The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032680	Lactobacillus johnsonii strain ZLJ010 chromosome, complete genome	1999879	347073	408793	1999879	transposase,tRNA	Streptococcus_phage(50.0%)	35	NA	NA
AZZ66889.1|347073_347865_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AZZ66890.1|347967_348411_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZZ66891.1|348424_348820_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZZ66892.1|350377_351073_-	NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
AZZ66893.1|351075_351720_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZZ66894.1|351719_352859_-	DUF3533 domain-containing protein	NA	NA	NA	NA	NA
AZZ66895.1|352949_353540_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ66896.1|353683_354550_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZZ66897.1|354775_355360_-	DJ-1 family protein	NA	NA	NA	NA	NA
AZZ66898.1|355622_356312_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZZ66899.1|356338_356665_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ66900.1|356759_357644_+	cation transporter	NA	NA	NA	NA	NA
AZZ66901.1|357707_357965_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ66902.1|357966_358209_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ66903.1|358230_358908_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZZ66904.1|359016_359952_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	I7CCW4	Staphylococcus_virus	29.0	2.0e-13
AZZ68342.1|360193_360778_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
AZZ66905.1|360793_363760_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ66906.1|364007_365231_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.7	3.4e-93
AZZ66907.1|365565_372363_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AZZ66908.1|372788_373139_+|transposase	transposase	transposase	NA	NA	NA	NA
AZZ66909.1|373203_373434_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AZZ66910.1|373348_374716_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	27.7	6.8e-42
AZZ66911.1|374931_384447_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
AZZ66912.1|385011_385359_+|transposase	transposase	transposase	NA	NA	NA	NA
AZZ66913.1|388921_390109_+	accessory Sec system protein translocase subunit SecY2	NA	NA	NA	NA	NA
AZZ66914.1|390111_391620_+	accessory Sec system protein Asp1	NA	NA	NA	NA	NA
AZZ66915.1|391621_393166_+	accessory Sec system protein Asp2	NA	NA	NA	NA	NA
AZZ66916.1|393149_394010_+	accessory Sec system protein Asp3	NA	NA	NA	NA	NA
AZZ66917.1|394014_396381_+	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
AZZ66918.1|396393_397923_+	accessory Sec system glycosyltransferase GtfA	NA	NA	NA	NA	NA
AZZ66919.1|397915_399244_+	accessory Sec system glycosylation chaperone GtfB	NA	NA	NA	NA	NA
AZZ66920.1|399236_399425_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ66921.1|399787_407452_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AZZ66922.1|407515_408793_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.1	8.3e-50
>prophage 2
CP032680	Lactobacillus johnsonii strain ZLJ010 chromosome, complete genome	1999879	648524	704869	1999879	capsid,plate,portal,bacteriocin,integrase,terminase	Lactobacillus_phage(44.74%)	76	660019:660035	673926:673942
AZZ67137.1|648524_648851_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZZ67138.1|649115_649901_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AZZ67139.1|650008_652414_+	phosphoketolase family protein	NA	NA	NA	NA	NA
AZZ67140.1|652574_653231_+	nitroreductase	NA	NA	NA	NA	NA
AZZ67141.1|653360_654053_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67142.1|654103_655486_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AZZ67143.1|655583_656153_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	30.7	6.8e-12
AZZ67144.1|656243_657554_-	amino acid permease	NA	NA	NA	NA	NA
AZZ67145.1|657674_658385_+	lysozyme	NA	NA	NA	NA	NA
AZZ67146.1|658395_659625_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	29.3	8.0e-34
AZZ67147.1|659624_660956_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
660019:660035	attL	ATGTAGTTGATATTAAA	NA	NA	NA	NA
AZZ67148.1|661187_662306_-|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	40.8	1.7e-70
AZZ67149.1|662390_662933_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67150.1|663019_663820_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AZZ67151.1|663843_664311_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67152.1|664381_664804_-	ImmA/IrrE family metallo-endopeptidase	NA	Q6SEA2	Lactobacillus_prophage	92.1	3.0e-73
AZZ67153.1|664807_665152_-	XRE family transcriptional regulator	NA	Q6SEA1	Lactobacillus_prophage	55.8	3.6e-24
AZZ67154.1|665290_665491_+	XRE family transcriptional regulator	NA	A0A1B0Y2Q9	Lactobacillus_phage	45.5	1.7e-05
AZZ67155.1|665662_665911_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67156.1|665973_666471_+	hypothetical protein	NA	Q6SE99	Lactobacillus_prophage	66.2	1.1e-55
AZZ67157.1|666434_666713_+	hypothetical protein	NA	Q6SE99	Lactobacillus_prophage	98.9	5.1e-45
AZZ67158.1|666890_667193_+	hypothetical protein	NA	B8R678	Lactobacillus_phage	41.3	7.3e-13
AZZ67159.1|667650_667992_+	hypothetical protein	NA	L0P7D6	Lactobacillus_phage	60.2	1.0e-26
AZZ67160.1|668007_668493_+	hypothetical protein	NA	A0A0A1EL06	Lactobacillus_phage	42.1	8.3e-27
AZZ67161.1|668506_669364_+	hypothetical protein	NA	A0A2D1GPH8	Lactobacillus_phage	43.9	1.7e-22
AZZ67162.1|669373_670123_+	Rep protein	NA	Q8SDH3	Lactococcus_phage	45.1	3.2e-49
AZZ67163.1|670135_670936_+	AAA family ATPase	NA	B8R682	Lactobacillus_phage	48.7	6.3e-64
AZZ67164.1|670938_671256_+	XRE family transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	46.8	1.8e-09
AZZ67165.1|671277_671643_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67166.1|671676_671964_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67167.1|671965_672256_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67168.1|672258_672534_+	hypothetical protein	NA	Q9T1H3	Lactobacillus_phage	38.2	5.1e-05
AZZ67169.1|672533_672776_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67170.1|672780_673053_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67171.1|673039_673312_+	hypothetical protein	NA	Q20DF3	Lactobacillus_phage	68.6	9.4e-28
AZZ67172.1|673298_673853_+	methyltransferase domain-containing protein	NA	A0A2H4PBJ4	Lactobacillus_phage	54.5	3.2e-46
AZZ67173.1|674212_674626_+	hypothetical protein	NA	NA	NA	NA	NA
673926:673942	attR	ATGTAGTTGATATTAAA	NA	NA	NA	NA
AZZ67174.1|674622_675084_+	RusA family crossover junction endodeoxyribonuclease	NA	Q20DF1	Lactobacillus_phage	73.7	7.9e-59
AZZ67175.1|675391_675598_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67176.1|675604_676204_+	ArpU family transcriptional regulator	NA	NA	NA	NA	NA
AZZ67177.1|677243_678041_+|terminase	terminase	terminase	V9QKX0	Oenococcus_phage	54.5	6.3e-72
AZZ67178.1|678018_679314_+|terminase	PBSX family phage terminase large subunit	terminase	Q6SE84	Lactobacillus_prophage	66.1	4.1e-161
AZZ68351.1|679352_680762_+|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	37.1	1.2e-65
AZZ67179.1|680712_682332_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67180.1|682319_682619_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67181.1|682749_683388_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
AZZ67182.1|683391_684381_+|capsid	N4-gp56 family major capsid protein	capsid	D7RWC9	Brochothrix_phage	47.8	1.1e-62
AZZ67183.1|684380_684587_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67184.1|684561_684903_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67185.1|684912_685362_+	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	30.4	8.9e-07
AZZ67186.1|685363_685747_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67187.1|685730_686201_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67188.1|686193_687294_+	DUF3383 family protein	NA	A8ATH2	Listeria_phage	37.1	3.3e-55
AZZ67189.1|687305_687704_+	hypothetical protein	NA	A8ATH3	Listeria_phage	39.2	2.9e-17
AZZ67190.1|687782_688112_+	hypothetical protein	NA	D6PSY5	Lactobacillus_phage	36.2	9.4e-06
AZZ67191.1|688288_693082_+	hypothetical protein	NA	E9LUR1	Lactobacillus_phage	23.9	6.4e-10
AZZ67192.1|693085_693649_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	39.4	9.1e-25
AZZ67193.1|693648_693984_+	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	50.0	2.2e-26
AZZ67194.1|693976_694840_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67195.1|694839_695205_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ67196.1|695191_695527_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67197.1|695519_696668_+|plate	baseplate J/gp47 family protein	plate	A8ATI2	Listeria_phage	34.2	1.2e-60
AZZ67198.1|696664_697573_+	hypothetical protein	NA	A8ATI3	Listeria_phage	30.9	1.8e-14
AZZ67199.1|697583_698222_+	hypothetical protein	NA	H7BVG0	unidentified_phage	53.3	2.9e-43
AZZ67200.1|698235_698712_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67201.1|698686_699106_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67202.1|699106_699736_+	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	49.7	4.1e-42
AZZ67203.1|699782_700133_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67204.1|700129_700423_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67205.1|700440_700917_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67206.1|700916_701141_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67207.1|701152_701530_+	hypothetical protein	NA	A0A0A1ENR5	Lactobacillus_phage	51.2	7.2e-34
AZZ67208.1|701689_702097_+	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	54.3	2.9e-25
AZZ67209.1|702098_703007_+	glycoside hydrolase family 25	NA	Q9AZ81	Lactobacillus_prophage	84.1	5.2e-155
AZZ67210.1|703427_703613_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67211.1|703726_704869_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	32.1	2.7e-28
>prophage 3
CP032680	Lactobacillus johnsonii strain ZLJ010 chromosome, complete genome	1999879	792812	827732	1999879	integrase,protease,transposase,tRNA	Streptococcus_phage(36.36%)	38	791037:791056	818074:818093
791037:791056	attL	GTTTTAACTAAGCTTGATGG	NA	NA	NA	NA
AZZ67297.1|792812_794090_-|transposase	ISL3-like element ISLjo2 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	5.4e-49
AZZ67298.1|794290_796225_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	E4ZFJ7	Streptococcus_phage	99.4	0.0e+00
AZZ67299.1|796476_796863_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ68352.1|797225_798140_-|integrase	integrase	integrase	M4W8M4	Mycobacterium_phage	32.7	5.3e-06
AZZ67300.1|799777_800059_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67301.1|800423_800855_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
AZZ67302.1|800988_803142_+	copper-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	26.9	2.2e-10
AZZ67303.1|803194_803359_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AZZ68353.1|803376_803691_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67304.1|803972_804221_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67305.1|804214_804556_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SEX8	Streptococcus_phage	43.7	1.2e-11
AZZ67306.1|804665_804884_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	44.1	7.8e-09
AZZ68354.1|805005_805434_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67307.1|805594_806572_+	NADPH:quinone reductase	NA	NA	NA	NA	NA
AZZ67308.1|807078_807906_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ67309.1|808077_809283_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZZ67310.1|809689_810022_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67311.1|810319_810640_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67312.1|810717_810993_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67313.1|811098_811356_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67314.1|811707_812895_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67315.1|813606_813927_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67316.1|814351_815233_-	restriction endonuclease	NA	NA	NA	NA	NA
AZZ67317.1|815774_816791_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.0	1.5e-46
AZZ67318.1|816995_817337_+	transcriptional regulator	NA	NA	NA	NA	NA
AZZ67319.1|817338_818769_+	signal recognition particle protein	NA	D6PHS7	uncultured_phage	29.9	2.8e-06
818074:818093	attR	GTTTTAACTAAGCTTGATGG	NA	NA	NA	NA
AZZ67320.1|818855_819128_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZZ67321.1|819196_819718_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZZ67322.1|819707_820430_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZZ67323.1|820543_820894_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZZ67324.1|820985_821627_-	signal peptidase I	NA	NA	NA	NA	NA
AZZ67325.1|821827_822247_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AZZ68355.1|822230_822869_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
AZZ67326.1|822905_823529_-	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	56.3	3.2e-15
AZZ67327.1|823666_823915_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
AZZ67328.1|823987_824209_+	YneF family protein	NA	NA	NA	NA	NA
AZZ67329.1|824285_826052_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.9	2.2e-53
AZZ67330.1|826508_827732_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.7	4.5e-93
>prophage 4
CP032680	Lactobacillus johnsonii strain ZLJ010 chromosome, complete genome	1999879	926433	936556	1999879	transposase	Streptococcus_phage(66.67%)	6	NA	NA
AZZ67409.1|926433_927552_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.5	8.3e-38
AZZ67410.1|928872_930096_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.7	4.5e-93
AZZ67411.1|930446_933692_+	hypothetical protein	NA	A0A248SL14	Klebsiella_phage	36.4	3.8e-192
AZZ67412.1|933672_934047_+	TnpV protein	NA	D0R0F4	Streptococcus_phage	96.8	6.6e-64
AZZ67413.1|934411_936331_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	E4ZFJ7	Streptococcus_phage	84.2	0.0e+00
AZZ67414.1|936382_936556_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	100.0	4.6e-28
>prophage 5
CP032680	Lactobacillus johnsonii strain ZLJ010 chromosome, complete genome	1999879	1039749	1115344	1999879	capsid,holin,tRNA,portal,tail,integrase,terminase,transposase	Lactobacillus_phage(34.88%)	80	1071949:1071967	1111223:1111241
AZZ67503.1|1039749_1041048_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	26.9	2.7e-48
AZZ67504.1|1041119_1041764_+	DnaD domain protein	NA	Q938N2	Temperate_phage	36.5	2.6e-07
AZZ67505.1|1041773_1042403_+	endonuclease III	NA	NA	NA	NA	NA
AZZ67506.1|1042526_1043576_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.2	2.0e-49
AZZ67507.1|1043875_1044721_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ67508.1|1044745_1045717_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67509.1|1045780_1046374_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67510.1|1046461_1047511_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.9	4.4e-49
AZZ67511.1|1047603_1049979_-	penicillin-binding protein	NA	NA	NA	NA	NA
AZZ67512.1|1049989_1050601_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	37.7	3.3e-20
AZZ67513.1|1050668_1051232_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
AZZ67514.1|1051437_1051875_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
AZZ67515.1|1052340_1053465_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
AZZ67516.1|1053470_1054703_+	metallophosphoesterase	NA	NA	NA	NA	NA
AZZ67517.1|1054751_1055879_-	acyltransferase	NA	NA	NA	NA	NA
AZZ67518.1|1055964_1056888_-	DegV family protein	NA	NA	NA	NA	NA
AZZ67519.1|1057020_1057365_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ68364.1|1057367_1059041_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AZZ67520.1|1059040_1059505_+	signal peptidase II	NA	NA	NA	NA	NA
AZZ67521.1|1059519_1060434_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	1.8e-09
AZZ67522.1|1060437_1061493_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
AZZ67523.1|1061496_1064661_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AZZ67524.1|1064733_1066425_-	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.2	1.5e-09
AZZ67525.1|1066613_1067024_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ67526.1|1067139_1068027_+	DegV family protein	NA	NA	NA	NA	NA
AZZ67527.1|1068111_1069224_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67528.1|1069281_1070163_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ67529.1|1070233_1071304_-	tyrosine recombinase XerS	NA	A0A142F1N9	Bacillus_phage	22.3	2.3e-05
AZZ67530.1|1071784_1072000_-	hypothetical protein	NA	NA	NA	NA	NA
1071949:1071967	attL	TGGTCACTTTTTGGTCACT	NA	NA	NA	NA
AZZ67531.1|1071968_1073189_-|integrase	site-specific integrase	integrase	A9D9I9	Lactobacillus_prophage	33.4	1.8e-49
AZZ67532.1|1073372_1074353_-	Abi family protein	NA	M1PS09	Streptococcus_phage	40.9	4.7e-61
AZZ67533.1|1074583_1075315_-	SHOCT domain-containing protein	NA	O48432	Lactobacillus_phage	38.7	1.1e-30
AZZ68365.1|1075329_1075845_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67534.1|1075936_1076545_-	helix-turn-helix domain-containing protein	NA	U3PIS7	Lactobacillus_phage	46.0	2.4e-39
AZZ67535.1|1076698_1076926_+	XRE family transcriptional regulator	NA	A0A2H4J9X2	uncultured_Caudovirales_phage	51.3	1.9e-13
AZZ67536.1|1076937_1077720_+	hypothetical protein	NA	Q20DF7	Lactobacillus_phage	61.0	2.3e-74
AZZ67537.1|1077729_1078086_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67538.1|1078082_1078331_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67539.1|1078681_1079557_+	DUF1351 domain-containing protein	NA	Q6SE94	Lactobacillus_prophage	47.0	7.2e-61
AZZ67540.1|1079558_1080362_+	hypothetical protein	NA	Q6SEE8	Lactobacillus_prophage	74.9	2.9e-109
AZZ67541.1|1080373_1081087_+	helix-turn-helix domain-containing protein	NA	Q6SE92	Lactobacillus_prophage	61.4	9.0e-62
AZZ67542.1|1081076_1081436_+	XRE family transcriptional regulator	NA	Q9T1H4	Lactobacillus_phage	50.9	1.1e-18
AZZ67543.1|1081621_1081894_+	hypothetical protein	NA	Q6SE91	Lactobacillus_prophage	94.4	1.9e-44
AZZ67544.1|1081883_1082075_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67545.1|1082167_1082473_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67546.1|1082478_1082949_+	RusA family crossover junction endodeoxyribonuclease	NA	X2CXX1	Lactobacillus_phage	77.8	3.5e-62
AZZ67547.1|1082941_1083262_+	hypothetical protein	NA	A9D9P5	Lactobacillus_prophage	67.6	8.8e-33
AZZ67548.1|1083243_1083471_+	hypothetical protein	NA	A9D9P7	Lactobacillus_prophage	55.4	1.8e-11
AZZ67549.1|1083868_1084429_+	ArpU family transcriptional regulator	NA	NA	NA	NA	NA
AZZ67550.1|1085613_1086081_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
AZZ67551.1|1086122_1086788_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AZZ67552.1|1086787_1087162_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67553.1|1087168_1087624_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67554.1|1087626_1088328_+	nuclease	NA	A8ATN5	Listeria_phage	39.4	5.3e-14
AZZ67555.1|1088422_1088701_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67556.1|1088719_1089385_+|terminase	terminase	terminase	A0A1S5SAK3	Streptococcus_phage	41.6	1.7e-30
AZZ67557.1|1089350_1090658_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	64.3	3.5e-168
AZZ67558.1|1090670_1092305_+|portal	phage portal protein	portal	Q38341	Lactococcus_phage	47.9	2.1e-130
AZZ67559.1|1092255_1093401_+|capsid	minor capsid protein	capsid	U3PFU0	Lactobacillus_phage	48.5	3.8e-94
AZZ67560.1|1093499_1094126_+	scaffolding protein	NA	X2CYF9	Lactobacillus_phage	32.0	2.9e-16
AZZ67561.1|1094133_1095171_+	replication protein	NA	O03966	Lactobacillus_phage	53.2	9.0e-103
AZZ67562.1|1095197_1095587_+	hypothetical protein	NA	U3PCQ2	Lactobacillus_phage	29.6	1.9e-05
AZZ67563.1|1095580_1095931_+|capsid	minor capsid protein	capsid	O03932	Lactobacillus_phage	43.2	3.8e-21
AZZ67564.1|1095940_1096312_+|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	41.3	1.5e-15
AZZ67565.1|1096304_1096706_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
AZZ68366.1|1096972_1097314_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67566.1|1097324_1097771_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67567.1|1097775_1098393_+	hypothetical protein	NA	O03936	Lactobacillus_phage	32.2	6.2e-19
AZZ67568.1|1098396_1103676_+|tail	tail tape measure protein	tail	Q9T1E7	Lactobacillus_phage	40.0	5.6e-116
AZZ67569.1|1103668_1104490_+|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	44.2	3.7e-59
AZZ67570.1|1104504_1105866_+	hypothetical protein	NA	O03938	Lactobacillus_phage	26.6	1.6e-22
AZZ67571.1|1105915_1106263_+	hypothetical protein	NA	Q6SEC1	Lactobacillus_prophage	51.2	2.7e-11
AZZ67572.1|1108880_1109282_+	hypothetical protein	NA	Q6SEB9	Lactobacillus_prophage	94.0	8.1e-68
AZZ67573.1|1109349_1109571_+	hypothetical protein	NA	Q6SEB8	Lactobacillus_prophage	87.7	2.8e-30
AZZ67574.1|1109563_1109761_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67575.1|1109760_1110156_+|holin	phage holin	holin	Q6SEB6	Lactobacillus_prophage	64.1	6.5e-38
AZZ67576.1|1110165_1111113_+	lysin	NA	Q6SE63	Lactobacillus_prophage	52.2	8.0e-90
AZZ67577.1|1112136_1112832_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
1111223:1111241	attR	TGGTCACTTTTTGGTCACT	NA	NA	NA	NA
AZZ67578.1|1112897_1113485_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	42.6	7.7e-27
AZZ67579.1|1113556_1115344_-	DNA helicase RecQ	NA	A0A0G2Y0D4	Acanthamoeba_polyphaga_mimivirus	36.8	2.0e-81
>prophage 6
CP032680	Lactobacillus johnsonii strain ZLJ010 chromosome, complete genome	1999879	1223902	1285426	1999879	transposase,integrase,protease	Enterobacteria_phage(20.0%)	60	1219456:1219471	1268779:1268794
1219456:1219471	attL	CATCAATTGCTGTTTT	NA	NA	NA	NA
AZZ67668.1|1223902_1224871_-|integrase	integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.8	2.5e-30
AZZ67669.1|1224916_1226080_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZZ67670.1|1226115_1227669_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	35.6	9.8e-37
AZZ67671.1|1227822_1229082_-	peptide-binding protein	NA	NA	NA	NA	NA
AZZ67672.1|1229182_1229458_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	66.3	6.4e-24
AZZ67673.1|1229622_1230930_-	GTPase Der	NA	NA	NA	NA	NA
AZZ67674.1|1231005_1232208_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AZZ67675.1|1232270_1232963_-	(d)CMP kinase	NA	NA	NA	NA	NA
AZZ67676.1|1233043_1233637_-	ECF transporter S component	NA	NA	NA	NA	NA
AZZ67677.1|1233901_1234669_-	LysM domain-containing protein	NA	NA	NA	NA	NA
AZZ67678.1|1234729_1235449_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AZZ67679.1|1235450_1236041_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.1	1.3e-21
AZZ67680.1|1236030_1236774_-	segregation and condensation protein A	NA	NA	NA	NA	NA
AZZ67681.1|1236766_1237129_-	reductase	NA	NA	NA	NA	NA
AZZ67682.1|1237134_1238043_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	7.0e-35
AZZ67683.1|1238014_1238908_-	RNA-binding protein	NA	NA	NA	NA	NA
AZZ67684.1|1239020_1240790_-	pyruvate kinase	NA	NA	NA	NA	NA
AZZ67685.1|1240824_1241784_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AZZ67686.1|1241815_1242028_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67687.1|1241957_1245074_-	DNA polymerase III subunit alpha	NA	A0A0K1Y8T6	Streptomyces_phage	31.6	6.4e-136
AZZ67688.1|1245176_1245377_+	DUF2929 family protein	NA	NA	NA	NA	NA
AZZ67689.1|1245434_1247000_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZZ67690.1|1247059_1247251_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AZZ67691.1|1247367_1247694_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
AZZ67692.1|1247703_1248498_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	20.7	2.4e-07
AZZ67693.1|1248502_1249432_-	ribonuclease Z	NA	NA	NA	NA	NA
AZZ67694.1|1249445_1251371_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.8	6.3e-25
AZZ67695.1|1251400_1252687_-	GTPase ObgE	NA	NA	NA	NA	NA
AZZ67696.1|1252794_1254597_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AZZ67697.1|1254738_1255665_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ67698.1|1255673_1256285_+	DedA family protein	NA	NA	NA	NA	NA
AZZ67699.1|1256391_1257189_+|integrase	integrase	integrase	NA	NA	NA	NA
AZZ67700.1|1257217_1257859_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AZZ67701.1|1258126_1259479_+	APC family permease	NA	NA	NA	NA	NA
AZZ67702.1|1259747_1260590_-	cell wall protein	NA	NA	NA	NA	NA
AZZ67703.1|1260812_1261193_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AZZ67704.1|1261281_1261683_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67705.1|1261887_1262547_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67706.1|1262577_1263018_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AZZ67707.1|1263168_1264014_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67708.1|1264079_1264808_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67709.1|1265533_1266451_-|protease	protease	protease	NA	NA	NA	NA
AZZ67710.1|1266658_1267084_-	restriction endonuclease	NA	G3M9Z4	Bacillus_virus	33.0	1.2e-05
AZZ67711.1|1267520_1267742_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67712.1|1267707_1267938_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67713.1|1268036_1268294_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ67714.1|1268336_1268513_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ67715.1|1270268_1270937_-	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
1268779:1268794	attR	AAAACAGCAATTGATG	NA	NA	NA	NA
AZZ67716.1|1270933_1271239_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AZZ67717.1|1271216_1272125_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AZZ67718.1|1272331_1276459_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
AZZ67719.1|1277244_1278231_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	37.5	1.7e-26
AZZ67720.1|1278247_1278856_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.3	8.5e-45
AZZ67721.1|1278886_1279771_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.6	1.4e-93
AZZ67722.1|1279777_1280815_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	47.1	2.6e-86
AZZ67723.1|1280889_1282065_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZZ67724.1|1282081_1283032_-	Abi family protein	NA	X2L062	Streptococcus_phage	52.4	1.3e-87
AZZ67725.1|1283498_1283849_+|transposase	transposase	transposase	NA	NA	NA	NA
AZZ67726.1|1283913_1284144_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AZZ67727.1|1284058_1285426_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	28.2	4.0e-42
