The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	354020	360425	4744953		Caulobacter_phage(50.0%)	7	NA	NA
QAT63829.1|354020_354623_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.9	3.7e-24
QAT63830.1|354652_355234_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.9	4.8e-29
QAT63831.1|355299_355878_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.2	8.1e-29
QAT63832.1|355946_356720_+	DUF475 domain-containing protein	NA	S5MAL1	Bacillus_phage	63.5	3.3e-78
QAT63833.1|356823_358011_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
QAT67731.1|358000_359323_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.1	3.9e-10
QAT63834.1|359315_360425_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.5	6.1e-41
>prophage 2
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	655596	749802	4744953	protease,holin,integrase,transposase,head,portal,tail,capsid,plate,terminase,tRNA	Bacillus_phage(53.19%)	100	655589:655622	749777:749810
655589:655622	attL	CCACACACTTAGCCAAGCTTGGCTAAGTGTGTGG	NA	NA	NA	NA
QAT67758.1|655596_656955_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	40.3	4.2e-84
QAT64042.1|657079_658039_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
QAT64043.1|658041_658722_-	response regulator	NA	NA	NA	NA	NA
QAT64044.1|658718_660329_-	sensor histidine kinase	NA	NA	NA	NA	NA
QAT64045.1|660930_662352_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
QAT64046.1|662496_663912_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
QAT64047.1|669970_670954_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
QAT64048.1|670961_671438_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
QAT64049.1|671418_672111_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
QAT67759.1|672122_672581_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
QAT64050.1|672570_673596_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.6	3.3e-65
QAT64051.1|673830_675759_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.5	2.4e-61
QAT67760.1|675911_676424_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
QAT64052.1|676420_677068_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
QAT64053.1|677089_677266_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
QAT64054.1|677272_678037_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
QAT67761.1|678073_678253_-	DUF4305 domain-containing protein	NA	NA	NA	NA	NA
QAT64055.1|678252_678987_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
QAT64056.1|679211_679496_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	2.9e-19
QAT64057.1|679541_681173_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.2	1.3e-159
QAT64058.1|681254_682472_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	64.1	3.4e-141
QAT64059.1|682485_683118_-	XRE family transcriptional regulator	NA	A0A1B2APZ3	Phage_Wrath	61.0	2.1e-70
QAT64060.1|683282_683531_+	XRE family transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	67.1	5.0e-20
QAT64061.1|683553_683754_+	DNA-binding protein	NA	NA	NA	NA	NA
QAT67762.1|683765_684512_+	phage antirepressor Ant	NA	A0A0C5AFE7	Paenibacillus_phage	74.6	1.3e-100
QAT64062.1|684525_684756_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64063.1|685257_685638_-	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	41.6	2.0e-20
QAT64064.1|685697_685964_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	53.5	7.8e-19
QAT64065.1|686051_686294_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64066.1|686386_686944_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.9	7.0e-70
QAT64067.1|686947_687880_+	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	88.1	3.6e-151
QAT64068.1|687879_688317_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.0	8.2e-74
QAT64069.1|688377_690810_+	DNA primase	NA	D6R422	Bacillus_phage	81.4	0.0e+00
QAT64070.1|691070_691433_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64071.1|691410_691848_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.9	9.4e-62
QAT64072.1|691844_692384_+	nuclease	NA	Q9ZXC2	Bacillus_phage	90.5	1.3e-89
QAT64073.1|692380_692551_+	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	3.0e-08
QAT64074.1|692554_693070_+	hypothetical protein	NA	D6R425	Bacillus_phage	83.0	3.3e-82
QAT64075.1|693085_693484_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64076.1|693596_693977_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	84.6	3.0e-48
QAT64077.1|694629_694869_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64078.1|694855_695113_+	DUF2829 domain-containing protein	NA	F8WPN8	Bacillus_phage	62.7	9.8e-27
QAT64079.1|695109_695418_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64080.1|695645_696206_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64081.1|696192_696507_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64082.1|696533_696908_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	2.4e-29
QAT64083.1|697136_697652_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.8	1.7e-33
QAT64084.1|697648_699358_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.4	2.5e-206
QAT64085.1|699369_699561_+	DUF1056 family protein	NA	NA	NA	NA	NA
QAT64086.1|699561_700872_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.9	1.1e-105
QAT64087.1|700816_701548_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	56.4	8.9e-57
QAT64088.1|701587_702871_+|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.8	7.7e-80
QAT64089.1|702894_703323_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	59.0	6.5e-15
QAT64090.1|703343_703646_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	9.5e-13
QAT64091.1|703635_703944_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	37.6	8.2e-12
QAT64092.1|703943_704342_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64093.1|704338_704722_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64094.1|704736_705354_+|tail	phage tail protein	tail	NA	NA	NA	NA
QAT64095.1|705410_705776_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64096.1|705984_710454_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.6	1.2e-71
QAT64097.1|710453_711290_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.2	7.5e-108
QAT64098.1|711302_713015_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.9	5.8e-224
QAT64099.1|713049_715614_+	peptidase G2	NA	D6R401	Bacillus_phage	60.7	1.7e-307
QAT64100.1|715626_716967_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	50.6	3.1e-63
QAT64101.1|716981_717284_+	hypothetical protein	NA	O64053	Bacillus_phage	34.8	2.0e-07
QAT64102.1|717280_717457_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	45.8	8.5e-06
QAT64103.1|717491_717902_+|holin	holin	holin	A0A0N7GFE6	Paenibacillus_phage	50.0	3.9e-25
QAT64104.1|717953_718796_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	56.7	8.7e-48
QAT64105.1|718830_719247_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	58.0	3.5e-42
QAT64106.1|719258_720908_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	49.2	2.6e-56
QAT64107.1|721160_722282_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
QAT67763.1|722504_722825_-	YolD-like family protein	NA	O64030	Bacillus_phage	36.9	6.5e-12
QAT64108.1|722963_723776_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64109.1|723846_724065_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64110.1|724672_725062_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64111.1|725079_726678_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT64112.1|727281_727488_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
QAT64113.1|727534_728008_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64114.1|728025_728505_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
QAT64115.1|728504_729518_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
QAT64116.1|729518_729869_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
QAT64117.1|729884_730091_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
QAT67764.1|730167_730986_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
QAT64118.1|731007_731691_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	68.8	5.1e-54
QAT64119.1|731744_732116_-	VOC family protein	NA	NA	NA	NA	NA
QAT64120.1|732183_733569_-	amino acid permease	NA	NA	NA	NA	NA
QAT64121.1|734032_734902_-	peptidase	NA	NA	NA	NA	NA
QAT64122.1|735186_735648_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAT64123.1|735757_736210_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67765.1|736316_736934_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64124.1|737399_738011_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAT64125.1|738025_740650_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.2	3.8e-41
QAT64126.1|741032_741392_-	DUF488 family protein	NA	NA	NA	NA	NA
QAT64127.1|741481_742246_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
QAT64128.1|742378_743833_+	carboxylesterase/lipase family protein	NA	A0A140E1D0	Samba_virus	36.7	2.8e-33
QAT64129.1|743867_745136_-	MFS transporter	NA	NA	NA	NA	NA
QAT64130.1|745625_746675_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
QAT64131.1|746705_747533_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
QAT64132.1|747683_748316_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64133.1|748443_749802_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	40.3	4.2e-84
749777:749810	attR	CCACACACTTAGCCAAGCTTGGCTAAGTGTGTGG	NA	NA	NA	NA
>prophage 3
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	792714	802639	4744953		Synechococcus_phage(50.0%)	9	NA	NA
QAT64168.1|792714_794010_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.0	4.5e-19
QAT64169.1|794085_794802_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	43.7	9.7e-48
QAT64170.1|794803_795058_+	phosphoribosylformylglycinamidine synthase, purS protein	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
QAT64171.1|795054_795738_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
QAT64172.1|795721_797950_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	9.7e-163
QAT64173.1|797925_799356_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	1.7e-51
QAT64174.1|799479_800520_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
QAT64175.1|800516_801104_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.5	8.3e-29
QAT64176.1|801100_802639_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	9.6e-77
>prophage 4
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	1321252	1353654	4744953	coat,tRNA	Planktothrix_phage(40.0%)	36	NA	NA
QAT64610.1|1321252_1322242_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
QAT64611.1|1322973_1324602_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAT64612.1|1324703_1325639_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT64613.1|1325643_1326561_+	ABC transporter permease	NA	NA	NA	NA	NA
QAT64614.1|1326574_1327642_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	2.0e-17
QAT64615.1|1327643_1328567_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.0	1.6e-23
QAT64616.1|1328757_1329336_+	N-acetyltransferase	NA	NA	NA	NA	NA
QAT64617.1|1329512_1329908_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
QAT64618.1|1329956_1330619_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	39.9	7.1e-29
QAT64619.1|1330877_1331516_+	adaptor protein MecA	NA	NA	NA	NA	NA
QAT64620.1|1331637_1332786_+	competence protein CoiA	NA	NA	NA	NA	NA
QAT64621.1|1332782_1334816_+	oligoendopeptidase F	NA	NA	NA	NA	NA
QAT64622.1|1335444_1336338_-	DsbA family protein	NA	NA	NA	NA	NA
QAT64623.1|1336334_1336733_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
QAT64624.1|1337017_1337683_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	60.5	2.2e-38
QAT64625.1|1337695_1338268_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
QAT64626.1|1338396_1338762_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64627.1|1338792_1339428_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
QAT64628.1|1339445_1340246_+	NAD kinase	NA	NA	NA	NA	NA
QAT64629.1|1340257_1341148_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
QAT64630.1|1341163_1341904_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A7D9	Microcystis_virus	28.4	2.5e-14
QAT64631.1|1342203_1344048_+	sodium:proton antiporter	NA	NA	NA	NA	NA
QAT64632.1|1344303_1345005_+	thiaminase II	NA	NA	NA	NA	NA
QAT64633.1|1344979_1345597_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
QAT64634.1|1345580_1346693_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
QAT64635.1|1346689_1346893_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
QAT64636.1|1346896_1347664_+	thiazole synthase	NA	NA	NA	NA	NA
QAT64637.1|1347660_1348671_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
QAT64638.1|1348697_1349510_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
QAT64639.1|1349666_1350443_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
QAT64640.1|1350549_1351029_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
QAT64641.1|1351061_1351514_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAT64642.1|1351675_1352158_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAT64643.1|1352289_1352796_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAT64644.1|1352863_1353220_-|coat	spore coat protein	coat	NA	NA	NA	NA
QAT64645.1|1353267_1353654_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 5
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	1367268	1433250	4744953	holin,integrase,portal,tail,capsid,plate	Bacillus_phage(50.0%)	90	1360376:1360390	1410601:1410613
1360376:1360390	attL	AGATTTTGTTCAAGC	NA	NA	NA	NA
QAT67803.1|1367268_1368315_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	31.2	5.1e-13
1360376:1360390	attL	AGATTTTGTTCAAGC	NA	NA	NA	NA
QAT64661.1|1368638_1369508_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	59.2	8.5e-38
QAT64662.1|1369521_1370013_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64663.1|1370085_1370274_+	hypothetical protein	NA	NA	NA	NA	NA
1370117:1370131	attR	AGATTTTGTTCAAGC	NA	NA	NA	NA
QAT64664.1|1370270_1370621_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1370117:1370131	attR	AGATTTTGTTCAAGC	NA	NA	NA	NA
QAT64665.1|1370833_1371313_+	hypothetical protein	NA	A0A109ZVT6	Bacillus_phage	31.4	5.5e-15
QAT67804.1|1371484_1371814_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	33.9	2.5e-06
QAT64666.1|1372013_1372220_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64667.1|1372766_1373123_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	39.3	5.0e-13
QAT64668.1|1373122_1373530_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64669.1|1373513_1373888_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67805.1|1373904_1374927_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	51.2	3.5e-75
QAT64670.1|1374923_1375127_+	hypothetical protein	NA	A0A1P8CX62	Bacillus_phage	64.7	2.3e-15
QAT64671.1|1375144_1375324_+	hypothetical protein	NA	A0A1P8CX65	Bacillus_phage	66.7	4.0e-11
QAT64672.1|1375316_1376144_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	53.4	3.1e-74
QAT64673.1|1376140_1376629_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67806.1|1376628_1377060_+	hypothetical protein	NA	R4JMS5	Bacillus_phage	57.4	3.0e-36
QAT64674.1|1377059_1377263_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64675.1|1377259_1378624_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.2	1.5e-121
QAT64676.1|1378758_1379772_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.3	2.9e-74
QAT64677.1|1379861_1380290_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	62.3	3.3e-43
QAT64678.1|1380299_1380728_-	XRE family transcriptional regulator	NA	Q5YAA4	Bacillus_phage	56.7	6.0e-37
QAT64679.1|1381072_1381600_+	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	26.5	2.3e-06
QAT64680.1|1381893_1382418_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64681.1|1382665_1383445_+	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	50.8	2.3e-58
QAT64682.1|1383622_1384054_+	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	39.3	5.7e-11
QAT67807.1|1384053_1385112_+	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	28.4	7.2e-15
QAT64683.1|1385112_1385292_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64684.1|1385486_1387745_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	48.6	1.4e-172
QAT64685.1|1387744_1388449_+	3'-5' exonuclease	NA	U5PXE0	Bacillus_virus	41.7	5.1e-33
QAT64686.1|1388449_1389499_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	54.9	1.4e-82
QAT64687.1|1389498_1389708_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64688.1|1389700_1390264_+	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	42.4	2.9e-07
QAT64689.1|1390260_1390566_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SA91	Streptococcus_phage	32.6	6.2e-12
QAT64690.1|1390566_1390932_+	hypothetical protein	NA	X2JKY6	Bacillus_phage	37.4	7.0e-10
QAT64691.1|1390936_1391197_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64692.1|1391193_1391394_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64693.1|1391533_1391890_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	57.6	1.2e-30
QAT64694.1|1391879_1393979_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	78.8	0.0e+00
QAT64695.1|1394010_1394343_+	DUF1140 family protein	NA	NA	NA	NA	NA
QAT67808.1|1395070_1395592_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	74.6	7.8e-71
QAT64696.1|1396207_1396717_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.0	1.3e-41
QAT64697.1|1396691_1397198_+	Fis family transcriptional regulator	NA	A0A2H4J152	uncultured_Caudovirales_phage	48.7	3.7e-25
QAT67809.1|1397213_1397975_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	69.1	1.3e-87
QAT67810.1|1398119_1398665_+	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	62.4	3.2e-27
QAT64698.1|1398661_1398847_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64699.1|1398863_1399319_+	methyltransferase domain-containing protein	NA	A8ATY8	Listeria_phage	75.3	1.9e-65
QAT64700.1|1399335_1400340_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	39.4	7.0e-20
QAT64701.1|1400336_1400900_+	dephospho-CoA kinase	NA	A0A0N9SJZ0	Paenibacillus_phage	47.8	3.6e-37
QAT64702.1|1400888_1401275_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64703.1|1401393_1401783_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	44.3	6.7e-19
QAT64704.1|1401775_1402297_+	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	49.3	6.6e-30
QAT64705.1|1402385_1403186_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	55.0	9.7e-73
QAT64706.1|1403216_1403396_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64707.1|1403420_1403990_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64708.1|1404160_1404334_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	87.5	8.9e-24
QAT64709.1|1404477_1404660_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64710.1|1404909_1405242_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64711.1|1405234_1405435_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64712.1|1405911_1406130_+	XRE family transcriptional regulator	NA	A0A1Z1DA26	Bacillus_phage	43.8	1.7e-08
QAT64713.1|1406652_1407042_+	hypothetical protein	NA	A0A0N7GFF5	Paenibacillus_phage	42.1	1.4e-19
QAT64714.1|1408778_1409348_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67811.1|1409693_1409975_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64715.1|1409994_1410543_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	44.4	1.0e-28
QAT64716.1|1411129_1412692_+	hypothetical protein	NA	A0A0N9RZA7	Paenibacillus_phage	53.9	2.1e-151
QAT64717.1|1412758_1414243_+|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	22.4	4.5e-15
QAT64718.1|1414336_1415062_+	scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	54.2	3.2e-06
QAT64719.1|1415121_1416246_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
QAT64720.1|1416714_1416906_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64721.1|1416920_1417259_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64722.1|1417255_1418065_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64723.1|1418080_1418470_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64724.1|1418466_1418823_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
QAT64725.1|1418819_1419260_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64726.1|1419277_1419748_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
QAT64727.1|1419701_1419998_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	77.1	1.1e-26
QAT64728.1|1420054_1420420_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64729.1|1420503_1420722_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64730.1|1420737_1423875_+|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	44.3	3.0e-77
QAT64731.1|1423871_1424690_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	53.3	2.1e-75
QAT64732.1|1424701_1426051_+	endopeptidase	NA	A6M966	Geobacillus_virus	36.0	5.0e-53
QAT64733.1|1426066_1428631_+	peptidase G2	NA	D6R401	Bacillus_phage	65.0	0.0e+00
QAT64734.1|1428643_1430011_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	52.2	6.4e-64
QAT64735.1|1430025_1430310_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.7	4.3e-15
QAT64736.1|1430311_1430533_+	XkdX family protein	NA	M4ZS22	Bacillus_phage	68.1	5.0e-11
QAT64737.1|1430536_1430800_+|holin	holin	holin	NA	NA	NA	NA
QAT64738.1|1430865_1431807_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	63.8	1.9e-96
QAT64739.1|1431827_1432058_+|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	57.1	4.8e-17
QAT64740.1|1432174_1432975_+	hypothetical protein	NA	A6M971	Geobacillus_virus	37.8	3.6e-19
QAT64741.1|1433043_1433250_-	XRE family transcriptional regulator	NA	A0A0A0RVA6	Bacillus_phage	40.3	1.2e-06
>prophage 6
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	1458061	1468878	4744953	portal,holin	uncultured_Caudovirales_phage(55.56%)	13	NA	NA
QAT64764.1|1458061_1459483_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.9	2.2e-19
QAT64765.1|1459484_1460066_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
QAT64766.1|1460175_1460589_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64767.1|1460720_1461350_+	hypothetical protein	NA	F8WQ53	Bacillus_phage	48.2	3.2e-47
QAT64768.1|1461352_1462015_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.4e-40
QAT64769.1|1462184_1462538_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.9	1.1e-17
QAT64770.1|1463274_1464114_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	30.3	9.4e-26
QAT64771.1|1464013_1464814_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.3	1.1e-60
QAT64772.1|1465087_1465423_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64773.1|1465413_1465623_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	57.8	3.3e-12
QAT67812.1|1467447_1468278_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
QAT64774.1|1468330_1468600_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	1.8e-23
QAT64775.1|1468614_1468878_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	71.3	1.8e-28
>prophage 7
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	1522152	1575632	4744953	protease,transposase	Bacillus_phage(45.45%)	51	NA	NA
QAT64818.1|1522152_1523583_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.0	5.3e-122
QAT64819.1|1523700_1524150_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QAT64820.1|1524294_1524708_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
QAT64821.1|1524778_1525426_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64822.1|1525443_1525914_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	38.0	7.6e-25
QAT64823.1|1526061_1526694_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
QAT64824.1|1526820_1528179_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	40.3	4.2e-84
QAT64825.1|1528309_1529026_-	hypothetical protein	NA	NA	NA	NA	NA
QAT64826.1|1529026_1529338_-	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
QAT64827.1|1529516_1531805_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
QAT64828.1|1532267_1533221_-|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	49.8	1.5e-75
QAT64829.1|1533450_1533630_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64830.1|1534188_1535544_+	magnesium transporter	NA	NA	NA	NA	NA
QAT64831.1|1535633_1536026_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64832.1|1536057_1536390_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
QAT64833.1|1536580_1536736_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64834.1|1536839_1537010_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
QAT64835.1|1537193_1537655_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QAT64836.1|1537658_1539506_-	DNA ligase D	NA	NA	NA	NA	NA
QAT64837.1|1539509_1540373_-	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	33.2	6.0e-36
QAT64838.1|1540459_1542799_-	GGDEF and EAL domain-containing protein	NA	NA	NA	NA	NA
QAT67816.1|1543013_1543670_+	DedA family protein	NA	NA	NA	NA	NA
QAT64839.1|1543938_1544706_+	hypothetical protein	NA	A0A068EP98	Bacillus_phage	43.1	1.4e-31
QAT64840.1|1546641_1547397_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
QAT64841.1|1547393_1548485_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
QAT64842.1|1548497_1548695_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	58.6	7.5e-11
QAT64843.1|1548824_1549544_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
QAT64844.1|1549685_1550579_+|protease	protease HtpX	protease	NA	NA	NA	NA
QAT64845.1|1550724_1552074_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
QAT64846.1|1552143_1553503_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	72.8	1.1e-108
QAT64847.1|1553626_1555621_+	penicillin-binding transpeptidase domain-containing protein	NA	NA	NA	NA	NA
QAT64848.1|1555833_1556058_+	hypothetical protein	NA	NA	NA	NA	NA
QAT64849.1|1556094_1557111_-	acyltransferase family protein	NA	NA	NA	NA	NA
QAT64850.1|1557380_1559591_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
QAT64851.1|1559595_1560093_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	53.8	7.0e-21
QAT64852.1|1560305_1561376_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
QAT64853.1|1561377_1562577_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
QAT64854.1|1562871_1563651_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
QAT64855.1|1563745_1564936_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
QAT64856.1|1565180_1566398_+	2,3-diketo-5-methylthiopentyl-1-phosphate enolase	NA	NA	NA	NA	NA
QAT64857.1|1566394_1567096_+	2-hydroxy-3-keto-5-methylthiopentenyl-1- phosphate phosphatase	NA	NA	NA	NA	NA
QAT64858.1|1567053_1567680_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
QAT64859.1|1567703_1568243_+	cupin domain-containing protein	NA	NA	NA	NA	NA
QAT64860.1|1568274_1568739_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	55.2	3.7e-32
QAT64861.1|1568728_1569025_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
QAT64862.1|1569239_1569476_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
QAT64863.1|1569556_1571068_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
QAT64864.1|1571304_1571772_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QAT64865.1|1571782_1572565_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
QAT64866.1|1572557_1573352_-	flagellar motor protein MotA	NA	NA	NA	NA	NA
QAT64867.1|1573538_1575632_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.8	2.5e-128
>prophage 8
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	1877239	1938597	4744953	protease,holin,tail,tRNA	Bacillus_phage(66.67%)	49	NA	NA
QAT65152.1|1877239_1878505_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
QAT65153.1|1878551_1880270_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
QAT65154.1|1880355_1884672_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.2	1.1e-24
QAT67830.1|1885045_1887013_+	endoglucanase	NA	NA	NA	NA	NA
QAT65155.1|1887073_1889188_+	glycoside hydrolase	NA	G0YQI6	Erwinia_phage	36.6	1.3e-111
QAT65156.1|1889300_1890956_+	glycoside hydrolase	NA	NA	NA	NA	NA
QAT65157.1|1891035_1892211_+	glycoside hydrolase	NA	NA	NA	NA	NA
QAT65158.1|1892406_1892880_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
QAT65159.1|1892911_1894027_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
QAT65160.1|1894040_1894316_+	YlxR family protein	NA	NA	NA	NA	NA
QAT65161.1|1894316_1894619_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
QAT65162.1|1894638_1896807_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.5	2.3e-23
QAT65163.1|1896803_1897082_+	DUF503 domain-containing protein	NA	NA	NA	NA	NA
QAT65164.1|1897100_1897451_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
QAT65165.1|1897528_1898458_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
QAT65166.1|1898474_1899434_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	29.4	1.1e-06
QAT65167.1|1899632_1899902_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
QAT65168.1|1900101_1902219_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
QAT67831.1|1902437_1903337_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65169.1|1903374_1904604_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.7	1.7e-47
QAT65170.1|1904691_1904949_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
QAT65171.1|1906784_1907669_+	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
QAT65172.1|1908042_1909677_-	recombinase family protein	NA	O64015	Bacillus_phage	51.8	1.9e-155
QAT65173.1|1910077_1912036_+	hypothetical protein	NA	O64023	Bacillus_phage	25.6	1.3e-38
QAT65174.1|1912049_1912472_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
QAT65175.1|1912512_1912977_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
QAT65176.1|1913376_1914468_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
QAT65177.1|1914742_1915270_+	transcriptional repressor Rok	NA	NA	NA	NA	NA
QAT65178.1|1915347_1915701_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65179.1|1915803_1916901_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	27.9	1.9e-39
QAT65180.1|1917543_1917705_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
QAT65181.1|1917829_1918138_-	hypothetical protein	NA	NA	NA	NA	NA
QAT65182.1|1918156_1918438_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	44.1	2.4e-10
QAT65183.1|1918456_1918843_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	72.7	3.1e-40
QAT65184.1|1918974_1920066_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1P8CWN6	Bacillus_phage	69.5	2.6e-113
QAT65185.1|1920402_1922967_-	hypothetical protein	NA	D6R401	Bacillus_phage	40.6	2.2e-158
QAT65186.1|1922985_1923783_-	hypothetical protein	NA	O64043	Bacillus_phage	59.7	5.5e-76
QAT65187.1|1923798_1926438_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	51.3	2.6e-239
QAT65188.1|1926441_1927203_-|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	59.4	2.1e-80
QAT65189.1|1927257_1932495_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	61.6	0.0e+00
QAT65190.1|1933138_1934533_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	57.3	9.9e-105
QAT65191.1|1934622_1934865_-	hypothetical protein	NA	NA	NA	NA	NA
QAT65192.1|1934907_1935603_-	hypothetical protein	NA	A0A290FZK7	Caldibacillus_phage	53.3	5.6e-32
QAT65193.1|1935550_1935802_-	hypothetical protein	NA	NA	NA	NA	NA
QAT65194.1|1936007_1936247_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAT65195.1|1936296_1936548_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65196.1|1936563_1937202_-	hypothetical protein	NA	Q37974	Bacillus_phage	31.6	1.8e-05
QAT65197.1|1937249_1937939_-	immunity protein	NA	Q37974	Bacillus_phage	42.2	7.7e-42
QAT65198.1|1937961_1938597_-	immunity protein	NA	A0A0H3UZD5	Geobacillus_virus	33.2	1.9e-23
>prophage 9
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	1945126	1981716	4744953	integrase	Bacillus_phage(73.33%)	40	1943470:1943484	1949325:1949339
1943470:1943484	attL	GAATTCCAACATTAA	NA	NA	NA	NA
QAT65206.1|1945126_1946206_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	39.1	9.5e-55
QAT65207.1|1946198_1946696_-	hypothetical protein	NA	NA	NA	NA	NA
QAT65208.1|1946839_1947841_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	85.9	1.3e-170
QAT65209.1|1947855_1948275_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	54.9	5.7e-40
QAT67834.1|1948274_1948757_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	34.6	1.3e-16
QAT65210.1|1948795_1948987_-	XkdX family protein	NA	NA	NA	NA	NA
QAT65211.1|1948983_1949301_-	hypothetical protein	NA	NA	NA	NA	NA
QAT65212.1|1949313_1950969_-	DNA-packaging protein	NA	M4ZRP1	Bacillus_phage	60.3	6.0e-16
1949325:1949339	attR	GAATTCCAACATTAA	NA	NA	NA	NA
QAT65213.1|1950971_1951337_-	lysozyme	NA	A0A1P8CWQ8	Bacillus_phage	47.7	1.2e-22
QAT65214.1|1951908_1952715_-	hypothetical protein	NA	A0A0N7GFG4	Staphylococcus_phage	33.2	7.1e-31
QAT65215.1|1952759_1953479_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	42.9	2.1e-50
QAT65216.1|1953475_1954006_-	hypothetical protein	NA	O64060	Bacillus_phage	62.5	5.0e-57
QAT65217.1|1954002_1954662_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	68.1	1.2e-79
QAT65218.1|1954648_1954891_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	49.4	1.0e-09
QAT65219.1|1954887_1955286_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	63.6	3.4e-42
QAT65220.1|1955297_1955768_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	80.1	8.5e-69
QAT65221.1|1955802_1956819_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	84.6	9.2e-161
QAT65222.1|1956863_1957466_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	84.1	2.0e-78
QAT65223.1|1957491_1958931_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	65.9	5.0e-176
QAT65224.1|1958964_1960485_-	hypothetical protein	NA	O64068	Bacillus_phage	82.0	1.4e-245
QAT65225.1|1960502_1962272_-	hypothetical protein	NA	O64069	Bacillus_phage	91.7	0.0e+00
QAT65226.1|1962255_1963188_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	76.3	8.3e-140
QAT65227.1|1963468_1964659_-	metallophosphatase family protein	NA	A0A0N9SK37	Staphylococcus_phage	38.0	7.0e-67
QAT65228.1|1964671_1964863_-	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	88.9	8.9e-25
QAT65229.1|1965507_1966023_-	hypothetical protein	NA	L0L915	Bacillus_phage	49.7	1.9e-37
QAT65230.1|1966088_1966319_-	hypothetical protein	NA	NA	NA	NA	NA
QAT65231.1|1967263_1967539_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	75.6	3.5e-30
QAT65232.1|1967644_1968445_-	hypothetical protein	NA	NA	NA	NA	NA
QAT65233.1|1968441_1971216_-	hypothetical protein	NA	H7BV05	unidentified_phage	29.4	2.3e-105
QAT65234.1|1971246_1971699_-	hypothetical protein	NA	NA	NA	NA	NA
QAT65235.1|1972319_1972733_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
QAT65236.1|1972747_1973443_-	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
QAT65237.1|1973552_1974554_+	hypothetical protein	NA	A0A2K9L199	Tupanvirus	30.7	1.5e-22
QAT65238.1|1975316_1975754_-	hypothetical protein	NA	M1HMZ7	Bacillus_phage	30.8	1.9e-09
QAT65239.1|1975992_1976274_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65240.1|1976886_1977066_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65241.1|1977138_1977327_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	46.3	2.6e-05
QAT65242.1|1977378_1978254_+	hypothetical protein	NA	D2XPY2	Bacillus_virus	36.9	4.9e-09
QAT65243.1|1978240_1979473_+	hypothetical protein	NA	O64082	Bacillus_phage	81.2	5.9e-194
QAT65244.1|1979784_1981716_+	hypothetical protein	NA	A0A0H3UZM4	Geobacillus_virus	35.1	5.8e-63
>prophage 10
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	1997642	2009503	4744953	integrase	Bacillus_phage(76.92%)	21	1990620:1990635	2001462:2001477
1990620:1990635	attL	TTAAACAAATTAAAAA	NA	NA	NA	NA
QAT65270.1|1997642_1999019_+	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	32.9	6.8e-58
QAT65271.1|1999036_2000041_+|integrase	site-specific integrase	integrase	O64101	Bacillus_phage	39.1	1.3e-58
QAT65272.1|2000428_2000701_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65273.1|2000714_2000909_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67835.1|2001057_2001255_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65274.1|2001490_2002228_+	hypothetical protein	NA	A0A0A8WIT2	Clostridium_phage	57.1	3.0e-68
2001462:2001477	attR	TTAAACAAATTAAAAA	NA	NA	NA	NA
QAT65275.1|2002224_2002572_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65276.1|2002599_2002848_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65277.1|2002876_2003164_+	hypothetical protein	NA	A0A0E3DEX0	Bacillus_phage	51.6	9.3e-18
QAT65278.1|2003362_2003611_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65279.1|2003646_2003937_+	hypothetical protein	NA	A0A127AWI5	Bacillus_phage	46.7	1.7e-14
QAT67836.1|2004105_2004324_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65280.1|2004584_2004785_+	hypothetical protein	NA	F8WPL5	Bacillus_phage	60.6	1.8e-15
QAT65281.1|2005214_2005742_+	hypothetical protein	NA	U5PUK4	Bacillus_phage	58.1	4.0e-51
QAT65282.1|2006055_2006304_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65283.1|2006313_2007126_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	75.8	3.5e-118
QAT65284.1|2007218_2007443_+	hypothetical protein	NA	O64132	Bacillus_phage	66.2	4.9e-22
QAT65285.1|2007619_2008291_+	hypothetical protein	NA	A0A2H4JB05	uncultured_Caudovirales_phage	42.7	7.5e-42
QAT65286.1|2008321_2008699_+	hypothetical protein	NA	A8ASN9	Listeria_phage	39.5	6.7e-16
QAT65287.1|2008847_2009294_+	hypothetical protein	NA	A0A1B1P7V7	Bacillus_phage	36.4	4.0e-07
QAT65288.1|2009290_2009503_+	hypothetical protein	NA	F8WPM3	Bacillus_phage	51.6	1.4e-07
>prophage 11
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	2013723	2023548	4744953		Bacillus_phage(100.0%)	9	NA	NA
QAT65295.1|2013723_2014056_+	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	49.5	9.1e-17
QAT65296.1|2014286_2015198_+	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	67.0	1.1e-112
QAT65297.1|2015252_2016224_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	85.4	2.0e-157
QAT65298.1|2016265_2016736_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	67.3	8.3e-56
QAT65299.1|2016750_2018265_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	81.2	2.0e-236
QAT65300.1|2018281_2019415_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	71.0	2.1e-161
QAT65301.1|2019418_2021140_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	66.1	8.7e-220
QAT65302.1|2021155_2022565_+	PHP domain-containing protein	NA	A0A1P8CX14	Bacillus_phage	85.8	4.0e-239
QAT65303.1|2022615_2023548_+	helix-turn-helix domain-containing protein	NA	A7KV45	Bacillus_phage	36.4	4.8e-31
>prophage 12
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	2031682	2049088	4744953	tRNA	Bacillus_phage(82.35%)	25	NA	NA
QAT67838.1|2031682_2032027_+	antitoxin endoai	NA	O64171	Bacillus_phage	42.5	7.5e-14
QAT65310.1|2032026_2032431_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	62.8	4.6e-39
QAT67839.1|2032435_2035645_+	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	85.4	0.0e+00
QAT65311.1|2035667_2035889_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	68.5	3.3e-23
QAT65312.1|2035889_2036870_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	82.2	2.3e-148
QAT65313.1|2037119_2037476_+|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	30.6	6.4e-08
QAT65314.1|2037523_2037823_+	hypothetical protein	NA	A0A0A0RSF8	Bacillus_phage	38.0	3.9e-11
QAT65315.1|2037841_2038276_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65316.1|2038319_2038754_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	88.7	5.5e-70
QAT65317.1|2039072_2039261_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65318.1|2039253_2039562_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	52.1	2.6e-10
QAT65319.1|2039551_2040109_+	hypothetical protein	NA	G3MBK8	Bacillus_virus	53.1	3.1e-49
QAT65320.1|2040110_2041208_+	hypothetical protein	NA	G3MBL0	Bacillus_virus	51.8	4.0e-109
QAT65321.1|2041220_2042060_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	42.0	1.4e-53
QAT65322.1|2042248_2042614_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	45.3	1.2e-17
QAT65323.1|2042933_2043332_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65324.1|2043858_2044107_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65325.1|2044129_2044474_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65326.1|2044642_2044987_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65327.1|2044987_2045995_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	38.2	4.1e-44
QAT65328.1|2046324_2046525_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	82.5	3.7e-21
QAT65329.1|2046613_2047129_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65330.1|2047157_2047985_+	metallophosphoesterase	NA	O64184	Bacillus_phage	84.7	1.6e-147
QAT65331.1|2048000_2048357_+	hypothetical protein	NA	NA	NA	NA	NA
QAT65332.1|2048638_2049088_+	NADAR family protein	NA	A0A172JI41	Bacillus_phage	64.7	4.4e-46
>prophage 13
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	2650586	2662845	4744953	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
QAT65870.1|2650586_2651051_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	71.1	1.0e-45
QAT65871.1|2651085_2652282_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.2	9.6e-117
QAT65872.1|2652301_2652949_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.2	3.7e-38
QAT65873.1|2652960_2654049_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.9	3.0e-56
QAT65874.1|2654417_2654762_-	hypothetical protein	NA	NA	NA	NA	NA
QAT65875.1|2655358_2655655_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAT65876.1|2655663_2656044_+	hypothetical protein	NA	A0A0N9S8A3	Staphylococcus_phage	31.6	5.4e-05
QAT65877.1|2656025_2656544_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	50.0	5.4e-40
QAT65878.1|2656600_2657038_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
QAT65879.1|2657169_2657418_-	hypothetical protein	NA	NA	NA	NA	NA
QAT65880.1|2657407_2658538_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	46.3	3.6e-89
QAT67884.1|2658774_2659212_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	45.5	2.4e-17
QAT65881.1|2659492_2660389_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
QAT65882.1|2660443_2661247_-	replication protein	NA	O64134	Bacillus_phage	51.1	6.4e-56
QAT65883.1|2661414_2662845_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.1	3.7e-30
>prophage 14
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	3184470	3270111	4744953	protease,holin,head,coat,portal,tail,capsid,tRNA,terminase	uncultured_Caudovirales_phage(35.0%)	95	NA	NA
QAT66328.1|3184470_3187113_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	9.8e-162
QAT66329.1|3187573_3187765_+	hypothetical protein	NA	NA	NA	NA	NA
QAT66330.1|3187801_3188824_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
QAT66331.1|3188840_3190346_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
QAT66332.1|3190469_3191765_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	NA	NA	NA	NA
QAT66333.1|3191791_3192766_-	porphobilinogen synthase	NA	NA	NA	NA	NA
QAT66334.1|3192769_3193558_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
QAT66335.1|3193547_3194489_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
QAT66336.1|3194524_3195355_-	cytochrome C assembly protein	NA	NA	NA	NA	NA
QAT66337.1|3195359_3196721_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
QAT66338.1|3196906_3197392_+	hypothetical protein	NA	NA	NA	NA	NA
QAT66339.1|3197439_3198027_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
QAT66340.1|3198023_3200348_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	6.5e-186
QAT66341.1|3200551_3202207_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	36.6	8.3e-18
QAT66342.1|3202333_3203599_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.8	1.9e-147
QAT66343.1|3203869_3205144_-	trigger factor	NA	NA	NA	NA	NA
QAT66344.1|3205373_3206381_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
QAT66345.1|3206504_3207104_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
QAT66346.1|3207116_3208535_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
QAT66347.1|3208568_3209681_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
QAT66348.1|3209708_3211265_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.5	3.0e-09
QAT66349.1|3211251_3212280_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
QAT66350.1|3212311_3212830_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
QAT66351.1|3212826_3214551_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.2	5.2e-63
QAT66352.1|3214957_3215872_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
QAT66353.1|3216329_3216617_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67920.1|3216636_3217986_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
QAT66354.1|3218784_3219180_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67921.1|3219816_3220278_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
QAT66355.1|3222772_3223285_-	metallophosphoesterase	NA	NA	NA	NA	NA
QAT66356.1|3223305_3223890_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.6	5.4e-12
QAT66357.1|3223915_3224659_-	ribonuclease PH	NA	NA	NA	NA	NA
QAT66358.1|3224781_3225891_-	sporulation protein	NA	NA	NA	NA	NA
QAT66359.1|3226050_3226875_-	glutamate racemase	NA	NA	NA	NA	NA
QAT66360.1|3226882_3227326_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
QAT67922.1|3227488_3227563_-	DNA-binding response regulator	NA	NA	NA	NA	NA
QAT66361.1|3227609_3229133_-	recombinase family protein	NA	A0A290FZV2	Caldibacillus_phage	52.9	7.1e-149
QAT67923.1|3229314_3229635_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.0	2.7e-10
QAT66362.1|3229658_3230120_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67924.1|3230126_3230534_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	45.6	6.1e-23
QAT66363.1|3231081_3231312_+	hypothetical protein	NA	NA	NA	NA	NA
QAT66364.1|3231336_3231918_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66365.1|3232082_3233165_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	54.1	2.1e-46
QAT66366.1|3233216_3233480_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	72.4	5.1e-31
QAT66367.1|3233495_3233765_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	1.6e-24
QAT66368.1|3233850_3234117_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66369.1|3234131_3234320_-	XkdX family protein	NA	NA	NA	NA	NA
QAT66370.1|3234446_3234833_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66371.1|3234853_3238249_-	hypothetical protein	NA	Q5YA57	Bacillus_phage	44.9	1.8e-131
QAT66372.1|3238261_3239026_-|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	26.7	1.8e-07
QAT66373.1|3239022_3243903_-	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	26.3	9.3e-33
QAT66374.1|3243918_3244215_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66375.1|3244262_3244775_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66376.1|3244858_3245185_-	fibronectin type III domain-containing protein	NA	R4JF61	Bacillus_phage	67.5	1.5e-24
QAT67925.1|3245114_3245633_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
QAT66377.1|3245646_3246045_-	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	45.4	6.4e-25
QAT66378.1|3246060_3246480_-	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	59.1	9.4e-35
QAT67926.1|3246472_3246817_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
QAT66379.1|3246816_3247125_-	hypothetical protein	NA	A0A1W6JQJ1	Staphylococcus_phage	40.2	5.7e-13
QAT66380.1|3247137_3247410_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66381.1|3247411_3247750_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66382.1|3247753_3248674_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	64.0	9.1e-107
QAT66383.1|3248689_3249271_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	56.0	2.2e-50
QAT66384.1|3249668_3249992_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66385.1|3250141_3251065_-|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	51.5	3.0e-81
QAT66386.1|3251051_3252446_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.7	6.5e-149
QAT66387.1|3252442_3253720_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	70.0	1.2e-154
QAT66388.1|3253716_3254466_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	53.8	4.0e-60
QAT66389.1|3254870_3255326_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	78.1	3.4e-62
QAT66390.1|3255865_3256105_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66391.1|3256104_3256368_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66392.1|3256424_3256631_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66393.1|3256632_3256965_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66394.1|3257131_3257401_-	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	39.1	1.9e-09
QAT66395.1|3257416_3257689_-	DUF5052 family protein	NA	F8WQ63	Bacillus_phage	70.3	8.5e-29
QAT66396.1|3257934_3258186_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66397.1|3258182_3258500_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66398.1|3258496_3258898_-	hypothetical protein	NA	S5MUL4	Brevibacillus_phage	47.1	4.0e-27
QAT66399.1|3258894_3259341_-	hypothetical protein	NA	A0A1B1P7V7	Bacillus_phage	37.4	8.0e-08
QAT66400.1|3259375_3259582_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	60.0	5.3e-15
QAT66401.1|3259941_3260400_-	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	70.0	7.8e-51
QAT66402.1|3260649_3261558_-	ATP-binding protein IstB	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	70.6	5.1e-102
QAT66403.1|3262560_3263412_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	78.9	2.3e-120
QAT66404.1|3263413_3264364_-	hypothetical protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	76.5	6.0e-138
QAT66405.1|3264363_3264552_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66406.1|3264544_3264739_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67927.1|3265281_3265539_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66407.1|3265540_3266104_-	helix-turn-helix domain-containing protein	NA	A0A2H4J884	uncultured_Caudovirales_phage	54.0	8.7e-60
QAT66408.1|3266170_3266860_-	phage antirepressor	NA	A0A1B1IMQ3	Lactococcus_phage	45.8	1.9e-32
QAT66409.1|3267176_3267488_+	hypothetical protein	NA	NA	NA	NA	NA
QAT66410.1|3267635_3267872_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAT66411.1|3268006_3268375_+	XRE family transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	35.6	1.3e-11
QAT66412.1|3268638_3268920_+	hypothetical protein	NA	NA	NA	NA	NA
QAT66413.1|3269013_3269535_+	hypothetical protein	NA	NA	NA	NA	NA
QAT66414.1|3269634_3270111_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	40.9	3.9e-29
>prophage 15
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	3397512	3410930	4744953	holin,tail,transposase	Bacillus_phage(81.82%)	13	NA	NA
QAT67932.1|3397512_3397836_+	YolD-like family protein	NA	O64030	Bacillus_phage	29.4	1.7e-07
QAT66522.1|3398249_3398960_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
QAT67933.1|3399164_3400016_+	DUF2202 domain-containing protein	NA	NA	NA	NA	NA
QAT66523.1|3400169_3400763_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	67.6	6.4e-53
QAT66524.1|3400883_3401825_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	42.3	6.5e-60
QAT66525.1|3401872_3402283_-|holin	holin	holin	A0A0N7GFE6	Paenibacillus_phage	50.8	1.1e-24
QAT66526.1|3402356_3403717_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	72.8	1.1e-108
QAT66527.1|3403749_3403947_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	45.8	7.3e-06
QAT66528.1|3403943_3404246_-	hypothetical protein	NA	O64053	Bacillus_phage	33.9	7.8e-07
QAT66529.1|3404260_3405757_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	64.6	1.5e-63
QAT66530.1|3405769_3408334_-	peptidase G2	NA	D6R401	Bacillus_phage	61.0	7.1e-311
QAT66531.1|3408368_3410081_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	67.7	1.3e-223
QAT66532.1|3410093_3410930_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	67.9	2.2e-107
>prophage 16
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	3691137	3778741	4744953	protease,holin,head,coat,integrase,portal,tail,capsid,plate,transposase,terminase	Bacillus_phage(60.0%)	99	3726978:3726994	3778295:3778311
QAT66769.1|3691137_3692145_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
QAT67954.1|3692280_3692781_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	51.3	1.7e-38
QAT66770.1|3692833_3693604_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
QAT66771.1|3693622_3694063_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
QAT66772.1|3694087_3694363_-	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
QAT66773.1|3694466_3695066_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67955.1|3695117_3696014_-	lipoyl synthase	NA	NA	NA	NA	NA
QAT66774.1|3696270_3697254_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	34.3	2.5e-06
QAT66775.1|3697281_3698043_-	sporulation protein YunB	NA	NA	NA	NA	NA
QAT66776.1|3698113_3698419_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
QAT66777.1|3698495_3699866_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
QAT66778.1|3699890_3700709_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
QAT66779.1|3700727_3701579_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
QAT66780.1|3701702_3702236_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66781.1|3702326_3702914_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
QAT66782.1|3704317_3705571_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
QAT66783.1|3705585_3706836_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
QAT66784.1|3707014_3708583_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
QAT66785.1|3708706_3710046_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	72.8	1.1e-108
QAT66786.1|3710113_3711310_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
QAT66787.1|3711998_3713399_-	YfcC family protein	NA	NA	NA	NA	NA
QAT66788.1|3713630_3713831_+	hypothetical protein	NA	NA	NA	NA	NA
QAT66789.1|3713934_3714750_+	ribonuclease	NA	NA	NA	NA	NA
QAT66790.1|3714798_3715890_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	47.1	1.9e-18
QAT66791.1|3716000_3716729_+	transcriptional regulator PhoB	NA	NA	NA	NA	NA
QAT66792.1|3716719_3717556_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
QAT66793.1|3717563_3718463_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
QAT66794.1|3718466_3719345_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
QAT66795.1|3719359_3720622_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
QAT66796.1|3720716_3721715_-	SIS domain-containing protein	NA	A0A2K9V905	Bandra_megavirus	22.4	4.3e-09
QAT66797.1|3721848_3722322_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.0	1.1e-18
QAT66798.1|3722299_3723157_-	xanthine dehydrogenase	NA	NA	NA	NA	NA
QAT66799.1|3725466_3726117_-	xanthine dehydrogenase	NA	NA	NA	NA	NA
QAT67956.1|3726113_3727103_-	XdhC/CoxI family protein	NA	NA	NA	NA	NA
3726978:3726994	attL	GGTGCCGTCTTCCTGAA	NA	NA	NA	NA
QAT66800.1|3727240_3728359_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
QAT66801.1|3730005_3730320_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAT66802.1|3730839_3731523_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67957.1|3731676_3731997_+	YolD-like family protein	NA	O64030	Bacillus_phage	33.0	4.7e-10
QAT66803.1|3732119_3732428_-	DUF4325 domain-containing protein	NA	J7KJ12	Streptococcus_phage	45.0	2.8e-12
QAT66804.1|3732415_3733327_-	ATP-binding protein	NA	J7KDG8	Streptococcus_phage	33.8	2.6e-37
QAT66805.1|3733427_3733673_-	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	56.2	9.4e-19
QAT66806.1|3734237_3735764_+|transposase	transposase	transposase	NA	NA	NA	NA
QAT66807.1|3735781_3736120_+	hypothetical protein	NA	NA	NA	NA	NA
QAT66808.1|3736183_3737266_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	53.6	6.2e-46
QAT66809.1|3737317_3737581_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	72.4	1.3e-29
QAT66810.1|3737596_3737866_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	1.6e-24
QAT66811.1|3737927_3738110_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	52.1	2.7e-07
QAT66812.1|3738106_3738409_-	hypothetical protein	NA	O64053	Bacillus_phage	35.7	1.2e-07
QAT66813.1|3738423_3739764_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	51.4	3.3e-65
QAT66814.1|3739776_3742341_-	peptidase G2	NA	D6R401	Bacillus_phage	60.0	3.9e-309
QAT66815.1|3742375_3744088_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	67.7	4.5e-224
QAT66816.1|3744100_3744937_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.2	2.2e-107
QAT66817.1|3744936_3749403_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.2e-71
QAT66818.1|3749612_3749978_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66819.1|3750034_3750652_-|tail	phage tail protein	tail	NA	NA	NA	NA
QAT66820.1|3750666_3751050_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66821.1|3751046_3751445_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66822.1|3751444_3751753_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	38.6	1.1e-11
QAT66823.1|3751742_3752045_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.1	8.0e-12
QAT66824.1|3752065_3752494_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	56.6	1.4e-14
QAT66825.1|3752519_3753803_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	45.2	1.8e-81
QAT66826.1|3753841_3754573_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	56.4	3.1e-57
QAT66827.1|3754517_3755828_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.4	2.7e-104
QAT66828.1|3755828_3756020_-	DUF1056 family protein	NA	NA	NA	NA	NA
QAT66829.1|3756031_3757741_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	63.8	7.4e-211
QAT66830.1|3757737_3758253_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.5	7.0e-32
QAT66831.1|3758481_3758856_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	1.2e-28
QAT66832.1|3758882_3759200_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66833.1|3759393_3759702_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66834.1|3759688_3759925_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66835.1|3760103_3760658_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66836.1|3760676_3761615_-	hypothetical protein	NA	A0A1L2JY39	Aeribacillus_phage	28.9	2.7e-21
QAT66837.1|3761818_3762001_+	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	90.0	1.7e-25
QAT66838.1|3762057_3762474_+	type II toxin-antitoxin system HicB family antitoxin	NA	D6R430	Bacillus_phage	86.9	1.6e-66
QAT66839.1|3762855_3763236_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	83.7	3.0e-48
QAT66840.1|3763382_3763664_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66841.1|3763703_3763952_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66842.1|3763899_3764214_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66843.1|3764210_3764765_-	hypothetical protein	NA	Q5YA89	Bacillus_phage	43.1	1.2e-21
QAT66844.1|3764761_3765277_-	hypothetical protein	NA	D6R425	Bacillus_phage	84.2	1.8e-83
QAT66845.1|3765279_3765450_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	3.0e-08
QAT66846.1|3765446_3765986_-	nuclease	NA	Q9ZXC2	Bacillus_phage	89.4	2.5e-88
QAT66847.1|3765982_3766420_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	78.6	1.5e-64
QAT66848.1|3766663_3769090_-	DNA primase	NA	D6R422	Bacillus_phage	85.6	0.0e+00
QAT66849.1|3769150_3769588_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	93.1	2.0e-75
QAT66850.1|3769587_3770520_-	hypothetical protein	NA	Q9ZXC7	Bacillus_phage	89.8	1.2e-154
QAT66851.1|3770523_3771081_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.9	1.1e-70
QAT66852.1|3771146_3771416_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66853.1|3771509_3771779_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	56.3	1.8e-23
QAT66854.1|3771833_3772148_+	hypothetical protein	NA	NA	NA	NA	NA
QAT66855.1|3772219_3772465_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66856.1|3772807_3773077_-	group-specific protein	NA	A0A0S2SXU9	Bacillus_phage	56.3	1.4e-23
QAT67958.1|3773082_3773268_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	70.5	4.0e-14
QAT66857.1|3773542_3773971_+	XRE family transcriptional regulator	NA	Q5YAA4	Bacillus_phage	59.6	1.5e-40
QAT66858.1|3773981_3774440_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	63.0	1.5e-46
QAT66859.1|3774446_3775604_+|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	69.9	7.8e-156
QAT66860.1|3775669_3777067_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
QAT66861.1|3777084_3777531_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2P1CJL8	Mycobacterium_phage	37.0	2.6e-14
QAT66862.1|3777520_3778741_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	47.1	1.2e-117
3778295:3778311	attR	GGTGCCGTCTTCCTGAA	NA	NA	NA	NA
>prophage 17
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	3910743	3960847	4744953	protease,holin,head,integrase,transposase,portal,tail,capsid,terminase	Bacillus_phage(38.46%)	63	3908675:3908694	3945668:3945687
3908675:3908694	attL	GTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
QAT66974.1|3910743_3911823_-	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	49.8	2.1e-46
QAT66975.1|3911874_3912138_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	3.0e-31
QAT66976.1|3912153_3912423_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	60.7	1.7e-21
QAT67967.1|3912497_3914108_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	58.2	2.5e-59
QAT66977.1|3914123_3916691_-	peptidase G2	NA	D6R401	Bacillus_phage	58.9	5.4e-298
QAT66978.1|3916709_3918596_-	autolysin	NA	D6R400	Bacillus_phage	30.6	2.7e-65
QAT66979.1|3918610_3919438_-|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	37.5	1.5e-39
QAT66980.1|3919434_3923754_-|tail	phage tail tape measure protein	tail	A0A1L2JY60	Aeribacillus_phage	44.1	1.1e-66
QAT66981.1|3923957_3924320_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66982.1|3924319_3924952_-	hypothetical protein	NA	A0A2H4J8F3	uncultured_Caudovirales_phage	33.2	7.6e-20
QAT66983.1|3924951_3925332_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
QAT66984.1|3925328_3925742_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66985.1|3925719_3926082_-|head,tail	head-tail adaptor protein	head,tail	A0A1W6JP44	Morganella_phage	34.7	4.6e-06
QAT67968.1|3926038_3926320_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	46.0	3.8e-16
QAT66986.1|3926306_3927608_-|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	54.2	7.1e-89
QAT66987.1|3927604_3928195_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	56.4	2.4e-52
QAT66988.1|3928187_3929366_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	53.4	2.3e-107
QAT67969.1|3929378_3931085_-|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	56.7	1.6e-189
QAT67970.1|3931129_3931534_-|terminase	terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	44.9	9.4e-24
QAT66989.1|3931611_3931983_-	HNH endonuclease	NA	NA	NA	NA	NA
QAT66990.1|3931979_3932189_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66991.1|3932494_3933124_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66992.1|3933111_3933357_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66993.1|3933359_3933584_-	hypothetical protein	NA	NA	NA	NA	NA
QAT66994.1|3933945_3934128_+	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	90.0	1.7e-25
QAT66995.1|3934176_3934593_+	type II toxin-antitoxin system HicB family antitoxin	NA	D6R430	Bacillus_phage	88.3	3.8e-68
QAT66996.1|3935097_3935640_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	61.1	2.5e-56
QAT66997.1|3935639_3936080_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	50.4	1.5e-35
QAT66998.1|3936506_3937316_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	59.1	1.2e-89
QAT66999.1|3937389_3937641_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67000.1|3937637_3937871_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67001.1|3937905_3938112_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	47.6	1.4e-07
QAT67002.1|3938184_3938334_-	BH0509 family protein	NA	NA	NA	NA	NA
QAT67003.1|3938438_3938987_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67004.1|3939310_3940144_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	37.4	6.4e-35
QAT67005.1|3940127_3940985_-	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	52.3	7.8e-60
QAT67006.1|3940977_3941208_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67007.1|3941260_3941659_+	hypothetical protein	NA	R9VW35	Paenibacillus_phage	34.6	7.4e-05
QAT67008.1|3941645_3941921_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67009.1|3941922_3942168_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67010.1|3942238_3943009_-	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	73.5	4.9e-106
QAT67011.1|3943005_3943212_-	XRE family transcriptional regulator	NA	A0A1B2APY7	Phage_Wrath	56.7	2.1e-11
QAT67012.1|3943248_3943449_-	XRE family transcriptional regulator	NA	A0A2P1JU05	Anoxybacillus_phage	55.7	1.4e-12
QAT67013.1|3943599_3944016_+	XRE family transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	55.5	4.5e-29
QAT67014.1|3944038_3944482_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	62.8	4.2e-49
QAT67015.1|3944530_3945595_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	64.3	2.0e-134
QAT67016.1|3946140_3946614_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	62.5	3.5e-46
3945668:3945687	attR	GTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
QAT67017.1|3946726_3949030_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.4	4.5e-94
QAT67018.1|3949043_3949790_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
QAT67019.1|3949907_3950138_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
QAT67020.1|3950297_3950582_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	50.0	3.2e-10
QAT67971.1|3950610_3950796_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAT67021.1|3950996_3951401_+	transcriptional regulator	NA	S6C481	Thermus_phage	65.3	7.7e-18
QAT67022.1|3951551_3951956_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	60.3	4.7e-15
QAT67972.1|3952002_3952680_-	ABC transporter permease	NA	NA	NA	NA	NA
QAT67023.1|3952700_3953618_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAT67024.1|3953631_3954285_-	ABC transporter permease	NA	NA	NA	NA	NA
QAT67025.1|3954297_3955440_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	31.1	2.3e-14
QAT67026.1|3955699_3956236_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
QAT67027.1|3956286_3957647_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	72.8	1.1e-108
QAT67028.1|3957720_3958353_-	NAAT family transporter	NA	NA	NA	NA	NA
QAT67029.1|3958501_3959281_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
QAT67030.1|3959416_3960847_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.0	5.3e-122
>prophage 18
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	3980221	4052449	4744953	holin,integrase,portal,tail,capsid,plate,transposase	Bacillus_phage(28.12%)	71	3999147:3999162	4057031:4057046
QAT67046.1|3980221_3981581_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	72.8	1.1e-108
QAT67047.1|3981657_3981975_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67048.1|3982038_3982965_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.7e-28
QAT67049.1|3982964_3983654_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67050.1|3983813_3984638_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
QAT67051.1|3984634_3986392_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
QAT67052.1|3986435_3987158_-	lactate utilization protein C	NA	NA	NA	NA	NA
QAT67053.1|3987154_3988582_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
QAT67054.1|3988621_3989338_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
QAT67975.1|3989497_3990196_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
QAT67055.1|3990439_3992128_+	L-lactate permease	NA	NA	NA	NA	NA
QAT67056.1|3992158_3993472_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
QAT67057.1|3993544_3993757_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67058.1|3993778_3994744_-	pyruvyl transferase	NA	NA	NA	NA	NA
QAT67059.1|3994755_3995901_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2D2W2B8	Stenotrophomonas_phage	25.6	5.4e-08
QAT67976.1|3995923_3996550_-	acetyltransferase	NA	NA	NA	NA	NA
QAT67060.1|3996549_3997152_-	sugar transferase	NA	NA	NA	NA	NA
QAT67061.1|3997171_3998719_-	MATE family efflux transporter	NA	NA	NA	NA	NA
QAT67062.1|3998724_3999744_-	glycosyltransferase	NA	NA	NA	NA	NA
3999147:3999162	attL	GCTTTGCGGCGTAAAA	NA	NA	NA	NA
QAT67063.1|3999740_4000820_-	pyruvyl transferase	NA	NA	NA	NA	NA
QAT67064.1|4000831_4001863_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	38.0	1.4e-10
QAT67065.1|4001932_4003036_-	EpsG family protein	NA	NA	NA	NA	NA
QAT67066.1|4003038_4004199_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
QAT67067.1|4004191_4005034_-	glycosyltransferase	NA	NA	NA	NA	NA
QAT67068.1|4005030_4006179_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
QAT67069.1|4006190_4008008_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	31.0	3.4e-28
QAT67070.1|4008264_4008957_-	tyrosine-protein kinase family protein	NA	A0A1X9I5D6	Streptococcus_phage	33.2	2.3e-22
QAT67071.1|4008937_4009690_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67072.1|4009926_4010385_+	helix-turn-helix domain-containing protein	NA	A0A0K2CP57	Brevibacillus_phage	47.2	5.0e-05
QAT67073.1|4010779_4011304_+	general stress protein	NA	NA	NA	NA	NA
QAT67074.1|4011343_4012627_-	MFS transporter	NA	NA	NA	NA	NA
QAT67075.1|4012696_4013647_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.0	3.9e-36
QAT67076.1|4013674_4014673_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
QAT67077.1|4014676_4015948_-	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
QAT67078.1|4015960_4017127_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
QAT67079.1|4017140_4018028_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
QAT67977.1|4018269_4019628_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	40.3	4.2e-84
QAT67080.1|4019756_4021475_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
QAT67081.1|4021574_4021898_-	transcriptional regulator	NA	NA	NA	NA	NA
QAT67082.1|4023609_4025061_+	glycoside hydrolase family 68 protein	NA	NA	NA	NA	NA
QAT67083.1|4025141_4026677_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	42.7	2.4e-96
QAT67084.1|4026874_4027306_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
QAT67085.1|4027594_4028413_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAT67086.1|4028552_4028759_+	XRE family transcriptional regulator	NA	A0A0A0RVA6	Bacillus_phage	38.1	1.1e-07
QAT67087.1|4028814_4029117_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67088.1|4029312_4029912_-	N-acetyltransferase	NA	NA	NA	NA	NA
QAT67089.1|4030359_4030590_-|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	57.1	4.8e-17
QAT67090.1|4030610_4031552_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	62.9	4.8e-95
QAT67091.1|4031617_4031881_-|holin	holin	holin	NA	NA	NA	NA
QAT67092.1|4031884_4032106_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	68.1	5.0e-11
QAT67093.1|4032107_4032392_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.7	4.3e-15
QAT67094.1|4032406_4033774_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	52.2	1.1e-63
QAT67095.1|4033786_4036351_-	peptidase G2	NA	D6R401	Bacillus_phage	65.1	0.0e+00
QAT67096.1|4036366_4037743_-	endopeptidase	NA	A6M966	Geobacillus_virus	35.5	1.4e-42
QAT67978.1|4037752_4038529_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	45.6	1.3e-58
QAT67979.1|4038612_4041357_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	35.2	3.8e-68
QAT67097.1|4041783_4042152_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67098.1|4042203_4042767_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	60.1	4.6e-53
QAT67099.1|4042804_4043179_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67100.1|4043182_4043593_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	49.3	4.1e-27
QAT67101.1|4043589_4043928_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	48.2	2.4e-20
QAT67102.1|4043928_4044315_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	47.2	1.3e-25
QAT67103.1|4044329_4044542_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67104.1|4044596_4045688_-	hypothetical protein	NA	A0A2H4J2M3	uncultured_Caudovirales_phage	66.9	4.8e-131
QAT67105.1|4045742_4046474_-	OmpH family outer membrane protein	NA	A0A2H4IZP8	uncultured_Caudovirales_phage	39.1	2.0e-24
QAT67106.1|4046584_4047139_-	hypothetical protein	NA	S5MA16	Bacillus_phage	40.3	7.8e-13
QAT67107.1|4047135_4047963_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	55.3	5.9e-81
QAT67108.1|4047959_4049597_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	57.2	3.1e-166
QAT67109.1|4049599_4050028_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	56.4	1.9e-22
QAT67110.1|4050044_4051799_-	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	72.6	9.4e-254
QAT67111.1|4051903_4052449_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	44.7	5.3e-30
4057031:4057046	attR	TTTTACGCCGCAAAGC	NA	NA	NA	NA
>prophage 19
CP035232	Bacillus glycinifermentans strain SRCM103574 chromosome, complete genome	4744953	4057452	4089801	4744953		Bacillus_phage(42.86%)	45	NA	NA
QAT67117.1|4057452_4057626_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	83.6	2.9e-22
QAT67118.1|4057661_4058006_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
QAT67119.1|4058056_4059484_+	lipase	NA	NA	NA	NA	NA
QAT67120.1|4059495_4059807_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67121.1|4059839_4060640_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	53.5	7.7e-70
QAT67122.1|4060727_4061216_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	35.8	3.4e-12
QAT67123.1|4061208_4061598_-	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	44.3	6.7e-19
QAT67124.1|4061716_4062103_+	hypothetical protein	NA	NA	NA	NA	NA
QAT67125.1|4062091_4062655_-	dephospho-CoA kinase	NA	A0A0N9SJZ0	Paenibacillus_phage	47.8	3.6e-37
QAT67126.1|4062651_4063656_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	39.4	7.0e-20
QAT67127.1|4063672_4064128_-	methyltransferase domain-containing protein	NA	A8ATY8	Listeria_phage	75.3	1.9e-65
QAT67128.1|4064144_4064330_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67980.1|4064326_4064872_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	62.4	3.2e-27
QAT67981.1|4065016_4065778_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	69.1	1.3e-87
QAT67129.1|4065793_4066300_-	Fis family transcriptional regulator	NA	A0A2H4J152	uncultured_Caudovirales_phage	48.7	3.7e-25
QAT67130.1|4066274_4066784_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.0	1.3e-41
QAT67982.1|4067399_4067921_-	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	74.6	7.8e-71
QAT67131.1|4068648_4068981_-	DUF1140 family protein	NA	NA	NA	NA	NA
QAT67132.1|4069012_4071112_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	78.8	0.0e+00
QAT67133.1|4071101_4071458_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	56.8	5.9e-30
QAT67134.1|4071597_4071798_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67135.1|4071794_4072052_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67136.1|4072056_4072422_-	hypothetical protein	NA	A0A218KDD8	Bacillus_phage	39.3	2.6e-12
QAT67137.1|4072421_4072988_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	52.6	5.0e-07
QAT67138.1|4072980_4073190_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67139.1|4073189_4074239_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	54.9	1.4e-82
QAT67140.1|4074253_4076500_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	48.6	3.6e-173
QAT67141.1|4076682_4076946_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67142.1|4076986_4077418_-	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	41.0	5.2e-12
QAT67143.1|4077595_4078375_-	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	50.4	6.6e-58
QAT67144.1|4078622_4079147_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67145.1|4079440_4080076_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
QAT67146.1|4080339_4081578_-	hypothetical protein	NA	A0A288WG12	Bacillus_phage	28.6	3.3e-43
QAT67147.1|4081689_4081899_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAT67983.1|4081911_4082196_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAT67148.1|4082192_4083212_-	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.9	1.0e-74
QAT67149.1|4083233_4084595_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.3	4.2e-124
QAT67150.1|4084613_4085402_-	phage antirepressor Ant	NA	A0A2P1JTZ2	Anoxybacillus_phage	56.4	1.1e-63
QAT67151.1|4085398_4085902_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67152.1|4085898_4086726_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	53.8	4.1e-74
QAT67153.1|4086744_4086948_-	hypothetical protein	NA	A0A1P8CX62	Bacillus_phage	63.2	1.2e-14
QAT67154.1|4086944_4087949_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	43.0	3.0e-55
QAT67155.1|4087965_4088349_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67156.1|4088332_4088752_-	hypothetical protein	NA	NA	NA	NA	NA
QAT67157.1|4089471_4089801_-	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	33.0	2.5e-06
