The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035156	Lactobacillus plantarum strain SRCM103362 chromosome, complete genome	3038657	37635	54422	3038657	integrase,terminase,tail,head,portal,capsid	Lactococcus_phage(22.22%)	22	37591:37610	42592:42611
37591:37610	attL	GTACAACGTGGTACACTTAG	NA	NA	NA	NA
QAS22849.1|37635_38790_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	36.7	8.0e-60
QAS22850.1|38851_39556_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAS22851.1|39693_39873_+	DNA-binding protein	NA	NA	NA	NA	NA
QAS22852.1|39915_40023_+	hypothetical protein	NA	NA	NA	NA	NA
QAS22853.1|40143_40374_+	hypothetical protein	NA	NA	NA	NA	NA
QAS22854.1|40387_41188_+	DNA replication protein	NA	NA	NA	NA	NA
QAS22855.1|41187_42582_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.4	1.8e-69
QAS22856.1|42724_43204_+	hypothetical protein	NA	NA	NA	NA	NA
42592:42611	attR	CTAAGTGTACCACGTTGTAC	NA	NA	NA	NA
QAS22857.1|43219_43411_+	hypothetical protein	NA	NA	NA	NA	NA
QAS22858.1|43397_43739_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
QAS22859.1|43731_44121_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.6	1.0e-19
QAS22860.1|44707_45181_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
QAS22861.1|45177_46881_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.3	3.2e-121
QAS22862.1|46834_47035_+	hypothetical protein	NA	NA	NA	NA	NA
QAS22863.1|47035_48136_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.0	1.2e-49
QAS22864.1|48132_49668_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.8	6.7e-46
QAS22865.1|49785_50055_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
QAS22866.1|50204_50582_+	hypothetical protein	NA	NA	NA	NA	NA
QAS22867.1|50705_50906_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	1.4e-20
QAS22868.1|50992_51223_+	hypothetical protein	NA	NA	NA	NA	NA
QAS22869.1|51826_52534_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.1	2.9e-44
QAS22870.1|52547_54422_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.8	5.5e-34
>prophage 2
CP035156	Lactobacillus plantarum strain SRCM103362 chromosome, complete genome	3038657	547880	556505	3038657		Streptococcus_phage(66.67%)	11	NA	NA
QAS23304.1|547880_549578_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
QAS23305.1|549599_549908_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
QAS23306.1|549923_550523_+	recombination protein RecR	NA	NA	NA	NA	NA
QAS23307.1|550537_550789_+	DUF2508 family protein	NA	NA	NA	NA	NA
QAS23308.1|551187_551853_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
QAS23309.1|551849_552179_+	hypothetical protein	NA	NA	NA	NA	NA
QAS23310.1|552195_553215_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
QAS23311.1|553239_553587_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
QAS23312.1|553685_554582_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	1.7e-81
QAS23313.1|554585_555371_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
QAS23314.1|555509_556505_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	1.0e-50
>prophage 3
CP035156	Lactobacillus plantarum strain SRCM103362 chromosome, complete genome	3038657	1156190	1163550	3038657		Lactobacillus_phage(83.33%)	7	NA	NA
QAS23787.1|1156190_1157138_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
QAS23788.1|1157481_1158096_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
QAS23789.1|1158098_1160537_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.4	0.0e+00
QAS23790.1|1160624_1161185_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
QAS23791.1|1161255_1161696_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
QAS23792.1|1161791_1161929_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
QAS23793.1|1162554_1163550_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
>prophage 4
CP035156	Lactobacillus plantarum strain SRCM103362 chromosome, complete genome	3038657	1661698	1748312	3038657	integrase,terminase,protease,tail,holin,head,tRNA,portal,capsid	Lactobacillus_phage(69.39%)	92	1687277:1687294	1755246:1755263
QAS24236.1|1661698_1662622_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
QAS24237.1|1663106_1663628_-	shikimate kinase	NA	NA	NA	NA	NA
QAS24238.1|1663630_1664728_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
QAS24239.1|1664730_1666029_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
QAS24240.1|1666042_1666570_-	amino acid biosynthesis protein	NA	NA	NA	NA	NA
QAS24241.1|1666578_1667748_-	chorismate synthase	NA	NA	NA	NA	NA
QAS24242.1|1667740_1669195_-	MFS transporter	NA	NA	NA	NA	NA
QAS24243.1|1672808_1673114_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24244.1|1673103_1673403_-	YlxR family protein	NA	NA	NA	NA	NA
QAS24245.1|1674684_1675161_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
QAS24246.1|1680262_1681972_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
QAS24247.1|1682011_1683289_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
QAS24248.1|1683326_1684112_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
QAS24249.1|1684127_1684907_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
QAS24250.1|1685026_1685590_-	ribosome recycling factor	NA	NA	NA	NA	NA
QAS24251.1|1685591_1686314_-	UMP kinase	NA	NA	NA	NA	NA
QAS24252.1|1686514_1687393_-	elongation factor Ts	NA	NA	NA	NA	NA
1687277:1687294	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
QAS24253.1|1687495_1688299_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
QAS24254.1|1688523_1689246_+	HAD family hydrolase	NA	NA	NA	NA	NA
QAS24255.1|1689534_1690533_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
QAS24256.1|1690617_1690923_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
QAS24257.1|1690906_1691665_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
QAS24258.1|1691776_1692412_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
QAS24259.1|1692468_1692705_-	YneF family protein	NA	NA	NA	NA	NA
QAS24260.1|1692802_1693042_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
QAS24261.1|1693193_1693826_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
QAS25457.1|1693915_1694146_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24262.1|1694449_1695079_+	hypothetical protein	NA	NA	NA	NA	NA
QAS24263.1|1695128_1696298_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
QAS24264.1|1696333_1696726_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24265.1|1696889_1697282_+	hypothetical protein	NA	NA	NA	NA	NA
QAS24266.1|1697727_1698669_+	glycosyltransferase	NA	V9QJB1	Oenococcus_phage	49.0	2.4e-78
QAS24267.1|1699420_1699993_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAS24268.1|1700144_1701329_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
QAS24269.1|1701309_1702101_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
QAS24270.1|1702119_1703862_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
QAS24271.1|1704340_1705552_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
QAS24272.1|1706793_1707171_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	68.8	1.0e-16
QAS24273.1|1707183_1707447_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
QAS25458.1|1707446_1708562_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	68.3	1.6e-33
QAS24274.1|1708627_1708843_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	74.3	5.9e-17
QAS24275.1|1710093_1710348_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	97.2	9.4e-30
QAS24276.1|1710340_1712656_-|tail	phage tail protein	tail	E9LUR4	Lactobacillus_phage	65.2	3.7e-189
QAS24277.1|1712673_1715031_-	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	91.4	0.0e+00
QAS24278.1|1715096_1716869_-|tail	phage tail protein	tail	E9LUR2	Lactobacillus_phage	95.6	0.0e+00
QAS24279.1|1716940_1721848_-|tail	phage tail protein	tail	E9LUR1	Lactobacillus_phage	62.4	0.0e+00
QAS24280.1|1721860_1722052_-	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
QAS24281.1|1722048_1722432_-	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	100.0	3.9e-64
QAS24282.1|1722633_1723272_-|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	94.3	2.7e-110
QAS24283.1|1723272_1723656_-	hypothetical protein	NA	E9LUQ7	Lactobacillus_phage	96.1	5.2e-64
QAS24284.1|1723652_1724093_-|tail	phage tail protein	tail	E9LUQ6	Lactobacillus_phage	97.9	4.2e-78
QAS24285.1|1724082_1724445_-|head,tail	head-tail adaptor protein	head,tail	E9LUQ5	Lactobacillus_phage	95.0	2.4e-63
QAS24286.1|1724428_1724773_-|head,tail	phage gp6-like head-tail connector protein	head,tail	F8J1B6	Lactobacillus_phage	33.0	2.0e-06
QAS24287.1|1725005_1726151_-|capsid	phage major capsid protein	capsid	A0A0C5AEH1	Paenibacillus_phage	45.6	4.9e-86
QAS24288.1|1726153_1726873_-|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	56.5	3.3e-64
QAS24289.1|1726844_1728074_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	50.8	1.9e-107
QAS24290.1|1728093_1729884_-|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	65.7	2.3e-231
QAS24291.1|1729870_1730329_-|terminase	phage terminase small subunit P27 family	terminase	F8J1A9	Lactobacillus_phage	35.3	3.1e-15
QAS24292.1|1730487_1730820_-	HNH endonuclease	NA	A0A0C5AFD8	Paenibacillus_phage	47.7	8.8e-20
QAS24293.1|1730819_1731059_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24294.1|1731058_1731247_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	85.7	6.1e-18
QAS24295.1|1731300_1732101_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24296.1|1732496_1732934_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	45.8	2.1e-29
QAS24297.1|1733008_1733209_-	hypothetical protein	NA	A0A1I9KKG6	Lactobacillus_phage	72.3	7.6e-19
QAS24298.1|1733240_1733408_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	86.4	4.4e-12
QAS24299.1|1733400_1733580_-	hypothetical protein	NA	A0A1S5RCW8	Lactobacillus_phage	80.0	2.7e-15
QAS24300.1|1733582_1733954_-	hypothetical protein	NA	Q9T1G9	Lactobacillus_phage	47.5	4.3e-15
QAS24301.1|1733950_1734397_-	DUF1642 domain-containing protein	NA	A0A1S5RCV9	Lactobacillus_phage	63.0	6.9e-44
QAS24302.1|1734478_1734904_-	hypothetical protein	NA	K4I239	Lactobacillus_phage	55.1	1.8e-33
QAS24303.1|1734969_1735179_-	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	97.1	9.1e-31
QAS24304.1|1735171_1735480_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	91.1	2.3e-46
QAS24305.1|1735615_1736401_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	98.9	1.2e-144
QAS24306.1|1736400_1737198_-	replication protein	NA	Q9AZA0	Lactobacillus_prophage	69.7	2.5e-52
QAS24307.1|1737247_1737940_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	88.7	1.1e-117
QAS24308.1|1738720_1738921_-	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	90.9	3.4e-27
QAS24309.1|1738923_1739178_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24310.1|1739190_1739394_-	DNA-binding protein	NA	NA	NA	NA	NA
QAS24311.1|1739559_1739850_+	hypothetical protein	NA	NA	NA	NA	NA
QAS25459.1|1739928_1740198_+	SinR family protein	NA	A0A0M3LS55	Mannheimia_phage	42.4	2.1e-11
QAS24312.1|1740442_1740703_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24313.1|1740760_1741048_+	hypothetical protein	NA	NA	NA	NA	NA
QAS24314.1|1741024_1741372_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24315.1|1741384_1741594_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24316.1|1741605_1742340_-	hypothetical protein	NA	A0A1P8BM06	Lactococcus_phage	45.3	2.5e-51
QAS24317.1|1742355_1742571_-	XRE family transcriptional regulator	NA	A0A2H4JBV7	uncultured_Caudovirales_phage	71.0	5.9e-17
QAS24318.1|1742763_1743435_+	LexA family transcriptional regulator	NA	D7RWL5	Brochothrix_phage	53.6	2.4e-40
QAS24319.1|1743557_1744832_+	hypothetical protein	NA	A0A0K2SUJ2	Clostridium_phage	35.7	3.5e-24
QAS24320.1|1745128_1745311_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	66.7	6.7e-14
QAS24321.1|1745412_1745652_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	60.3	1.8e-11
QAS24322.1|1745832_1746147_+	hypothetical protein	NA	NA	NA	NA	NA
QAS24323.1|1746343_1746919_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24324.1|1747148_1748312_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.5	2.7e-55
1755246:1755263	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 5
CP035156	Lactobacillus plantarum strain SRCM103362 chromosome, complete genome	3038657	2040218	2098739	3038657	integrase,terminase,tail,plate,holin,head,portal,capsid	Lactobacillus_phage(50.0%)	67	2084807:2084828	2098917:2098938
QAS24569.1|2040218_2040593_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	70.0	3.5e-17
QAS24570.1|2040579_2040876_-	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	4.4e-39
QAS24571.1|2042245_2044573_-	hypothetical protein	NA	A0A2K9VC32	Lactobacillus_phage	35.8	1.6e-38
QAS24572.1|2044587_2044734_-	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	56.8	6.0e-05
QAS24573.1|2044733_2045045_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
QAS24574.1|2045049_2045814_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24575.1|2045831_2046491_-|plate	phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	48.6	1.8e-40
QAS24576.1|2046502_2047567_-	SGNH/GDSL hydrolase family protein	NA	Q8LTH0	Staphylococcus_virus	48.6	1.1e-66
QAS24577.1|2047563_2047785_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24578.1|2047777_2048905_-	hypothetical protein	NA	O03938	Lactobacillus_phage	42.6	6.8e-72
QAS24579.1|2048916_2049735_-|tail	phage tail family protein	tail	NA	NA	NA	NA
QAS24580.1|2049735_2055366_-|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	25.2	4.5e-23
QAS24581.1|2055381_2056023_-	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	30.6	2.0e-07
QAS24582.1|2056019_2056538_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24583.1|2056656_2057274_-	hypothetical protein	NA	A0A2I7QIP9	Bacillus_phage	31.8	1.0e-05
QAS24584.1|2057291_2057756_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24585.1|2057716_2058118_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24586.1|2058114_2058504_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24587.1|2058504_2058909_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24588.1|2059268_2060216_-|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.5	3.9e-89
QAS24589.1|2060229_2060832_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24590.1|2060895_2062098_-	hypothetical protein	NA	A0A059T7W2	Listeria_phage	31.1	4.0e-38
QAS24591.1|2061973_2063569_-|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	37.8	1.3e-84
QAS24592.1|2063571_2064897_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	55.5	3.8e-138
QAS24593.1|2064877_2065417_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	72.6	9.5e-48
QAS24594.1|2065593_2065773_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	49.1	6.0e-07
QAS24595.1|2065833_2066550_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24596.1|2066830_2066998_-	BC1881 family protein	NA	NA	NA	NA	NA
QAS24597.1|2067233_2067701_-	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	40.0	1.4e-15
QAS24598.1|2068160_2068595_-	hypothetical protein	NA	A0A2I7S8E8	Vibrio_phage	33.8	3.3e-14
QAS24599.1|2068906_2069287_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24600.1|2069283_2069802_-	hypothetical protein	NA	O03915	Lactobacillus_phage	72.5	1.6e-60
QAS24601.1|2069798_2070086_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24602.1|2070082_2071000_-	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	43.2	1.3e-57
QAS24603.1|2071082_2072048_-	hypothetical protein	NA	A6M982	Geobacillus_virus	53.6	7.6e-64
QAS24604.1|2072059_2072590_-	hypothetical protein	NA	E9LUU0	Lactobacillus_phage	58.6	6.7e-54
QAS24605.1|2072610_2072724_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24606.1|2072856_2073027_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24607.1|2073094_2073607_-	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	44.1	7.2e-29
QAS24608.1|2073673_2073979_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
QAS24609.1|2074239_2074521_+	hypothetical protein	NA	NA	NA	NA	NA
QAS24610.1|2074677_2074932_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAS24611.1|2075078_2075582_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	41.4	3.8e-22
QAS24612.1|2075596_2076019_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
QAS24613.1|2076074_2077043_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
QAS24614.1|2078064_2078241_+	hypothetical protein	NA	NA	NA	NA	NA
QAS24615.1|2079097_2079457_+	hypothetical protein	NA	NA	NA	NA	NA
QAS24616.1|2079487_2079769_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
QAS24617.1|2080019_2081768_+	hypothetical protein	NA	NA	NA	NA	NA
QAS24618.1|2081821_2082736_+	DNA adenine methylase	NA	NA	NA	NA	NA
QAS24619.1|2084293_2084500_-	hypothetical protein	NA	NA	NA	NA	NA
2084807:2084828	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
QAS24620.1|2084917_2085223_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24621.1|2085304_2085685_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24622.1|2085832_2086102_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
QAS24623.1|2089142_2089343_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24624.1|2089296_2091000_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.7	1.1e-121
QAS24625.1|2090996_2091470_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
QAS24626.1|2092330_2092714_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	44.3	2.5e-18
QAS24627.1|2092706_2093045_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
QAS24628.1|2093031_2093223_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24629.1|2093237_2093717_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24630.1|2095254_2096055_-	DNA replication protein	NA	NA	NA	NA	NA
QAS24631.1|2096068_2096299_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24632.1|2096418_2096526_-	hypothetical protein	NA	NA	NA	NA	NA
QAS24633.1|2096568_2096748_-	DNA-binding protein	NA	E9LUT5	Lactobacillus_phage	89.7	3.0e-22
QAS24634.1|2096904_2097525_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAS24635.1|2097581_2098739_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	35.1	6.6e-54
2098917:2098938	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
