The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025428	Lactobacillus rhamnosus strain LR-B1 chromosome, complete genome	3007503	405873	526329	3007503	transposase	Faecalibacterium_phage(15.0%)	102	NA	NA
AZZ22084.1|405873_406890_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
AZZ22085.1|408035_408893_+	transketolase	NA	NA	NA	NA	NA
AZZ22086.1|408885_409902_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
AZZ22087.1|410093_410948_+	fructokinase	NA	NA	NA	NA	NA
AZZ22088.1|410997_411756_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AZZ22089.1|411996_412470_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AZZ22090.1|412474_412804_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
AZZ22091.1|412828_413935_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
AZZ22092.1|414098_415115_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
AZZ22093.1|415195_416011_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZZ22094.1|416032_416926_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZZ22095.1|417470_417947_-	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
AZZ22096.1|417918_418347_-	PTS mannose transporter subunit IIB	NA	NA	NA	NA	NA
AZZ22097.1|418364_420053_-	PTS mannose transporter subunit IICD	NA	NA	NA	NA	NA
AZZ22098.1|420092_420803_-	transaldolase	NA	NA	NA	NA	NA
AZZ22099.1|420994_422038_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZZ22100.1|422276_423191_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ22101.1|423223_423574_+	PRD domain-containing protein	NA	NA	NA	NA	NA
AZZ22102.1|423575_423938_+	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
AZZ22103.1|423998_425294_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22104.1|425323_426208_+	phosphotriesterase-related protein	NA	NA	NA	NA	NA
AZZ22105.1|426200_427307_+	aminotransferase	NA	NA	NA	NA	NA
AZZ22106.1|427297_428470_+	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
AZZ22107.1|428471_429701_+	phosphopentomutase	NA	NA	NA	NA	NA
AZZ22108.1|430028_430865_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AZZ22109.1|430947_431508_+	DUF3816 family protein	NA	NA	NA	NA	NA
AZZ22110.1|431509_433210_+	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	3.8e-18
AZZ22111.1|433206_434034_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AZZ22112.1|434057_434354_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22113.1|434385_435519_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
AZZ22114.1|436348_438163_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AZZ22115.1|438632_439544_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	8.4e-20
AZZ22116.1|439885_440536_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
AZZ22117.1|440541_440826_+	cytosolic protein	NA	NA	NA	NA	NA
AZZ22118.1|441564_441780_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22119.1|441903_442302_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AZZ22120.1|442772_443852_-	class C sortase	NA	NA	NA	NA	NA
AZZ22121.1|443925_444930_-	pilus assembly protein	NA	NA	NA	NA	NA
AZZ22122.1|444932_445658_-	pilus assembly protein	NA	NA	NA	NA	NA
AZZ22123.1|445650_448338_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AZZ22124.1|448478_449495_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	1.2e-35
AZZ22125.1|450173_450731_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22126.1|451769_453557_-	DNA helicase UvrD	NA	U5PSZ2	Bacillus_phage	25.9	1.7e-08
AZZ22127.1|453553_455644_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZZ22128.1|455761_457258_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
AZZ22129.1|457551_457803_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.8	1.1e-35
AZZ22130.1|457808_458648_+	DDE domain-containing protein	NA	Q6J1X2	Lactobacillus_phage	98.9	2.2e-147
AZZ22131.1|458981_459830_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	1.3e-43
AZZ22132.1|460034_460382_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22133.1|460433_460697_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22134.1|460756_463579_-	magnesium-transporting ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.7	3.1e-73
AZZ22135.1|464683_465838_-	cation:proton antiporter	NA	NA	NA	NA	NA
AZZ22136.1|466344_467132_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AZZ22137.1|467181_467856_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	1.2e-58
AZZ24443.1|468698_470255_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AZZ22138.1|470605_471526_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
AZZ22139.1|471560_472814_-	MFS transporter	NA	NA	NA	NA	NA
AZZ22140.1|472912_474409_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
AZZ22141.1|474410_475733_-	peptidase M20	NA	NA	NA	NA	NA
AZZ22142.1|477092_480071_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.3	1.5e-147
AZZ22143.1|480103_481585_+	amino acid permease	NA	NA	NA	NA	NA
AZZ22144.1|481732_483190_+	amino acid permease	NA	NA	NA	NA	NA
AZZ22145.1|483457_484312_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ22146.1|484472_486689_+	transcriptional regulator	NA	NA	NA	NA	NA
AZZ22147.1|486922_488122_+	MFS transporter	NA	NA	NA	NA	NA
AZZ22148.1|488145_489576_+	amidohydrolase	NA	NA	NA	NA	NA
AZZ22149.1|489661_490723_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22150.1|490719_491472_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.9e-22
AZZ22151.1|491481_492360_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ22152.1|492373_493042_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZZ22153.1|493038_493725_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZZ22154.1|494193_494931_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24444.1|495166_495412_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22155.1|495657_496203_+	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
AZZ22156.1|496319_496472_+	YvrJ family protein	NA	NA	NA	NA	NA
AZZ22157.1|496483_497248_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CCE6	Lactobacillus_phage	52.0	2.3e-47
AZZ22158.1|497468_498266_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22159.1|498516_499020_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ22160.1|499027_500089_+	ABC transporter permease	NA	NA	NA	NA	NA
AZZ22161.1|500093_500783_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.8e-28
AZZ22162.1|501071_502442_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.6	1.2e-09
AZZ22163.1|502688_503507_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AZZ22164.1|503629_503902_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AZZ22165.1|504050_504815_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
AZZ24445.1|505224_505653_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22166.1|507486_508905_-|transposase	IS5 family transposase ISLrh3	transposase	NA	NA	NA	NA
AZZ22167.1|509169_509451_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22168.1|509429_510287_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ22169.1|510496_511513_+	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	28.8	8.4e-21
AZZ22170.1|511692_512658_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22171.1|512928_514623_-	oleate hydratase	NA	NA	NA	NA	NA
AZZ24446.1|514634_514763_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22172.1|514851_515418_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ22173.1|515507_515876_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
AZZ22174.1|516151_516733_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AZZ22175.1|516719_517739_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AZZ22176.1|517932_518361_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AZZ22177.1|518819_519503_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	1.1e-24
AZZ22178.1|519509_520682_-	ABC transporter	NA	NA	NA	NA	NA
AZZ22179.1|521081_522578_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
AZZ22180.1|523948_524785_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZZ22181.1|524832_526329_-|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP025428	Lactobacillus rhamnosus strain LR-B1 chromosome, complete genome	3007503	1101691	1150952	3007503	terminase,portal,integrase,tail,transposase,holin,head,capsid	Lactobacillus_phage(85.42%)	70	1093876:1093890	1154833:1154847
1093876:1093890	attL	GAAGCCGATCCGGAA	NA	NA	NA	NA
AZZ22692.1|1101691_1102876_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	7.3e-226
AZZ22693.1|1103046_1103253_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22694.1|1103220_1104222_-	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	23.3	4.4e-06
AZZ22695.1|1104332_1104536_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	85.1	8.6e-26
AZZ22696.1|1104559_1104985_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	94.3	2.5e-59
AZZ22697.1|1105367_1105589_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22698.1|1105589_1106345_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22699.1|1106451_1107153_-	DUF3862 domain-containing protein	NA	A9D9J1	Lactobacillus_prophage	39.3	5.1e-25
AZZ22700.1|1107212_1107635_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0YA58	Lactobacillus_phage	93.5	5.1e-73
AZZ22701.1|1107624_1107963_-	transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	6.6e-55
AZZ22702.1|1108097_1108340_+	XRE family transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	95.0	4.6e-34
AZZ22703.1|1108336_1108585_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22704.1|1108581_1108809_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ22705.1|1109120_1109669_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	97.8	1.0e-97
AZZ22706.1|1109647_1109878_+	DNA-binding protein	NA	A0A1B0Y6A3	Lactobacillus_phage	98.6	5.5e-37
AZZ22707.1|1110021_1110249_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22708.1|1110455_1111331_+	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	52.2	5.7e-58
AZZ22709.1|1111350_1112115_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	54.0	4.0e-76
AZZ22710.1|1112130_1113087_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	90.9	2.0e-128
AZZ22711.1|1113099_1113585_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	86.3	8.8e-61
AZZ22712.1|1113602_1113818_+	XRE family transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	91.4	6.1e-30
AZZ22713.1|1113814_1114006_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZZ22714.1|1114375_1114825_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	93.2	6.2e-69
AZZ22715.1|1114871_1115126_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	94.0	4.6e-37
AZZ22716.1|1115122_1115524_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	71.5	2.6e-50
AZZ22717.1|1115536_1116001_+	endonuclease	NA	A0A0P0IXF6	Lactobacillus_phage	98.0	7.2e-20
AZZ22718.1|1116012_1116198_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	88.5	5.1e-25
AZZ22719.1|1116194_1116701_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	72.9	8.6e-59
AZZ22720.1|1116690_1116870_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22721.1|1116856_1117060_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22722.1|1117049_1117481_+	hypothetical protein	NA	C1KFE8	Lactobacillus_virus	69.9	1.1e-49
AZZ24479.1|1117474_1117840_+	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	58.0	3.2e-31
AZZ22723.1|1117836_1118076_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22724.1|1118125_1118308_+	hypothetical protein	NA	A0A0P0I365	Lactobacillus_phage	61.7	1.6e-15
AZZ24480.1|1118313_1118385_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22725.1|1118602_1119031_+	transcriptional regulator	NA	NA	NA	NA	NA
AZZ22726.1|1120058_1121207_+	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	98.7	2.4e-221
AZZ22727.1|1121219_1121762_+	endonuclease	NA	B4XYU1	Lactobacillus_phage	100.0	1.1e-107
AZZ22728.1|1121754_1122075_+	ribonucleoside-diphosphate reductase	NA	A8YQN5	Lactobacillus_phage	92.4	9.0e-54
AZZ22729.1|1122111_1122645_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	94.1	2.7e-63
AZZ22730.1|1122622_1123978_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	59.1	4.9e-149
AZZ22731.1|1123982_1125410_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	90.6	2.7e-243
AZZ22732.1|1125375_1126368_+|head	phage head morphogenesis protein	head	A0A0P0ID43	Lactobacillus_phage	95.5	6.2e-178
AZZ22733.1|1126492_1127149_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	80.0	4.3e-58
AZZ22734.1|1127164_1128178_+|capsid	capsid protein	capsid	A0A0A7RVZ1	Clostridium_phage	26.5	3.1e-23
AZZ22735.1|1128405_1128780_+	hypothetical protein	NA	A0A0P0IZF6	Lactobacillus_phage	91.9	3.2e-58
AZZ22736.1|1128784_1129087_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	93.0	6.3e-49
AZZ22737.1|1129083_1129449_+|tail	phage tail protein	tail	A0A0P0IUZ3	Lactobacillus_phage	96.7	2.0e-57
AZZ22738.1|1129449_1129854_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	98.5	3.0e-70
AZZ22739.1|1129865_1130468_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.5	2.4e-100
AZZ22740.1|1130554_1130887_+	hypothetical protein	NA	A0A0P0IQQ6	Lactobacillus_phage	94.5	2.4e-49
AZZ22741.1|1130991_1131345_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	96.6	5.3e-55
AZZ22742.1|1131337_1134427_+|tail	phage tail tape measure protein	tail	A0A0P0IJD2	Lactobacillus_phage	88.0	1.4e-263
AZZ22743.1|1134429_1136418_+|tail	phage tail protein	tail	B4XYQ4	Lactobacillus_phage	85.9	0.0e+00
AZZ24481.1|1136414_1138925_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	82.6	0.0e+00
AZZ22744.1|1138934_1139258_+	phage infection protein	NA	B4XYQ6	Lactobacillus_phage	98.1	1.1e-51
AZZ22745.1|1139250_1139382_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	97.7	2.5e-18
AZZ22746.1|1139411_1139705_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	94.8	5.3e-45
AZZ22747.1|1139694_1140108_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	97.9	1.4e-43
AZZ22748.1|1140118_1141417_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	99.1	1.2e-232
AZZ22749.1|1142036_1142324_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZZ22750.1|1142619_1143471_-	DNA/RNA endonuclease	NA	NA	NA	NA	NA
AZZ22751.1|1143470_1144214_-	DNA-entry nuclease	NA	NA	NA	NA	NA
AZZ22752.1|1144342_1145506_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AZZ22753.1|1145963_1146881_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AZZ22754.1|1146981_1147449_+	nucleoside deaminase	NA	NA	NA	NA	NA
AZZ22755.1|1148332_1148548_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22756.1|1148935_1149130_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22757.1|1149397_1149592_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ22758.1|1149713_1150952_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
1154833:1154847	attR	TTCCGGATCGGCTTC	NA	NA	NA	NA
>prophage 3
CP025428	Lactobacillus rhamnosus strain LR-B1 chromosome, complete genome	3007503	1494702	1594655	3007503	terminase,portal,tRNA,integrase,tail,transposase,holin,head,capsid	Lactobacillus_phage(36.11%)	99	1527486:1527545	1562098:1562258
AZZ23073.1|1494702_1496001_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	28.2	2.9e-50
AZZ23074.1|1496024_1497200_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AZZ23075.1|1497252_1497744_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23076.1|1497821_1498004_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23077.1|1498018_1500820_-	DNA helicase	NA	A0A1X9I5C8	Streptococcus_phage	33.3	1.1e-54
AZZ23078.1|1500863_1504574_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	22.2	6.4e-18
AZZ23079.1|1504570_1508110_-	ATP-dependent helicase	NA	NA	NA	NA	NA
AZZ23080.1|1508524_1509460_+	mevalonate kinase	NA	NA	NA	NA	NA
AZZ23081.1|1509467_1510472_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
AZZ23082.1|1510437_1511472_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AZZ23083.1|1511578_1512910_-	RNA methyltransferase	NA	NA	NA	NA	NA
AZZ23084.1|1512896_1513853_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23085.1|1513849_1514032_-	alpha-galactosidase	NA	NA	NA	NA	NA
AZZ23086.1|1514054_1514798_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZZ23087.1|1514913_1515264_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
AZZ24502.1|1515297_1515486_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AZZ23088.1|1515693_1515828_-	Malolactic regulator	NA	NA	NA	NA	NA
AZZ23089.1|1515943_1517449_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZZ23090.1|1517414_1519145_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	24.3	1.5e-06
AZZ23091.1|1519519_1520314_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AZZ23092.1|1520300_1521011_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZZ23093.1|1521199_1522450_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	1.1e-38
AZZ23094.1|1522463_1524233_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.4	8.2e-56
AZZ23095.1|1524418_1526488_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZZ23096.1|1526489_1527386_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
1527486:1527545	attL	TGCGCGGTTCCACCCTACTTCAGATAGACCGAATCTACCTGCAGCTTTGTCATTTGGTTC	NA	NA	NA	NA
AZZ23097.1|1527791_1528961_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	31.8	2.6e-42
AZZ23098.1|1529003_1529330_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZZ23099.1|1529436_1529619_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ23100.1|1530165_1530552_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23101.1|1530742_1531897_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	66.2	9.9e-143
AZZ23102.1|1531899_1532232_-|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	100.0	2.0e-32
AZZ23103.1|1532244_1532478_-	DNA primase	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	2.6e-34
AZZ23104.1|1532502_1532634_-	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.7	4.2e-18
AZZ23105.1|1532626_1532950_-	phage infection protein	NA	B4XYQ6	Lactobacillus_phage	99.1	5.0e-52
AZZ23106.1|1532959_1535893_-|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	68.7	1.1e-311
AZZ23107.1|1535898_1537956_-|tail	phage tail protein	tail	Q6J1X4	Lactobacillus_phage	48.1	1.3e-153
AZZ24503.1|1537956_1542123_-|tail	phage tail protein	tail	A8YQJ9	Lactobacillus_phage	79.4	0.0e+00
AZZ23108.1|1542128_1542359_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	5.0e-38
AZZ23109.1|1542336_1542687_-|tail	phage tail protein	tail	Q6J1X6	Lactobacillus_phage	95.7	2.2e-53
AZZ23110.1|1542841_1543477_-|tail	phage tail protein	tail	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	89.6	9.1e-98
AZZ23111.1|1543477_1543858_-	DUF806 domain-containing protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.9	9.0e-61
AZZ23112.1|1543854_1544274_-|head,tail	head-tail connector protein	head,tail	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.6	1.9e-64
AZZ23113.1|1544276_1544621_-|head,tail	head-tail adaptor protein	head,tail	A8YQJ4	Lactobacillus_phage	85.8	1.1e-49
AZZ23114.1|1544610_1544901_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23115.1|1544972_1546901_-|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	46.1	1.2e-68
AZZ23116.1|1546900_1548001_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	43.6	9.6e-79
AZZ23117.1|1547997_1548180_-	DUF1056 domain-containing protein	NA	NA	NA	NA	NA
AZZ23118.1|1548303_1550196_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.0	3.5e-153
AZZ23119.1|1550189_1550654_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	39.7	3.1e-23
AZZ23120.1|1551135_1551696_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.2	2.5e-35
AZZ23121.1|1552101_1552851_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZZ23122.1|1552916_1554413_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
AZZ23123.1|1554507_1554954_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ23124.1|1555069_1555348_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23125.1|1555340_1555781_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	54.0	9.3e-25
AZZ23126.1|1555879_1556284_-	single-stranded DNA-binding protein	NA	L0P8Q2	Lactobacillus_phage	40.0	1.4e-14
AZZ23127.1|1556270_1557038_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23128.1|1557038_1557245_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23129.1|1557305_1557908_-	hypothetical protein	NA	M1NMU3	Moumouvirus	33.8	5.9e-14
AZZ23130.1|1558293_1559532_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23131.1|1559570_1559798_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23132.1|1562376_1562904_-	N-acetyltransferase	NA	NA	NA	NA	NA
1562098:1562258	attR	TGCGCGGTTCCACCCTACTTCAGATAGACCGAATCTACCTGCAGCTTTGTCATTTGGTTCGAAAACGCCAATCACATTCACCACCATCAGGCTTACACTATCCCTGACTCGCTTGGGTTTGGTACAAATGCGACCCTTTTTCTCATCACCGATTCAATTTC	NA	NA	NA	NA
AZZ23133.1|1563000_1563630_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
AZZ23134.1|1563626_1564340_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.7e-12
AZZ23135.1|1564994_1565306_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23136.1|1565456_1566272_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AZZ23137.1|1566271_1567174_-	GTPase Era	NA	NA	NA	NA	NA
AZZ24504.1|1567170_1567560_-	cytidine deaminase	NA	NA	NA	NA	NA
AZZ23138.1|1567563_1567962_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZZ23139.1|1567945_1568404_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AZZ23140.1|1568407_1569394_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	45.2	3.2e-49
AZZ23141.1|1569960_1570404_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	39.0	9.7e-14
AZZ23142.1|1570422_1570599_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AZZ23143.1|1570871_1571702_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AZZ23144.1|1571698_1572586_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	27.0	2.1e-20
AZZ23145.1|1572733_1573654_-	YitT family protein	NA	NA	NA	NA	NA
AZZ23146.1|1573958_1574405_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AZZ23147.1|1574490_1576296_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AZZ23148.1|1576297_1577581_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AZZ23149.1|1577684_1577906_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ23150.1|1578134_1579643_-	ABC transporter permease	NA	NA	NA	NA	NA
AZZ23151.1|1579639_1580515_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	5.4e-24
AZZ23152.1|1580714_1581161_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ23153.1|1581248_1582571_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	30.2	3.0e-10
AZZ23154.1|1582672_1583299_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AZZ23155.1|1583298_1583745_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AZZ23156.1|1583871_1586097_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.1	3.1e-07
AZZ23157.1|1586401_1586725_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23158.1|1586762_1587491_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AZZ23159.1|1587529_1588474_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AZZ23160.1|1588554_1589049_-	DUF3013 domain-containing protein	NA	NA	NA	NA	NA
AZZ23161.1|1589045_1589651_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AZZ23162.1|1589756_1590005_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ23163.1|1590073_1590460_-	DUF1093 domain-containing protein	NA	NA	NA	NA	NA
AZZ23164.1|1590744_1590924_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24505.1|1590923_1591310_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23165.1|1591727_1592318_-	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
AZZ23166.1|1592320_1592878_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ23167.1|1593158_1594655_+|transposase	IS5-like element ISLrh2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP025428	Lactobacillus rhamnosus strain LR-B1 chromosome, complete genome	3007503	2105605	2112478	3007503		Lactococcus_phage(33.33%)	9	NA	NA
AZZ23600.1|2105605_2106535_-	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	38.1	4.5e-53
AZZ23601.1|2106546_2106873_-	hypothetical protein	NA	Q9AZG1	Lactococcus_phage	39.6	4.8e-10
AZZ23602.1|2107166_2107667_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	29.3	4.7e-09
AZZ23603.1|2107783_2108497_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AZZ23604.1|2108493_2108718_-	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	40.4	4.3e-10
AZZ24532.1|2108998_2109310_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZZ23605.1|2109557_2110196_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AZZ23606.1|2110440_2111424_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	33.0	1.7e-10
AZZ23607.1|2111425_2112478_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-20
>prophage 5
CP025428	Lactobacillus rhamnosus strain LR-B1 chromosome, complete genome	3007503	2404241	2466976	3007503	bacteriocin,protease,portal	Bacillus_phage(30.0%)	59	NA	NA
AZZ23848.1|2404241_2405072_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZZ23849.1|2405085_2406102_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23850.1|2406098_2406485_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ23851.1|2406616_2408245_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZZ23852.1|2408742_2410059_-	internalin	NA	NA	NA	NA	NA
AZZ23853.1|2411159_2412275_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
AZZ23854.1|2412295_2413660_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AZZ23855.1|2413679_2414219_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.0	4.4e-37
AZZ24546.1|2414358_2414484_-	acetyltransferase	NA	NA	NA	NA	NA
AZZ24547.1|2414480_2414663_-	alpha-galactosidase	NA	NA	NA	NA	NA
AZZ23856.1|2414859_2415150_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZZ23857.1|2415444_2416764_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.8	2.3e-63
AZZ23858.1|2416908_2418255_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.5	1.3e-72
AZZ23859.1|2418471_2419572_+	ABC transporter permease	NA	NA	NA	NA	NA
AZZ23860.1|2419571_2420765_+	ABC transporter permease	NA	NA	NA	NA	NA
AZZ23861.1|2420778_2421654_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	2.1e-12
AZZ23862.1|2421805_2423860_+|portal	portal protein	portal	A7K9V6	Acanthocystis_turfacea_chlorella_virus	32.9	2.1e-63
AZZ23863.1|2424066_2426697_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.9	2.8e-84
AZZ23864.1|2426996_2427584_-	CBS domain-containing protein	NA	NA	NA	NA	NA
AZZ23865.1|2427755_2428427_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
AZZ23866.1|2428584_2429703_+	bacitracin ABC transporter permease	NA	NA	NA	NA	NA
AZZ23867.1|2429721_2430006_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AZZ23868.1|2430251_2431367_-	lactate oxidase	NA	NA	NA	NA	NA
AZZ23869.1|2431529_2431739_-	CsbD family protein	NA	NA	NA	NA	NA
AZZ23870.1|2432304_2432493_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23871.1|2432504_2432702_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23872.1|2433496_2433754_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23873.1|2433943_2434150_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23874.1|2434378_2434594_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23875.1|2435163_2436396_+	MFS transporter	NA	NA	NA	NA	NA
AZZ23876.1|2436465_2437722_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.6	6.0e-109
AZZ23877.1|2437802_2438639_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.9	7.4e-47
AZZ23878.1|2439087_2439273_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23879.1|2439849_2440392_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23880.1|2440621_2441446_-	class C sortase	NA	NA	NA	NA	NA
AZZ23881.1|2441452_2443006_-	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
AZZ23882.1|2442996_2444352_-	pilus assembly protein	NA	NA	NA	NA	NA
AZZ23883.1|2444353_2447284_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23884.1|2447579_2448137_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23885.1|2448305_2449514_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AZZ23886.1|2449706_2450762_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
AZZ23887.1|2451054_2451702_+	XRE family transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	38.7	2.2e-06
AZZ23888.1|2451832_2452165_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ23889.1|2452161_2452947_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ23890.1|2452990_2453767_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ23891.1|2453794_2454085_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZZ23892.1|2454212_2455295_+	aldo/keto reductase	NA	NA	NA	NA	NA
AZZ23893.1|2455320_2455503_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23894.1|2455597_2456953_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23895.1|2457129_2457540_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23896.1|2457600_2458980_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
AZZ23897.1|2458992_2461185_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.5	3.6e-37
AZZ23898.1|2461433_2461568_-	peptide pheromone	NA	NA	NA	NA	NA
AZZ23899.1|2461743_2463057_+	ATP-binding protein	NA	NA	NA	NA	NA
AZZ23900.1|2463049_2463838_+	LytR domain-containing response regulator	NA	NA	NA	NA	NA
AZZ24548.1|2464574_2464760_+|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
AZZ23901.1|2465476_2465659_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23902.1|2466181_2466427_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ23903.1|2466676_2466976_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 6
CP025428	Lactobacillus rhamnosus strain LR-B1 chromosome, complete genome	3007503	2930724	2958630	3007503	terminase,portal,integrase,transposase,capsid	Lactobacillus_phage(22.22%)	33	2946345:2946365	2960474:2960494
AZZ24342.1|2930724_2931261_+|transposase	transposase	transposase	NA	NA	NA	NA
AZZ24343.1|2931287_2932106_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	34.1	6.1e-38
AZZ24344.1|2932299_2933694_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AZZ24585.1|2933840_2934416_-	thymidylate synthase	NA	NA	NA	NA	NA
AZZ24345.1|2934529_2934949_-	DUF2992 domain-containing protein	NA	NA	NA	NA	NA
AZZ24346.1|2935232_2935523_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24347.1|2935616_2935865_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24348.1|2937311_2938637_-	malate permease	NA	A0A140XAH4	Dickeya_phage	52.9	2.1e-16
AZZ24349.1|2938783_2940319_+	sensor histidine kinase	NA	NA	NA	NA	NA
AZZ24350.1|2940315_2941005_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
AZZ24586.1|2941190_2941706_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24351.1|2941954_2942347_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24352.1|2942579_2943434_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZZ24587.1|2943756_2944143_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ24353.1|2944327_2945008_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AZZ24354.1|2945186_2946116_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
2946345:2946365	attL	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
AZZ24355.1|2946462_2947620_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	1.3e-46
AZZ24356.1|2947737_2948349_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZZ24357.1|2948463_2948676_+	transcriptional regulator	NA	NA	NA	NA	NA
AZZ24358.1|2948700_2948976_+	DNA-binding protein	NA	NA	NA	NA	NA
AZZ24359.1|2949043_2949265_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24360.1|2949375_2949567_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24361.1|2949611_2949884_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24362.1|2949880_2950069_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24363.1|2950052_2950880_+	DNA replication protein	NA	Q854C1	Mycobacterium_phage	34.9	4.5e-12
AZZ24364.1|2950872_2952297_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	6.6e-64
AZZ24365.1|2952576_2952999_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24366.1|2953029_2953455_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	40.5	7.1e-14
AZZ24367.1|2953579_2954050_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
AZZ24368.1|2954046_2955750_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.6	5.4e-121
AZZ24369.1|2955715_2955895_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ24370.1|2955899_2957084_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.4	2.4e-59
AZZ24371.1|2957070_2958630_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	29.8	3.3e-32
2960474:2960494	attR	CTATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
