	PRD domain-containing protein	NA	NA	NA	NA	NA
2567900:2567928	attL	AAAAAAGAACCGCCATTTCTGACGATTCT	NA	NA	NA	NA
QAT41002.1|2567954_2568743_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41003.1|2568735_2569875_-	ATP-binding protein	NA	NA	NA	NA	NA
QAT41004.1|2570040_2570310_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
QAT41703.1|2570386_2570749_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41005.1|2571415_2572810_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
QAT41006.1|2572855_2574007_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
QAT41007.1|2574029_2574938_-	ATP-binding protein	NA	NA	NA	NA	NA
QAT41008.1|2574989_2576633_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	30.9	6.1e-37
QAT41009.1|2576903_2577476_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41010.1|2577509_2578061_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	51.4	4.1e-46
QAT41011.1|2578357_2579161_+	restriction endonuclease	NA	NA	NA	NA	NA
QAT41012.1|2579197_2580175_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	M4QMR9	Micromonas_pusilla_virus	28.8	7.6e-19
QAT41013.1|2580926_2581703_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
QAT41014.1|2581787_2581994_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41015.1|2582304_2582598_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41016.1|2582601_2582850_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41017.1|2583042_2583225_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41018.1|2583224_2583593_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41019.1|2583594_2583858_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41020.1|2583876_2584065_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41021.1|2584744_2584900_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
QAT41022.1|2584930_2585326_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41023.1|2585452_2585647_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
QAT41024.1|2585885_2586545_-	ATP-binding protein	NA	NA	NA	NA	NA
QAT41025.1|2586546_2587104_-|transposase	transposase	transposase	NA	NA	NA	NA
2587165:2587193	attR	AAAAAAGAACCGCCATTTCTGACGATTCT	NA	NA	NA	NA
>prophage 16
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	2898501	2959318	3223191	transposase,holin,tRNA	Bacillus_phage(30.77%)	46	NA	NA
QAT41276.1|2898501_2899911_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	31.8	4.6e-41
QAT41277.1|2900276_2902829_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
QAT41278.1|2902867_2903707_-	YihY/virulence factor BrkB family protein	NA	H9YQA7	environmental_Halophage	28.6	3.4e-07
QAT41279.1|2903743_2905225_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.6	7.2e-37
QAT41280.1|2905221_2905899_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	4.3e-45
QAT41281.1|2906364_2907006_-	dihydroorotate dehydrogenase	NA	A0A076FI83	Aureococcus_anophage	26.4	1.9e-10
QAT41282.1|2907183_2907603_+	DUF3842 family protein	NA	NA	NA	NA	NA
QAT41716.1|2907662_2908055_+	hypothetical protein	NA	NA	NA	NA	NA
QAT41283.1|2908102_2908690_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
QAT41284.1|2908969_2909620_+	hemolysin III family protein	NA	NA	NA	NA	NA
QAT41717.1|2909656_2912455_-	ATP-dependent helicase	NA	A0A142KCD4	Gordonia_phage	26.9	1.6e-37
QAT41285.1|2913103_2913505_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
QAT41286.1|2914179_2914935_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
QAT41287.1|2915026_2915944_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAT41288.1|2916180_2918010_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.3	7.2e-55
QAT41289.1|2918031_2919834_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	5.1e-45
QAT41290.1|2920621_2921584_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT41291.1|2921757_2922552_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAT41292.1|2922597_2923254_-	ABC transporter permease	NA	NA	NA	NA	NA
QAT41293.1|2923246_2924212_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	1.9e-30
QAT41294.1|2924602_2925811_+	HD domain-containing protein	NA	NA	NA	NA	NA
QAT41295.1|2926103_2927486_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT41296.1|2928025_2929498_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
QAT41297.1|2929738_2931232_+	spore germination protein	NA	NA	NA	NA	NA
QAT41298.1|2931212_2932298_+	hypothetical protein	NA	NA	NA	NA	NA
QAT41299.1|2932300_2933419_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
QAT41300.1|2933533_2933899_-|holin	phage holin family protein	holin	NA	NA	NA	NA
QAT41301.1|2934015_2935347_-	amino acid permease	NA	NA	NA	NA	NA
QAT41302.1|2935785_2936928_-	serine/threonine protein kinase	NA	W5S4J6	Pithovirus	29.3	5.4e-16
QAT41718.1|2937058_2937232_-	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
QAT41303.1|2937900_2939184_-	L-sorbose 1-phosphate reductase	NA	NA	NA	NA	NA
QAT41304.1|2939203_2940139_-	1-phosphofructokinase	NA	NA	NA	NA	NA
QAT41305.1|2940150_2940585_-	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
QAT41306.1|2940585_2942640_-	PRD domain-containing protein	NA	NA	NA	NA	NA
QAT41307.1|2942663_2944085_-	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
QAT41719.1|2944285_2944828_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
QAT41308.1|2945003_2947151_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.5	1.9e-123
QAT41309.1|2947341_2949903_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.5	1.8e-48
QAT41310.1|2950583_2951858_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT41311.1|2952131_2952671_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
QAT41312.1|2952762_2954073_-	MATE family efflux transporter	NA	NA	NA	NA	NA
QAT41313.1|2954137_2954968_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
QAT41314.1|2954967_2955414_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41315.1|2955486_2955840_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41316.1|2956805_2957267_-	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
QAT41317.1|2957689_2959318_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	31.7	2.5e-51
>prophage 17
CP035280	Clostridium sp. JN-9 chromosome, complete genome	3223191	3056588	3135532	3223191	transposase,tRNA,protease	Bacillus_phage(23.53%)	56	NA	NA
QAT41422.1|3056588_3057986_-|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	30.9	3.1e-50
QAT41423.1|3059113_3060325_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
QAT41424.1|3060447_3061533_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
QAT41425.1|3061822_3062227_+	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
QAT41426.1|3062264_3063338_-	DNA integrity scanning protein DisA	NA	NA	NA	NA	NA
QAT41427.1|3063362_3064718_-	DNA repair protein RadA	NA	NA	NA	NA	NA
QAT41428.1|3064880_3065615_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
QAT41429.1|3065808_3068262_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	35.8	4.1e-130
QAT41430.1|3068283_3069315_-	protein arginine kinase	NA	NA	NA	NA	NA
QAT41431.1|3069326_3069848_-	excinuclease	NA	NA	NA	NA	NA
QAT41432.1|3069893_3070352_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
QAT41433.1|3070480_3071431_-	ROK family protein	NA	NA	NA	NA	NA
QAT41434.1|3071525_3071753_-	hypothetical protein	NA	NA	NA	NA	NA
QAT41435.1|3071896_3073981_-	elongation factor G	NA	NA	NA	NA	NA
QAT41436.1|3085571_3086951_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
QAT41437.1|3087372_3088764_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SAN4	Catovirus	27.6	2.0e-52
QAT41438.1|3089261_3089870_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	68.7	9.0e-79
QAT41439.1|3090406_3091915_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	40.6	9.1e-96
QAT41440.1|3091932_3092415_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
QAT41441.1|3092656_3093628_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
QAT41442.1|3093627_3094416_-	type III pantothenate kinase	NA	NA	NA	NA	NA
QAT41443.1|3094534_3096340_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	48.7	2.3e-106
QAT41444.1|3096419_3096956_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.6	1.7e-12
QAT41725.1|3096952_3098311_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
QAT41445.1|3098539_3100930_-	stage II sporulation protein E	NA	NA	NA	NA	NA
QAT41446.1|3101872_3102286_-	RNA-binding protein S1	NA	NA	NA	NA	NA
QAT41726.1|3102347_3102617_-	septum formation initiator family protein	NA	NA	NA	NA	NA
QAT41447.1|3102713_3103124_-	spore cortex biosynthesis protein YabQ	NA	NA	NA	NA	NA
QAT41448.1|3103133_3103424_-	sporulation protein YabP	NA	NA	NA	NA	NA
QAT41449.1|3103497_3103755_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
QAT41450.1|3103844_3104120_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	58.4	2.8e-19
QAT41451.1|3104220_3105666_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
QAT41452.1|3105679_3107215_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
QAT41453.1|3107413_3107965_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	7.3e-11
QAT41454.1|3108124_3109135_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
QAT41455.1|3109400_3110654_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT41456.1|3110841_3114363_-	transcription-repair coupling factor	NA	A0A2K9L170	Tupanvirus	31.5	2.7e-05
QAT41457.1|3114381_3114948_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
QAT41727.1|3115053_3116229_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
QAT41458.1|3116265_3117684_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	36.0	9.9e-36
QAT41459.1|3117686_3118373_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	46.0	2.0e-50
QAT41460.1|3118538_3119498_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.5	4.3e-43
QAT41461.1|3119523_3120894_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	36.6	5.4e-39
QAT41462.1|3121042_3121330_-	septation protein SpoVG	NA	NA	NA	NA	NA
QAT41463.1|3121432_3122248_-	pur operon repressor	NA	NA	NA	NA	NA
QAT41464.1|3122531_3123908_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
QAT41465.1|3123972_3124287_+	hypothetical protein	NA	NA	NA	NA	NA
QAT41466.1|3124723_3126073_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
QAT41467.1|3126205_3126859_+	HAD family phosphatase	NA	NA	NA	NA	NA
QAT41468.1|3126914_3127328_+	hypothetical protein	NA	NA	NA	NA	NA
QAT41469.1|3127386_3128469_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
QAT41470.1|3128551_3130138_-	peptidoglycan-binding protein	NA	A0A172JII6	Bacillus_phage	34.8	5.9e-13
QAT41471.1|3130364_3131540_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
QAT41472.1|3131649_3133278_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	31.6	5.1e-52
QAT41473.1|3133472_3134210_-	2-phosphosulfolactate phosphatase family protein	NA	NA	NA	NA	NA
QAT41474.1|3134368_3135532_-|transposase	transposase	transposase	Q331V1	Clostridium_botulinum_C_phage	77.5	5.4e-157
