The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	199375	272391	5425761	transposase,plate,tRNA,protease	Emiliania_huxleyi_virus(11.11%)	60	NA	NA
AZZ24763.1|199375_200728_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AZZ24764.1|200757_203190_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AZZ24765.1|203311_203797_+	chaperone protein Skp	NA	NA	NA	NA	NA
AZZ24766.1|203800_204826_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZZ24767.1|204930_205386_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZZ24768.1|205389_206178_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZZ24769.1|206177_207326_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZZ24770.1|207322_207919_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	7.9e-27
AZZ24771.1|207955_211438_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	2.2e-209
AZZ24772.1|211450_212410_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AZZ24773.1|212507_214649_+	lysine decarboxylase constitutive	NA	NA	NA	NA	NA
AZZ24774.1|214705_215095_+	VOC family protein	NA	NA	NA	NA	NA
AZZ24775.1|215159_216458_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AZZ29590.1|216506_216761_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
AZZ24776.1|216753_216954_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24777.1|217119_217665_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24778.1|217661_218084_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AZZ24779.1|218097_218808_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AZZ24780.1|218838_219663_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24781.1|219715_221434_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AZZ24782.1|221544_222252_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AZZ24783.1|222248_222653_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AZZ24784.1|222770_223586_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AZZ24785.1|223625_224279_-	methionine ABC transporter	NA	NA	NA	NA	NA
AZZ24786.1|224271_225303_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AZZ24787.1|225489_226062_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AZZ24788.1|231821_232625_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
AZZ24789.1|232621_233536_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ24790.1|233776_234577_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AZZ24791.1|234654_235425_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZZ24792.1|235471_236830_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AZZ24793.1|236901_237657_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AZZ24794.1|237690_238413_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZZ24795.1|238409_238877_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AZZ29591.1|238941_239673_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
AZZ24796.1|239561_239792_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24797.1|240211_240997_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24798.1|241145_241613_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24799.1|241622_242537_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24800.1|242580_243063_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AZZ24801.1|243086_244439_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24802.1|244449_247914_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AZZ24803.1|247992_249405_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AZZ24804.1|249409_250153_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AZZ24805.1|250149_252975_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.1	1.0e-79
AZZ24806.1|252983_253745_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24807.1|253749_255081_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AZZ24808.1|255083_255608_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AZZ24809.1|255604_256885_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AZZ24810.1|256909_257992_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZZ24811.1|257955_259806_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZZ24812.1|259809_260223_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AZZ24813.1|260229_261705_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AZZ24814.1|261755_261980_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24815.1|262014_262515_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AZZ24816.1|263211_263730_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AZZ24817.1|263762_263900_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24818.1|263939_266081_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
AZZ24819.1|270656_271034_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24820.1|271254_272391_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	438376	492251	5425761	tRNA,transposase,protease	uncultured_Mediterranean_phage(23.08%)	52	NA	NA
AZZ24974.1|438376_438886_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	3.2e-13
AZZ24975.1|439020_440394_+	proline-specific permease ProY	NA	NA	NA	NA	NA
AZZ24976.1|440552_442367_+	maltodextrin glucosidase	NA	NA	NA	NA	NA
AZZ24977.1|442554_444012_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24978.1|444032_444614_-	ACP phosphodiesterase	NA	NA	NA	NA	NA
AZZ24979.1|444832_445903_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AZZ24980.1|445958_447086_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
AZZ24981.1|447108_447441_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AZZ24982.1|447468_449316_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AZZ24983.1|449326_450298_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AZZ24984.1|450426_450774_+	HNH endonuclease	NA	NA	NA	NA	NA
AZZ24985.1|450950_451835_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AZZ24986.1|453038_454247_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.8	1.7e-209
AZZ24987.1|454570_455020_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AZZ24988.1|455023_456127_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	2.2e-54
AZZ24989.1|456215_456686_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AZZ24990.1|456705_457125_+	N utilization substance protein B	NA	NA	NA	NA	NA
AZZ24991.1|457202_458180_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AZZ24992.1|458157_458673_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AZZ24993.1|458849_460421_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AZZ24994.1|460651_461626_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZZ24995.1|461680_463543_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AZZ24996.1|463567_464467_-	farnesyl-diphosphate synthase	NA	NA	NA	NA	NA
AZZ24997.1|464466_464709_-	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AZZ24998.1|464914_466363_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AZZ24999.1|466416_467007_-	protein deglycase YajL	NA	NA	NA	NA	NA
AZZ25000.1|466969_467881_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AZZ25001.1|468048_468540_+	nucleotide-binding protein	NA	NA	NA	NA	NA
AZZ25002.1|468667_470032_-	MFS transporter	NA	NA	NA	NA	NA
AZZ25003.1|470180_471071_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AZZ25004.1|471082_471412_-	cytochrome bo(3) ubiquinol oxidase subunit 4	NA	NA	NA	NA	NA
AZZ25005.1|471411_472026_-	cytochrome bo(3) ubiquinol oxidase subunit 3	NA	NA	NA	NA	NA
AZZ25006.1|472015_474007_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZZ25007.1|474028_474976_-	cytochrome ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZZ25008.1|475435_476911_-	muropeptide transporter AmpG	NA	NA	NA	NA	NA
AZZ25009.1|476954_477533_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25010.1|477582_477714_-	polymerase	NA	NA	NA	NA	NA
AZZ25011.1|477837_478155_+	protein BolA	NA	NA	NA	NA	NA
AZZ25012.1|478088_478352_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25013.1|478498_479797_+	trigger factor	NA	NA	NA	NA	NA
AZZ25014.1|480043_480667_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AZZ25015.1|480792_482067_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AZZ25016.1|482254_484609_+|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AZZ25017.1|484817_485090_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AZZ25018.1|485281_487153_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZZ25019.1|487303_487675_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25020.1|487780_488179_+	long-chain acyl-CoA thioesterase FadM	NA	NA	NA	NA	NA
AZZ25021.1|488230_488926_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
AZZ25022.1|488990_490691_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25023.1|490790_491609_+	HMP-PP phosphatase	NA	NA	NA	NA	NA
AZZ29601.1|491605_491836_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25024.1|491741_492251_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.5e-13
>prophage 3
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	1178273	1226994	5425761	transposase,holin,integrase	Escherichia_phage(40.0%)	40	1177503:1177517	1180835:1180849
1177503:1177517	attL	CAGAAATTATTTTTT	NA	NA	NA	NA
AZZ25618.1|1178273_1179476_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
AZZ25619.1|1179662_1181480_-	hypothetical protein	NA	NA	NA	NA	NA
1180835:1180849	attR	CAGAAATTATTTTTT	NA	NA	NA	NA
AZZ25620.1|1182591_1182888_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AZZ25621.1|1183132_1183330_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AZZ25622.1|1183548_1184982_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AZZ25623.1|1185802_1186366_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZZ29628.1|1187040_1191999_+	nuclease	NA	NA	NA	NA	NA
AZZ25624.1|1191995_1193432_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29629.1|1193536_1193743_+	methyltransferase	NA	NA	NA	NA	NA
AZZ25625.1|1193911_1195801_-	enterotoxin	NA	NA	NA	NA	NA
AZZ25626.1|1195814_1196990_-	putative C-S lyase	NA	NA	NA	NA	NA
AZZ25627.1|1197001_1198573_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
AZZ25628.1|1198686_1199091_-	aldolase	NA	NA	NA	NA	NA
AZZ25629.1|1199038_1199341_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25630.1|1199273_1200098_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ25631.1|1200160_1200598_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25632.1|1200679_1201315_-	galactonate dehydratase	NA	NA	NA	NA	NA
AZZ25633.1|1201501_1201741_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25634.1|1201709_1201907_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ29630.1|1202094_1202295_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25635.1|1202422_1202521_+	acetolactate synthase	NA	NA	NA	NA	NA
AZZ25636.1|1202522_1203305_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ25637.1|1203610_1204531_+	ribokinase	NA	NA	NA	NA	NA
AZZ25638.1|1204558_1205875_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AZZ25639.1|1205886_1206900_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AZZ25640.1|1207391_1207541_+	exopolygalacturonate lyase	NA	NA	NA	NA	NA
AZZ25641.1|1207550_1208333_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	98.8	2.9e-138
AZZ25642.1|1208329_1209352_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	2.7e-200
AZZ25643.1|1209889_1210066_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AZZ25644.1|1210028_1210208_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25645.1|1211048_1211993_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ25646.1|1212337_1213057_+	aspartate racemase	NA	NA	NA	NA	NA
AZZ25647.1|1213122_1214421_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AZZ29631.1|1216301_1217744_-	amino acid permease	NA	NA	NA	NA	NA
AZZ25648.1|1217875_1220245_-	arginine decarboxylase	NA	NA	NA	NA	NA
AZZ25649.1|1220349_1221819_-	amino acid permease	NA	NA	NA	NA	NA
AZZ25650.1|1222208_1223370_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
AZZ25651.1|1223650_1224928_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AZZ25652.1|1224887_1225046_-|holin	choline transporter	holin	NA	NA	NA	NA
AZZ25653.1|1224990_1226994_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
>prophage 4
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	1357649	1461117	5425761	terminase,integrase,portal,lysis,tRNA,tail,holin,head,capsid,plate,transposase	Escherichia_phage(21.43%)	142	1382881:1382897	1436769:1436785
AZZ25791.1|1357649_1358768_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AZZ25792.1|1358736_1359006_-	excisionase	NA	NA	NA	NA	NA
AZZ25793.1|1359067_1361539_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
AZZ25794.1|1361634_1361823_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZZ25795.1|1361819_1362008_-	cell division inhibitor	NA	NA	NA	NA	NA
AZZ25796.1|1362018_1362873_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
AZZ29640.1|1363142_1363451_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25797.1|1363380_1363647_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29641.1|1363635_1363974_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
AZZ25798.1|1363985_1364138_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
AZZ25799.1|1364327_1364786_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	6.2e-24
AZZ25800.1|1364812_1365040_+	transcriptional regulator	NA	NA	NA	NA	NA
AZZ25801.1|1365023_1365575_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25802.1|1366375_1367041_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AZZ25803.1|1367074_1367845_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	5.1e-87
AZZ25804.1|1367845_1368253_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	4.0e-38
AZZ25805.1|1368249_1368546_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AZZ25806.1|1368542_1369004_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
AZZ25807.1|1368981_1369338_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
AZZ25808.1|1369431_1369614_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.3e-25
AZZ25809.1|1369779_1370295_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
AZZ25810.1|1370415_1370595_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25811.1|1370853_1371009_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AZZ25812.1|1371225_1371477_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25813.1|1371543_1371822_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	5.1e-05
AZZ25814.1|1371823_1372870_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.3	1.2e-110
AZZ25815.1|1372882_1373257_+	hypothetical protein	NA	V5URS4	Shigella_phage	62.7	8.4e-35
AZZ25816.1|1373253_1374075_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.6e-78
AZZ25817.1|1374608_1374935_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25818.1|1375382_1375718_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
AZZ25819.1|1375978_1377940_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	4.3e-239
AZZ25820.1|1378076_1378259_+	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
AZZ25821.1|1378296_1378542_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
AZZ25822.1|1378618_1378834_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AZZ25823.1|1378838_1379645_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	95.5	8.1e-144
AZZ25824.1|1379654_1379969_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
AZZ25825.1|1380097_1380631_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
AZZ25826.1|1380708_1380921_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AZZ29642.1|1381185_1381272_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25827.1|1381273_1381741_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	94.8	5.1e-74
AZZ25828.1|1382189_1382699_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AZZ25829.1|1382670_1384599_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.0e-261
1382881:1382897	attL	ACTGTTAATCTGATTAA	NA	NA	NA	NA
AZZ25830.1|1384582_1384789_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AZZ25831.1|1384785_1386378_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
AZZ25832.1|1386367_1387873_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
AZZ25833.1|1387909_1388257_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
AZZ25834.1|1388314_1389343_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
AZZ25835.1|1389346_1389769_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25836.1|1389761_1390115_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
AZZ25837.1|1390130_1390664_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
AZZ25838.1|1390660_1391056_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AZZ25839.1|1391063_1391813_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
AZZ25840.1|1391831_1392263_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
AZZ25841.1|1392289_1392703_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
AZZ25842.1|1392683_1395245_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.7	0.0e+00
AZZ25843.1|1395241_1395571_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AZZ25844.1|1395773_1396163_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AZZ25845.1|1396134_1396587_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.9	1.6e-24
AZZ25846.1|1396576_1396792_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25847.1|1396781_1397012_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25848.1|1397008_1397692_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.2	1.4e-24
AZZ25849.1|1397688_1397904_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25850.1|1397918_1398215_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25851.1|1398224_1398497_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ29643.1|1398553_1398775_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25852.1|1398785_1399316_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.1	2.0e-58
AZZ25853.1|1399343_1399613_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25854.1|1399615_1400782_-	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.7	7.4e-122
AZZ25855.1|1400792_1402562_-|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	69.2	3.8e-226
AZZ25856.1|1402577_1402895_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25857.1|1402894_1403815_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	2.0e-74
AZZ25858.1|1403825_1404134_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
AZZ25859.1|1404186_1404375_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AZZ25860.1|1404468_1404825_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZZ25861.1|1404941_1405706_-	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
AZZ25862.1|1405896_1406112_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25863.1|1406110_1406515_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25864.1|1406490_1407219_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25865.1|1407349_1407700_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	2.6e-22
AZZ25866.1|1407702_1408443_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.0	2.1e-61
AZZ25867.1|1408426_1409077_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AZZ25868.1|1409073_1409400_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AZZ25869.1|1409399_1409711_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AZZ25870.1|1409710_1410256_+	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AZZ25871.1|1410252_1411848_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	8.5e-185
AZZ25872.1|1411847_1413344_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.2	6.3e-166
AZZ25873.1|1413324_1414146_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
AZZ25874.1|1414148_1414607_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AZZ25875.1|1414821_1415937_+	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AZZ25876.1|1415951_1416905_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AZZ25877.1|1416914_1417253_+	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AZZ25878.1|1417254_1417701_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	5.0e-34
AZZ25879.1|1417700_1418165_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.0	1.2e-38
AZZ25880.1|1418161_1418416_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25881.1|1418405_1419833_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AZZ25882.1|1419832_1420354_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AZZ25883.1|1420356_1420638_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25884.1|1420735_1421071_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZZ25885.1|1420994_1421153_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZZ25886.1|1421228_1424180_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.6	5.4e-84
AZZ25887.1|1424179_1425064_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	5.2e-51
AZZ25888.1|1425060_1425276_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AZZ25889.1|1425263_1426418_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.6	3.2e-85
AZZ25890.1|1426414_1427011_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	1.4e-36
AZZ25891.1|1427065_1427413_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
AZZ25892.1|1427403_1428507_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
AZZ25893.1|1428499_1429078_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AZZ25894.1|1429080_1430700_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	33.9	2.1e-21
AZZ25895.1|1430702_1431119_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	4.5e-21
AZZ25896.1|1431090_1431693_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	82.5	1.4e-87
AZZ25897.1|1431692_1432151_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	53.1	1.5e-38
AZZ25898.1|1432222_1432795_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AZZ25899.1|1432825_1433536_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	93.1	1.2e-122
AZZ25900.1|1433546_1434290_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
AZZ25901.1|1434187_1434868_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.6	6.3e-113
AZZ25902.1|1435211_1438904_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
1436769:1436785	attR	ACTGTTAATCTGATTAA	NA	NA	NA	NA
AZZ25903.1|1438971_1439571_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
AZZ25904.1|1439722_1442749_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.4	4.5e-54
AZZ25905.1|1442748_1443333_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.0e-104
AZZ25906.1|1443305_1443443_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZZ29644.1|1443387_1444014_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZZ25907.1|1444112_1444379_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
AZZ25908.1|1444610_1445474_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AZZ25909.1|1445457_1446594_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AZZ29645.1|1446572_1446788_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25910.1|1446843_1448070_+	peptidase T	NA	NA	NA	NA	NA
AZZ25911.1|1448118_1449240_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AZZ25912.1|1449315_1450776_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AZZ25913.1|1450775_1451447_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AZZ25914.1|1451615_1452986_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AZZ29646.1|1452989_1453631_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AZZ25915.1|1453666_1454773_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZZ25916.1|1454826_1455288_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZZ25917.1|1455297_1455936_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AZZ25918.1|1456268_1456604_-	DUF1493 domain-containing protein	NA	NA	NA	NA	NA
AZZ25919.1|1456603_1457053_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ25920.1|1457634_1458885_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
AZZ25921.1|1458920_1459124_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25922.1|1459029_1459539_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	3.2e-13
AZZ25923.1|1459696_1460020_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	63.6	1.3e-39
AZZ25924.1|1460495_1460702_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ25925.1|1460607_1461117_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	3.2e-13
>prophage 5
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	1572259	1644594	5425761	terminase,integrase,lysis,holin,tail,head,capsid,protease	Escherichia_phage(31.75%)	92	1568211:1568224	1586289:1586302
1568211:1568224	attL	CTGCTTCCAGCGAT	NA	NA	NA	NA
AZZ26031.1|1572259_1573390_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AZZ26032.1|1573367_1573616_-	excisionase	NA	NA	NA	NA	NA
AZZ26033.1|1573680_1576155_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
AZZ26034.1|1576247_1576439_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZZ26035.1|1576435_1576624_-	cell division inhibitor	NA	NA	NA	NA	NA
AZZ26036.1|1576634_1577489_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
AZZ26037.1|1578046_1578325_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26038.1|1578284_1578686_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
AZZ26039.1|1578708_1578927_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26040.1|1578956_1579127_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26041.1|1579086_1579242_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
AZZ26042.1|1579495_1579957_-	transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
AZZ26043.1|1580064_1580340_+	transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
AZZ26044.1|1580323_1580749_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AZZ26045.1|1580759_1580963_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26046.1|1581649_1582315_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AZZ26047.1|1582348_1583119_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	2.5e-86
AZZ26048.1|1583119_1583527_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	4.0e-38
AZZ26049.1|1583523_1583820_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AZZ26050.1|1583816_1584278_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	5.9e-38
AZZ26051.1|1584255_1584612_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
AZZ26052.1|1584707_1584890_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	1.5e-26
AZZ26053.1|1585055_1585415_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	9.2e-39
AZZ26054.1|1585417_1585909_+	hypothetical protein	NA	G9L661	Escherichia_phage	92.0	3.7e-83
AZZ26055.1|1585910_1586174_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AZZ26056.1|1586184_1586352_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
1586289:1586302	attR	ATCGCTGGAAGCAG	NA	NA	NA	NA
AZZ26057.1|1586348_1586693_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
AZZ26058.1|1586927_1587140_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
AZZ26059.1|1587305_1587956_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26060.1|1587936_1589040_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AZZ26061.1|1589149_1589371_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	63.8	6.7e-16
AZZ26062.1|1589430_1589703_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
AZZ26063.1|1589704_1590751_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
AZZ26064.1|1590763_1591138_+	hypothetical protein	NA	V5URS4	Shigella_phage	62.7	1.1e-34
AZZ26065.1|1591134_1591956_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
AZZ26066.1|1592182_1592380_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AZZ26067.1|1592530_1593580_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	7.5e-198
AZZ26068.1|1594452_1594665_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26069.1|1594735_1595071_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	4.0e-44
AZZ26070.1|1595331_1597188_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	89.6	0.0e+00
AZZ26071.1|1597338_1597554_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AZZ26072.1|1597558_1597903_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
AZZ26073.1|1597868_1598141_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26074.1|1598246_1598780_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
AZZ26075.1|1598857_1599070_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AZZ29655.1|1599334_1599421_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26076.1|1599422_1599890_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	94.8	5.1e-74
AZZ26077.1|1600110_1600293_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	100.0	4.5e-26
AZZ26078.1|1600228_1600555_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
AZZ26079.1|1600686_1600887_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
AZZ26080.1|1600928_1601294_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	6.2e-59
AZZ26081.1|1601584_1602148_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
AZZ26082.1|1602144_1603806_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
AZZ26083.1|1603869_1605807_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
AZZ29656.1|1605851_1606073_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AZZ26084.1|1608761_1609088_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AZZ26085.1|1609097_1609448_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AZZ26086.1|1609444_1609891_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
AZZ26087.1|1609887_1610232_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AZZ26088.1|1610296_1611013_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
AZZ26089.1|1611027_1611402_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AZZ26090.1|1611425_1611707_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AZZ26091.1|1611754_1614997_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.7	0.0e+00
AZZ26092.1|1614989_1615331_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
AZZ26093.1|1615330_1616029_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
AZZ26094.1|1616039_1616783_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AZZ26095.1|1616680_1617361_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	3.8e-110
AZZ26096.1|1617703_1621177_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
AZZ26097.1|1621244_1621844_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
AZZ26098.1|1621995_1625022_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
AZZ26099.1|1625021_1625606_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.0e-103
AZZ26100.1|1625578_1625716_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZZ29657.1|1625660_1626287_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZZ26101.1|1626385_1626655_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AZZ26102.1|1627428_1627935_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AZZ26103.1|1627980_1628481_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AZZ26104.1|1628566_1628746_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26105.1|1629126_1629933_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZZ26106.1|1629932_1631126_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AZZ29658.1|1631137_1632496_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.5e-36
AZZ26107.1|1632499_1634095_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
AZZ26108.1|1634094_1635657_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AZZ29659.1|1635748_1635793_-	trp operon leader peptide	NA	NA	NA	NA	NA
AZZ26109.1|1635930_1636812_+	phosphatase	NA	NA	NA	NA	NA
AZZ26110.1|1636808_1637429_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AZZ26111.1|1637456_1639352_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AZZ26112.1|1639562_1640438_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AZZ26113.1|1640607_1641609_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26114.1|1641619_1641928_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26115.1|1641979_1642570_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AZZ26116.1|1642566_1643325_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
AZZ26117.1|1643544_1644594_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	2076696	2167529	5425761	terminase,integrase,portal,lysis,tRNA,tail,holin,head,capsid,plate	Enterobacteria_phage(65.96%)	118	2067825:2067839	2116941:2116955
2067825:2067839	attL	TTCAGCGCTGCGCTT	NA	NA	NA	NA
AZZ26496.1|2076696_2077446_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AZZ26497.1|2077445_2077997_-	glutathione peroxidase	NA	NA	NA	NA	NA
AZZ26498.1|2078059_2079040_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AZZ29677.1|2079248_2079578_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26499.1|2079685_2080048_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26500.1|2080050_2080989_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.8	2.3e-81
AZZ26501.1|2081077_2081386_-	transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
AZZ26502.1|2081482_2081761_+	DNA-binding protein	NA	NA	NA	NA	NA
AZZ26503.1|2081775_2082114_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
AZZ26504.1|2082124_2082403_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	5.3e-34
AZZ26505.1|2082414_2082657_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.5e-37
AZZ26506.1|2082854_2083058_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
AZZ26507.1|2083054_2083273_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	50.8	8.6e-08
AZZ26508.1|2083381_2083771_+	inositol monophosphatase	NA	NA	NA	NA	NA
AZZ26509.1|2083767_2086608_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	87.8	0.0e+00
AZZ26510.1|2086684_2087644_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.6e-181
AZZ26511.1|2087648_2087960_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	1.1e-48
AZZ26512.1|2088023_2088407_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	50.7	4.4e-31
AZZ26513.1|2088497_2089028_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26514.1|2088918_2089170_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26515.1|2089558_2090605_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	3.3e-206
AZZ26516.1|2090604_2092356_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
AZZ26517.1|2092510_2093347_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.9e-119
AZZ26518.1|2093370_2094423_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
AZZ26519.1|2094468_2095269_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.5	2.0e-126
AZZ26520.1|2095370_2095865_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	98.8	1.3e-88
AZZ26521.1|2095864_2096065_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AZZ26522.1|2096067_2096391_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AZZ26523.1|2096387_2096780_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AZZ26524.1|2096776_2097184_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	2.2e-65
AZZ29678.1|2097155_2097335_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26525.1|2097321_2097789_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
AZZ26526.1|2097781_2098417_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	7.6e-113
AZZ26527.1|2098413_2098995_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.4	2.0e-99
AZZ26528.1|2098991_2099342_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AZZ26529.1|2099345_2100242_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	2.3e-155
AZZ26530.1|2100234_2100765_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	2.8e-92
AZZ26531.1|2100767_2102957_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.7	3.6e-109
AZZ26532.1|2102956_2103574_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
AZZ26533.1|2103537_2104083_-	transferase	NA	NA	NA	NA	NA
AZZ26534.1|2104271_2104766_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AZZ26535.1|2104772_2107580_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.0	0.0e+00
AZZ26536.1|2107566_2107803_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AZZ26537.1|2107730_2108105_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	74.0	3.1e-37
AZZ26538.1|2108160_2108673_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AZZ26539.1|2108672_2109857_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
AZZ26540.1|2110014_2111112_+	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	5.6e-204
AZZ29679.1|2111242_2112388_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26541.1|2112604_2112865_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26542.1|2113055_2113196_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AZZ26543.1|2113501_2113801_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AZZ26544.1|2113805_2116193_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZZ26545.1|2116207_2117191_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.4	1.7e-34
2116941:2116955	attR	TTCAGCGCTGCGCTT	NA	NA	NA	NA
AZZ29680.1|2117329_2117374_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AZZ26546.1|2117496_2117853_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AZZ26547.1|2117906_2118104_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AZZ26548.1|2118200_2118743_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AZZ26549.1|2118746_2120675_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
AZZ26550.1|2121413_2123156_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29681.1|2123637_2123931_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26551.1|2123973_2125014_-	peptidase S74	NA	A0A0E3M4A9	Enterobacteria_phage	66.1	3.0e-122
AZZ26552.1|2125023_2125305_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
AZZ26553.1|2125304_2127680_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
AZZ26554.1|2127744_2128344_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	88.9	1.0e-98
AZZ26555.1|2128411_2131810_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
AZZ26556.1|2131870_2132542_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.2	1.3e-102
AZZ26557.1|2132439_2133183_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	1.7e-151
AZZ26558.1|2133188_2133887_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
AZZ26559.1|2133886_2134216_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
AZZ26560.1|2134212_2136774_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.5	0.0e+00
AZZ26561.1|2136766_2137201_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
AZZ26562.1|2137182_2137605_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
AZZ29682.1|2137620_2138361_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	4.7e-130
AZZ26563.1|2138368_2138764_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AZZ26564.1|2138760_2139339_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
AZZ26565.1|2139350_2139704_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
AZZ26566.1|2139715_2140111_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
AZZ26567.1|2140152_2141178_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	96.8	7.6e-187
AZZ26568.1|2141232_2141565_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AZZ26569.1|2141574_2142894_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
AZZ26570.1|2142874_2144476_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.2e-309
AZZ26571.1|2144472_2144679_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZZ26572.1|2144675_2146601_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AZZ26573.1|2146575_2147121_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AZZ26574.1|2147789_2148083_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AZZ26575.1|2148114_2148576_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	99.3	2.4e-76
AZZ26576.1|2148572_2149070_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
AZZ26577.1|2149069_2149285_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AZZ26578.1|2149473_2150214_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ26579.1|2150556_2151516_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AZZ26580.1|2151708_2152233_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AZZ26581.1|2152388_2152766_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AZZ26582.1|2152851_2152992_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AZZ26583.1|2153348_2153639_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
AZZ26584.1|2153631_2153802_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
AZZ26585.1|2153801_2154257_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
AZZ26586.1|2154253_2154355_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26587.1|2154471_2155269_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ26588.1|2155278_2155830_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AZZ26589.1|2156294_2157821_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
AZZ26590.1|2158075_2158408_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AZZ26591.1|2158475_2158778_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AZZ26592.1|2158774_2159476_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
AZZ26593.1|2159472_2160492_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AZZ26594.1|2160488_2161028_-	regulator	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
AZZ26595.1|2161097_2161328_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AZZ26596.1|2161366_2162122_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AZZ26597.1|2162717_2162924_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.1	3.5e-27
AZZ26598.1|2162999_2163296_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
AZZ26599.1|2163301_2164087_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AZZ26600.1|2164083_2164764_+	exonuclease	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
AZZ26601.1|2164760_2164943_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
AZZ26602.1|2164915_2165107_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AZZ26603.1|2165117_2165399_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AZZ26604.1|2165497_2165716_+	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AZZ26605.1|2165763_2166042_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
AZZ26606.1|2166132_2166363_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	55.7	2.9e-14
AZZ26607.1|2166320_2167529_-	DUF4102 domain-containing protein	NA	I6R9B6	Salmonella_phage	74.9	4.7e-180
>prophage 7
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	2275598	2362189	5425761	terminase,portal,tRNA,tail,holin,head,capsid,transposase,protease	Enterobacteria_phage(34.38%)	107	NA	NA
AZZ26721.1|2275598_2276480_-|protease	protease HtpX	protease	NA	NA	NA	NA
AZZ26722.1|2276671_2278720_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
AZZ26723.1|2278739_2279438_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AZZ26724.1|2279534_2280032_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AZZ26725.1|2280161_2281445_+	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
AZZ26726.1|2281413_2284047_+	MCE family protein	NA	NA	NA	NA	NA
AZZ29687.1|2284126_2285566_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AZZ26727.1|2285683_2285920_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AZZ29688.1|2286024_2286216_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZZ26728.1|2286216_2286873_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.1	1.2e-55
AZZ26729.1|2287268_2287610_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AZZ26730.1|2287622_2288495_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26731.1|2288498_2288873_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AZZ26732.1|2289011_2289242_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AZZ26733.1|2289343_2290000_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AZZ26734.1|2290023_2290686_+	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AZZ26735.1|2290682_2292743_-	oligopeptidase B	NA	NA	NA	NA	NA
AZZ26736.1|2292899_2293325_-|transposase	IS200/IS605 family transposase ISEc46	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
AZZ26737.1|2293381_2294551_+|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	99.0	1.7e-203
AZZ26738.1|2294714_2295374_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AZZ26739.1|2295700_2296057_-	protein YebF	NA	NA	NA	NA	NA
AZZ26740.1|2296123_2296414_-	damage-inducible protein YebG	NA	NA	NA	NA	NA
AZZ26741.1|2296547_2297726_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AZZ26742.1|2297780_2298422_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AZZ26743.1|2298458_2300270_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AZZ26744.1|2300504_2301980_-	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
AZZ26745.1|2302317_2303187_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ26746.1|2303314_2304757_+	pyruvate kinase	NA	NA	NA	NA	NA
AZZ26747.1|2304888_2305860_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AZZ26748.1|2305979_2307302_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AZZ29689.1|2307317_2308250_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ26749.1|2308328_2309084_+	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AZZ26750.1|2309080_2309866_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AZZ26751.1|2310015_2311026_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AZZ26752.1|2311034_2311646_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZZ29690.1|2311784_2311850_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26753.1|2311920_2312523_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26754.1|2312524_2313046_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AZZ26755.1|2313080_2313821_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZZ26756.1|2313849_2314302_-	NUDIX pyrophosphatase	NA	NA	NA	NA	NA
AZZ26757.1|2314419_2316192_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AZZ26758.1|2316501_2317068_+	hydrolase	NA	NA	NA	NA	NA
AZZ26759.1|2317149_2317266_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
AZZ26760.1|2317422_2317671_+	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
AZZ26761.1|2317788_2318076_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26762.1|2318085_2318364_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
AZZ26763.1|2318360_2320427_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	63.2	4.3e-149
AZZ26764.1|2320491_2321091_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.5	2.7e-107
AZZ26765.1|2321158_2324854_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	73.3	0.0e+00
AZZ26766.1|2324914_2325586_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.3	1.7e-102
AZZ26767.1|2325483_2326227_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.2e-149
AZZ26768.1|2326231_2326930_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	1.2e-130
AZZ26769.1|2326929_2327271_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
AZZ26770.1|2327263_2330491_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	92.7	0.0e+00
AZZ29691.1|2330537_2330798_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.8	7.1e-41
AZZ26771.1|2330839_2331226_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AZZ26772.1|2331225_2331930_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	93.6	4.1e-115
AZZ26773.1|2331989_2332334_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.8e-55
AZZ26774.1|2332330_2332780_-	hypothetical protein	NA	S4TR46	Salmonella_phage	81.9	2.7e-64
AZZ26775.1|2332776_2333115_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	89.3	1.7e-50
AZZ26776.1|2333123_2333441_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
AZZ26777.1|2333517_2334735_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AZZ26778.1|2334749_2335349_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AZZ26779.1|2335341_2336568_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
AZZ26780.1|2336715_2338473_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
AZZ26781.1|2338472_2338955_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	2.5e-84
AZZ26782.1|2339102_2339453_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
AZZ26783.1|2339591_2340131_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26784.1|2340136_2340403_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26785.1|2340620_2340806_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
AZZ26786.1|2341022_2341556_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
AZZ26787.1|2341619_2341970_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AZZ26788.1|2341974_2342190_-|holin	holin	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
AZZ26789.1|2342931_2343981_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.4	4.1e-188
AZZ26790.1|2344132_2344330_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AZZ26791.1|2344545_2344926_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
AZZ26792.1|2344943_2345933_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.1e-193
AZZ26793.1|2345985_2346243_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	68.8	6.2e-21
AZZ26794.1|2346239_2347640_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	1.4e-244
AZZ26795.1|2347636_2348536_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
AZZ26796.1|2348546_2349539_-	replication protein	NA	Q8W642	Enterobacteria_phage	96.4	4.6e-56
AZZ26797.1|2349535_2349835_-	transcriptional regulator	NA	NA	NA	NA	NA
AZZ26798.1|2349831_2350056_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26799.1|2350052_2350247_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26800.1|2350243_2351095_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	66.5	3.1e-93
AZZ26801.1|2351203_2351911_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	91.1	3.9e-118
AZZ26802.1|2351907_2352135_-	hypothetical protein	NA	Q8W647	Enterobacteria_phage	91.0	4.9e-30
AZZ26803.1|2352246_2352903_+	LexA family transcriptional repressor	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
AZZ26804.1|2353006_2353423_+	transcriptional regulator	NA	Q8W649	Enterobacteria_phage	93.5	4.6e-66
AZZ26805.1|2353419_2353662_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26806.1|2353591_2353819_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ26807.1|2354157_2354364_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	97.1	6.9e-31
AZZ26808.1|2354559_2354919_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.6	3.2e-39
AZZ26809.1|2354918_2355134_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	63.4	1.2e-17
AZZ26810.1|2355105_2355324_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	73.6	4.0e-21
AZZ26811.1|2355320_2355713_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.1	1.4e-35
AZZ26812.1|2355773_2355962_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26813.1|2355958_2356786_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	97.8	4.5e-129
AZZ26814.1|2356827_2357199_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	96.7	9.4e-63
AZZ26815.1|2357230_2357473_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	95.0	1.4e-35
AZZ26816.1|2357476_2357623_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
AZZ26817.1|2357631_2357868_+	excisionase	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
AZZ26818.1|2357923_2359237_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	9.2e-246
AZZ26819.1|2359218_2359989_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.9	5.7e-70
AZZ26820.1|2360041_2360437_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ26821.1|2360477_2361221_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AZZ26822.1|2361217_2362189_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 8
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	2684761	2694204	5425761		Enterobacteria_phage(85.71%)	10	NA	NA
AZZ27094.1|2684761_2685898_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
AZZ27095.1|2685894_2687895_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AZZ27096.1|2688019_2688481_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AZZ27097.1|2688522_2688993_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
AZZ27098.1|2689039_2689759_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZZ27099.1|2689755_2691441_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AZZ27100.1|2691662_2692394_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AZZ27101.1|2692453_2692561_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ27102.1|2692541_2693273_-	ABC transporter permease	NA	NA	NA	NA	NA
AZZ27103.1|2693277_2694204_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 9
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	3053447	3145376	5425761	terminase,integrase,tRNA,tail,holin,transposase,protease	Escherichia_phage(50.0%)	95	3109887:3109902	3142115:3142130
AZZ27422.1|3053447_3055463_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
AZZ27423.1|3055477_3056341_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
AZZ27424.1|3056508_3057222_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
AZZ27425.1|3057434_3058469_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AZZ27426.1|3058485_3059364_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZZ27427.1|3059509_3060082_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
AZZ27428.1|3060081_3060552_+	peroxiredoxin	NA	NA	NA	NA	NA
AZZ27429.1|3060804_3061422_+	hydrogenase-4 F-S subunit	NA	NA	NA	NA	NA
AZZ27430.1|3061421_3063440_+	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
AZZ27431.1|3063450_3064398_+	hydrogenase 3 membrane subunit	NA	NA	NA	NA	NA
AZZ27432.1|3064414_3065854_+	hydrogenase 4 subunit D	NA	NA	NA	NA	NA
AZZ27433.1|3065865_3066516_+	hydrogenase 4 membrane subunit	NA	NA	NA	NA	NA
AZZ27434.1|3066520_3068101_+	hydrogenase 4 subunit F	NA	NA	NA	NA	NA
AZZ27435.1|3068090_3069806_+	hydrogenase large subunit	NA	NA	NA	NA	NA
AZZ27436.1|3069815_3070361_+	hydrogenase 4 subunit H	NA	NA	NA	NA	NA
AZZ27437.1|3070357_3071116_+	NADH-quinone oxidoreductase subunit NuoB	NA	NA	NA	NA	NA
AZZ27438.1|3071108_3071522_+	formate hydrogenlyase maturation protein HycH	NA	NA	NA	NA	NA
AZZ27439.1|3071551_3073564_+	hydrogenase	NA	NA	NA	NA	NA
AZZ27440.1|3073585_3074434_+	formate transporter	NA	NA	NA	NA	NA
AZZ27441.1|3074471_3075533_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZZ27442.1|3075745_3077209_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AZZ27443.1|3077229_3077589_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AZZ27444.1|3077694_3078441_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AZZ27445.1|3078490_3079780_-	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
AZZ27446.1|3079865_3080492_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZZ27447.1|3080612_3080798_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ27448.1|3080816_3081854_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AZZ27449.1|3081853_3082492_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.9	9.0e-29
AZZ27450.1|3082662_3084729_+	polyphosphate kinase	NA	NA	NA	NA	NA
AZZ27451.1|3084733_3086275_+	exopolyphosphatase	NA	NA	NA	NA	NA
AZZ27452.1|3086313_3088557_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AZZ27453.1|3088738_3088891_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AZZ27454.1|3088908_3089100_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AZZ27455.1|3089161_3089308_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AZZ27456.1|3089410_3089929_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AZZ27457.1|3089944_3090484_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.3	3.2e-43
AZZ27458.1|3090680_3091178_-	DUF2514 domain-containing protein	NA	A0A193GYU6	Enterobacter_phage	66.5	1.0e-48
AZZ27459.1|3091174_3091804_-	endolysin	NA	G9L6E8	Escherichia_phage	95.7	5.8e-113
AZZ27460.1|3091793_3092102_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	96.1	4.2e-48
AZZ27461.1|3092088_3092493_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
AZZ27462.1|3092715_3093000_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ27463.1|3095545_3095803_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
AZZ27464.1|3095824_3096553_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ27465.1|3097482_3098745_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AZZ27466.1|3099000_3099876_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AZZ27467.1|3099922_3100255_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AZZ27468.1|3102576_3103281_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ27469.1|3104474_3105017_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AZZ27470.1|3105029_3105890_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AZZ27471.1|3105996_3106701_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ27472.1|3107910_3108015_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ27473.1|3108011_3108476_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AZZ27474.1|3108695_3109349_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZZ27475.1|3109501_3109816_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	100.0	2.2e-52
3109887:3109902	attL	TATTACCTTAAAGGTA	NA	NA	NA	NA
AZZ27476.1|3109945_3110272_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ27477.1|3110258_3110771_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ27478.1|3110852_3111014_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AZZ27479.1|3111043_3111895_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ27480.1|3111896_3115286_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.9	1.4e-184
AZZ27481.1|3115285_3118033_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.7	2.4e-118
AZZ27482.1|3118032_3118608_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	94.7	1.2e-80
AZZ27483.1|3118607_3119072_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
AZZ27484.1|3119071_3121543_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.7	0.0e+00
AZZ27485.1|3121542_3122148_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	100.0	2.1e-112
AZZ27486.1|3122147_3122471_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	100.0	2.4e-54
AZZ27487.1|3122521_3122857_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AZZ27488.1|3122867_3123305_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.2	5.0e-71
AZZ27489.1|3123356_3124343_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	94.5	3.3e-179
AZZ27490.1|3124357_3125053_-	peptidase	NA	G9L6C4	Escherichia_phage	98.7	8.7e-94
AZZ27491.1|3125055_3125352_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AZZ27492.1|3125348_3127028_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.1e-302
AZZ27493.1|3127042_3127249_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AZZ27494.1|3127952_3128375_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ27495.1|3128465_3129941_-|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	3.8e-296
AZZ27496.1|3129937_3130612_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
AZZ27497.1|3130652_3130991_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	1.4e-49
AZZ27498.1|3131105_3131906_-	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	66.7	3.2e-47
AZZ27499.1|3131907_3132723_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	96.4	1.3e-141
AZZ27500.1|3132719_3133283_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	74.9	7.3e-67
AZZ27501.1|3133344_3133689_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	1.5e-59
AZZ27502.1|3133806_3134592_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
AZZ27503.1|3134588_3135404_-	primosomal protein	NA	Q286X4	Escherichia_phage	93.5	3.4e-113
AZZ27504.1|3135419_3135620_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
AZZ27505.1|3135770_3136001_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AZZ27506.1|3136155_3136740_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	3.5e-104
AZZ27507.1|3137048_3137348_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	99.0	9.9e-47
AZZ27508.1|3137344_3138244_+	endonuclease	NA	Q858E0	Salmonella_phage	90.6	1.6e-156
AZZ27509.1|3138253_3139276_+	recombinase RecT	NA	Q858E1	Salmonella_phage	92.9	7.1e-177
AZZ27510.1|3139325_3139574_+	transcriptional regulator	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AZZ29719.1|3139731_3139983_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	97.6	2.6e-40
AZZ27511.1|3139975_3140626_+	adenine methylase	NA	G9L699	Escherichia_phage	98.1	8.1e-126
AZZ27512.1|3140622_3140817_+	hypothetical protein	NA	G9L698	Escherichia_phage	96.9	2.8e-26
AZZ27513.1|3140820_3142071_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	98.6	5.7e-237
AZZ27514.1|3142263_3143841_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
3142115:3142130	attR	TACCTTTAAGGTAATA	NA	NA	NA	NA
AZZ27515.1|3143909_3145376_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 10
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	3379721	3386861	5425761		Escherichia_phage(83.33%)	6	NA	NA
AZZ27730.1|3379721_3382283_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
AZZ27731.1|3382388_3383045_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AZZ27732.1|3383095_3383863_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AZZ27733.1|3384058_3384967_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AZZ27734.1|3384963_3386226_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	3.7e-135
AZZ27735.1|3386222_3386861_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 11
CP025573	Escherichia coli strain E-1246 chromosome, complete genome	5425761	5306598	5363842	5425761	integrase,transposase	Escherichia_phage(52.94%)	57	5306547:5306606	5339111:5339930
5306547:5306606	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AZZ29468.1|5306598_5307303_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ29816.1|5307371_5308523_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29469.1|5308532_5309300_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29470.1|5309296_5309554_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
AZZ29471.1|5309618_5310479_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29472.1|5310546_5311725_+	MFS transporter	NA	NA	NA	NA	NA
AZZ29473.1|5311737_5312292_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	4.6e-37
AZZ29474.1|5312541_5313225_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29475.1|5313221_5313683_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29476.1|5313695_5314868_+	isoaspartyl dipeptidase	NA	NA	NA	NA	NA
AZZ29477.1|5314932_5315844_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ29478.1|5316269_5316653_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
AZZ29479.1|5317066_5317840_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ29480.1|5318054_5319515_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
AZZ29481.1|5319595_5320780_-	mannonate dehydratase	NA	NA	NA	NA	NA
AZZ29482.1|5320731_5321040_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ29483.1|5321119_5322463_+	gluconate permease	NA	NA	NA	NA	NA
AZZ29484.1|5322704_5323607_-	fimbrial protein	NA	NA	NA	NA	NA
AZZ29485.1|5323626_5324130_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZZ29486.1|5324142_5324673_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZZ29487.1|5324682_5327319_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZZ29488.1|5327384_5328110_-	chaperone protein FimC	NA	NA	NA	NA	NA
AZZ29489.1|5328152_5328692_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZZ29490.1|5328756_5329305_-	type-1 fimbrial protein subunit A	NA	NA	NA	NA	NA
AZZ29491.1|5329491_5329707_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29492.1|5329785_5330382_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
AZZ29493.1|5330859_5331462_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.3	1.3e-53
AZZ29494.1|5331721_5332129_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29495.1|5332409_5332559_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ29496.1|5332925_5333642_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
AZZ29497.1|5333661_5334768_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
AZZ29498.1|5334832_5335813_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	57.2	6.1e-101
AZZ29499.1|5337184_5337889_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ29500.1|5337947_5338595_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	98.6	1.9e-127
AZZ29501.1|5339162_5339867_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ29502.1|5340012_5340873_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
5339111:5339930	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
AZZ29503.1|5340967_5341258_-	alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	41.8	5.2e-08
AZZ29504.1|5341352_5342537_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AZZ29505.1|5342632_5343289_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ29506.1|5343300_5344005_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZZ29507.1|5344175_5345456_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
AZZ29508.1|5345640_5346561_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	51.7	2.2e-60
AZZ29509.1|5346690_5346861_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ29510.1|5347244_5347583_-	endoribonuclease SymE	NA	NA	NA	NA	NA
AZZ29511.1|5347797_5351061_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.8	1.5e-47
AZZ29512.1|5351155_5352466_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZZ29513.1|5352455_5354075_-	DNA methyltransferase	NA	A0A2H4UVW8	Bodo_saltans_virus	22.4	8.5e-07
AZZ29514.1|5354138_5355305_-	restriction endonuclease	NA	NA	NA	NA	NA
AZZ29515.1|5355400_5355610_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29516.1|5355606_5355909_+	toxin-antitoxin system, antitoxin component	NA	NA	NA	NA	NA
AZZ29517.1|5355942_5356899_-	GTPase	NA	NA	NA	NA	NA
AZZ29518.1|5356909_5357113_-	DUF466 domain-containing protein	NA	NA	NA	NA	NA
AZZ29519.1|5357230_5359381_-	carbon starvation protein A	NA	NA	NA	NA	NA
AZZ29817.1|5359425_5359599_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ29520.1|5359757_5361422_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
AZZ29521.1|5361470_5362832_-	MFS transporter	NA	NA	NA	NA	NA
AZZ29522.1|5363137_5363842_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	0	14644	129195	transposase	Burkholderia_virus(20.0%)	11	NA	NA
AZZ29822.1|240_1260_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AZZ29823.1|1234_2266_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZZ29824.1|2371_3766_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.8	1.7e-35
AZZ29825.1|4367_4748_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZZ29826.1|5613_7233_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	25.0	2.8e-10
AZZ29827.1|7489_8941_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AZZ29944.1|8933_10112_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AZZ29828.1|10233_10380_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	86.2	2.4e-06
AZZ29829.1|10345_11559_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	3.2e-168
AZZ29830.1|12267_13578_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ29831.1|13570_14644_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
>prophage 2
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	25755	29190	129195		Macacine_betaherpesvirus(33.33%)	4	NA	NA
AZZ29846.1|25755_26496_+	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AZZ29847.1|26774_27752_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
AZZ29848.1|28061_28550_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ29849.1|28764_29190_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
>prophage 3
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	35431	40731	129195	integrase	Escherichia_phage(40.0%)	7	31181:31199	42893:42911
31181:31199	attL	AAGCGTCAATACGGTGCTC	NA	NA	NA	NA
AZZ29854.1|35431_36241_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
AZZ29855.1|36378_36654_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AZZ29856.1|36647_37292_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
AZZ29857.1|37520_38492_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	43.3	3.3e-67
AZZ29858.1|38460_38889_+	plasmid stability protein	NA	NA	NA	NA	NA
AZZ29859.1|40048_40486_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	47.6	1.6e-24
AZZ29860.1|40482_40731_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
42893:42911	attR	AAGCGTCAATACGGTGCTC	NA	NA	NA	NA
>prophage 4
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	60897	61525	129195	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
AZZ29870.1|60897_61134_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	63.8	2.0e-18
AZZ29871.1|61190_61283_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AZZ29952.1|61276_61525_-|transposase	IS3 family transposase	transposase	A0A0N7BVE9	Escherichia_phage	83.8	4.0e-25
>prophage 5
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	64980	65610	129195		Planktothrix_phage(100.0%)	1	NA	NA
AZZ29875.1|64980_65610_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	1.2e-20
>prophage 6
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	70462	74032	129195		Stx2-converting_phage(66.67%)	4	NA	NA
AZZ29878.1|70462_71020_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	90.8	1.6e-85
AZZ29879.1|71801_72794_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29880.1|73010_73688_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	33.1	1.5e-10
AZZ29881.1|73684_74032_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	1.2e-43
>prophage 7
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	78133	80380	129195		Thalassomonas_phage(33.33%)	7	NA	NA
AZZ29885.1|78133_78697_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	3.6e-21
AZZ29886.1|78696_78927_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29954.1|78848_79097_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29887.1|79147_79342_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ29888.1|79268_79505_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ29889.1|79530_80091_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	58.3	1.2e-48
AZZ29890.1|80119_80380_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.9e-06
>prophage 8
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	85211	86117	129195		Yersinia_phage(100.0%)	1	NA	NA
AZZ29896.1|85211_86117_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.8e-44
>prophage 9
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	94076	94298	129195		Vibrio_virus(100.0%)	1	NA	NA
AZZ29909.1|94076_94298_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
>prophage 10
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	119442	120189	129195		Xanthomonas_phage(100.0%)	1	NA	NA
AZZ29931.1|119442_120189_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
>prophage 11
CP025574	Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence	129195	125349	126189	129195		Vibrio_phage(100.0%)	1	NA	NA
AZZ29941.1|125349_126189_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	38.0	1.8e-24
