The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035267	Weissella cibaria strain SRCM103448 chromosome, complete genome	2397676	424899	477475	2397676	protease,transposase,tRNA	Staphylococcus_phage(25.0%)	45	NA	NA
QAT24805.1|424899_425796_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	1.9e-45
QAT24806.1|425750_426257_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT24807.1|426328_426748_-	hypothetical protein	NA	NA	NA	NA	NA
QAT24808.1|426740_427556_-	hypothetical protein	NA	NA	NA	NA	NA
QAT24809.1|427692_428595_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
QAT24810.1|428895_430518_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAT24811.1|430529_431696_+	amidohydrolase family protein	NA	NA	NA	NA	NA
QAT24812.1|431771_433628_+	hypothetical protein	NA	NA	NA	NA	NA
QAT24813.1|433677_434277_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAT24814.1|434458_435853_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
QAT24815.1|436008_438501_+	ATP-binding cassette domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.1	5.1e-120
QAT24816.1|438591_439434_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	29.6	1.7e-22
QAT24817.1|439642_440491_+	DegV family protein	NA	NA	NA	NA	NA
QAT24818.1|440706_441468_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
QAT24819.1|441523_441955_+	DUF1810 family protein	NA	A0A2H4UVK5	Bodo_saltans_virus	41.2	2.6e-16
QAT24820.1|442213_442810_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	48.1	4.7e-40
QAT24821.1|443067_443394_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
QAT24822.1|443393_443717_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
QAT24823.1|444179_445205_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	NA	NA	NA	NA
QAT24824.1|445204_445792_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.2	7.0e-28
QAT24825.1|445797_446991_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.0	2.9e-89
QAT24826.1|447006_447471_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.0	3.6e-27
QAT24827.1|447577_448384_+	hypothetical protein	NA	NA	NA	NA	NA
QAT24828.1|448435_448873_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
QAT24829.1|449042_449951_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	4.9e-28
QAT24830.1|449957_451481_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
QAT24831.1|451533_452709_-	MFS transporter	NA	NA	NA	NA	NA
QAT24832.1|452932_454117_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
QAT24833.1|454230_454953_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
QAT24834.1|454979_455342_+	hypothetical protein	NA	NA	NA	NA	NA
QAT24835.1|455533_455938_+	hypothetical protein	NA	NA	NA	NA	NA
QAT24836.1|456265_456574_+	hypothetical protein	NA	NA	NA	NA	NA
QAT24837.1|456610_456823_+	hypothetical protein	NA	NA	NA	NA	NA
QAT24838.1|456937_457786_-	hypothetical protein	NA	NA	NA	NA	NA
QAT24839.1|457957_458383_+	GtrA family protein	NA	NA	NA	NA	NA
QAT24840.1|458379_459225_+	HAD family hydrolase	NA	NA	NA	NA	NA
QAT24841.1|459346_460135_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	45.1	5.0e-21
QAT24842.1|460145_460937_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
QAT24843.1|461029_462289_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
QAT24844.1|462455_464177_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
QAT24845.1|464699_469022_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	34.4	2.3e-19
QAT24846.1|474817_475432_+	TrmH family RNA methyltransferase	NA	NA	NA	NA	NA
QAT24847.1|475575_476049_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
QAT24848.1|476117_476624_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT24849.1|476578_477475_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	1.9e-45
>prophage 2
CP035267	Weissella cibaria strain SRCM103448 chromosome, complete genome	2397676	812537	828398	2397676	protease,transposase	Bacillus_phage(40.0%)	16	NA	NA
QAT25126.1|812537_813434_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
QAT25127.1|813506_814013_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT25128.1|813967_814864_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	1.9e-45
QAT25129.1|814932_816468_-	hypothetical protein	NA	NA	NA	NA	NA
QAT25130.1|816856_817651_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.1	4.7e-27
QAT26513.1|818155_819523_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.3	4.9e-125
QAT26514.1|819666_820659_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
QAT25131.1|820764_822072_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	28.7	7.5e-30
QAT25132.1|822296_822938_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
QAT25133.1|823144_824062_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25134.1|824054_824936_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25135.1|825036_825762_+	class A sortase	NA	NA	NA	NA	NA
QAT25136.1|825807_826464_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
QAT25137.1|826647_826962_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25138.1|827040_827937_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	1.9e-45
QAT25139.1|827891_828398_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP035267	Weissella cibaria strain SRCM103448 chromosome, complete genome	2397676	843558	876419	2397676	portal,head,integrase,tail,capsid,terminase	Enterococcus_phage(33.33%)	42	843528:843552	878840:878864
843528:843552	attL	ATTCGCACCAAATTCGCACCAAAAA	NA	NA	NA	NA
QAT25154.1|843558_844650_-|integrase	site-specific integrase	integrase	E3W8I1	Leuconostoc_phage	31.7	6.9e-37
QAT25155.1|845218_845731_-	hypothetical protein	NA	A0A0A1ERB0	Lactobacillus_phage	62.5	7.5e-10
QAT25156.1|845843_846140_-	hypothetical protein	NA	Q6SEG0	Lactobacillus_prophage	52.0	9.0e-24
QAT25157.1|846209_846575_-	hypothetical protein	NA	NA	NA	NA	NA
QAT25158.1|846795_847203_-	ImmA/IrrE family metallo-endopeptidase	NA	E3W8B8	Leuconostoc_phage	35.2	3.5e-10
QAT25159.1|847199_847544_-	XRE family transcriptional regulator	NA	A0A141DZM2	Streptococcus_phage	40.7	9.8e-14
QAT25160.1|848046_848799_+	oxidoreductase	NA	E3W8C2	Leuconostoc_phage	67.6	8.8e-84
QAT25161.1|848801_849035_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25162.1|849084_849309_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25163.1|849298_849487_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25164.1|849476_850004_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25165.1|850312_851239_+	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	27.8	2.6e-13
QAT25166.1|851249_852095_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25167.1|852108_852819_+	hypothetical protein	NA	D7RWH3	Brochothrix_phage	40.1	1.4e-35
QAT25168.1|852781_853582_+	DnaD domain protein	NA	A0A0S2MYA8	Enterococcus_phage	63.2	8.3e-40
QAT25169.1|853581_854307_+	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	33.2	4.6e-21
QAT25170.1|854309_854678_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25171.1|854733_854940_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAT25172.1|854939_855506_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25173.1|855505_855778_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25174.1|855777_856026_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25175.1|856022_856370_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25176.1|856373_856562_+	hypothetical protein	NA	NA	NA	NA	NA
QAT26515.1|856574_856775_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25177.1|856856_857270_+	ArpU family transcriptional regulator	NA	NA	NA	NA	NA
QAT25178.1|858368_858791_+|terminase	terminase small subunit	terminase	A0A1Q1PVS8	Bacillus_phage	34.8	7.3e-11
QAT25179.1|858783_860064_+|terminase	PBSX family phage terminase large subunit	terminase	Q8SDU9	Staphylococcus_phage	59.5	1.3e-140
QAT25180.1|860072_861620_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	58.2	3.7e-161
QAT25181.1|861606_862542_+|head	phage head morphogenesis protein	head	D2IYW4	Enterococcus_phage	42.1	2.0e-61
QAT25182.1|862659_863235_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	42.6	5.3e-12
QAT25183.1|863252_864155_+|capsid	phage capsid protein	capsid	D2IYW7	Enterococcus_phage	55.4	9.9e-82
QAT25184.1|864169_864454_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25185.1|864464_864806_+	hypothetical protein	NA	G8FUY6	Pediococcus_virus	42.1	3.4e-19
QAT25186.1|864805_865090_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25187.1|865092_865455_+	hypothetical protein	NA	A7J2A0	Streptococcus_phage	35.2	8.2e-11
QAT25188.1|865451_865820_+	hypothetical protein	NA	NA	NA	NA	NA
QAT25189.1|865828_866443_+|tail	phage major tail protein, TP901-1 family	tail	D2IYX2	Enterococcus_phage	55.4	1.5e-57
QAT25190.1|866528_866969_+	hypothetical protein	NA	D2IZN3	Enterococcus_phage	30.2	4.9e-10
QAT25191.1|867061_867268_+	hypothetical protein	NA	D2IYX5	Enterococcus_phage	45.5	2.0e-06
QAT25192.1|867284_870419_+|tail	phage tail tape measure protein	tail	A0A1B1SDY9	Weissella_phage	65.8	4.8e-99
QAT25193.1|870428_871325_+|tail	phage tail protein	tail	D2IYX7	Enterococcus_phage	40.3	9.0e-51
QAT25194.1|871334_876419_+	hypothetical protein	NA	A0A1B1SDS2	Weissella_phage	57.5	6.3e-141
878840:878864	attR	ATTCGCACCAAATTCGCACCAAAAA	NA	NA	NA	NA
>prophage 4
CP035267	Weissella cibaria strain SRCM103448 chromosome, complete genome	2397676	1663960	1672605	2397676		Synechococcus_phage(33.33%)	9	NA	NA
QAT25866.1|1663960_1664554_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	38.9	1.8e-23
QAT25867.1|1664544_1665585_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	40.5	4.1e-55
QAT25868.1|1665599_1667135_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	6.1e-47
QAT25869.1|1667119_1669342_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	4.9e-138
QAT25870.1|1669338_1670022_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
QAT25871.1|1670023_1670281_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
QAT25872.1|1670283_1671009_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	34.2	2.1e-29
QAT25873.1|1671005_1672124_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
QAT25874.1|1672116_1672605_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.4	2.9e-19
