The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032666	Streptococcus pyogenes strain MGAS28085 chromosome, complete genome	1851471	36552	48865	1851471		Synechococcus_phage(28.57%)	8	NA	NA
AZZ63491.1|36552_40278_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.3	1.1e-38
AZZ63492.1|40438_41893_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	2.8e-54
AZZ63493.1|41920_42943_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.1	2.4e-63
AZZ63494.1|43110_43665_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
AZZ63495.1|43848_45396_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
AZZ63496.1|45453_46578_-	CHAP domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
AZZ63497.1|46830_48096_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AZZ63498.1|48373_48865_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
CP032666	Streptococcus pyogenes strain MGAS28085 chromosome, complete genome	1851471	781219	880807	1851471	capsid,head,portal,terminase,transposase,tRNA,integrase,tail	Streptococcus_phage(40.91%)	113	801190:801249	847360:847455
AZZ64136.1|781219_781444_-|transposase	transposase	transposase	NA	NA	NA	NA
AZZ64137.1|781763_783023_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZZ64138.1|783188_784892_+	alpha-glycosidase	NA	NA	NA	NA	NA
AZZ64139.1|784917_787053_+	cyclomaltodextrin glucanotransferase	NA	NA	NA	NA	NA
AZZ64140.1|787127_788435_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZZ64141.1|788431_789292_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZZ64142.1|789313_790129_+	maltodextrose utilization protein malA	NA	NA	NA	NA	NA
AZZ64143.1|790244_791045_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AZZ64144.1|791199_792036_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZZ64145.1|792035_793397_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AZZ64146.1|793670_794918_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZZ64147.1|795160_796180_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.8	5.7e-17
AZZ64148.1|796295_797789_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AZZ64149.1|797823_800088_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
AZZ64150.1|800344_800965_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
801190:801249	attL	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGA	NA	NA	NA	NA
AZZ64151.1|801327_802416_-|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	98.6	3.0e-202
AZZ64152.1|802665_803475_-	MazF family toxin-antitoxin system	NA	J7KDP1	Streptococcus_phage	35.8	3.8e-24
AZZ64153.1|803487_804231_-	helix-turn-helix domain-containing protein	NA	A0A1S5S8T5	Streptococcus_phage	62.9	2.5e-75
AZZ64154.1|804723_804939_-	hypothetical protein	NA	J7KBX0	Streptococcus_phage	95.7	2.5e-28
AZZ64155.1|804997_805156_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	90.4	8.4e-21
AZZ64156.1|805185_805785_-	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
AZZ64157.1|805838_806048_+	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
AZZ64158.1|806036_806423_-	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
AZZ64159.1|806496_806724_+	XRE family transcriptional regulator	NA	A0A141E1R7	Streptococcus_phage	57.3	2.9e-14
AZZ64160.1|806831_807341_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ64161.1|807395_807641_+	hypothetical protein	NA	A0A097PAP6	Streptococcus_pyogenes_phage	95.1	1.2e-34
AZZ64162.1|807599_807809_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ64163.1|807958_808198_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ64164.1|808364_808550_+	XRE family transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
AZZ64165.1|808628_808925_+	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
AZZ64166.1|808921_809059_+	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	100.0	3.4e-18
AZZ64167.1|809139_809469_+	hypothetical protein	NA	J7KBZ0	Streptococcus_phage	41.8	7.9e-13
AZZ64168.1|809468_809663_+	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
AZZ64169.1|809659_809944_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ64170.1|809940_810624_+	DNA-binding protein	NA	J7KC09	Streptococcus_phage	99.1	9.4e-125
AZZ64171.1|810659_812063_+	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.3	2.3e-194
AZZ64172.1|812067_812550_+	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	9.7e-60
AZZ64173.1|814387_815257_+	hypothetical protein	NA	A0A1P8BME8	Lactococcus_phage	65.6	5.8e-103
AZZ64174.1|815210_815561_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	88.5	9.9e-46
AZZ64175.1|815544_815901_+	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
AZZ64176.1|815897_816143_+	hypothetical protein	NA	A0A097PBE9	Streptococcus_pyogenes_phage	95.1	2.1e-39
AZZ64177.1|816142_816379_+	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	100.0	2.4e-40
AZZ64178.1|816542_816827_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	86.2	2.6e-36
AZZ64179.1|816828_817461_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	5.1e-85
AZZ65166.1|817465_817945_+	DUF1642 domain-containing protein	NA	A0A141E0J6	Streptococcus_phage	41.9	6.5e-24
AZZ64180.1|818393_818828_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	97.9	6.2e-74
AZZ64181.1|819405_820320_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ64182.1|820338_820800_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ64183.1|820937_821315_-	HicB family protein	NA	I3NLB2	Bifidobacterium_phage	44.0	3.3e-15
AZZ64184.1|821366_821552_-	addiction module toxin, HicA family	NA	D6PSW1	Lactobacillus_phage	54.0	1.7e-09
AZZ65167.1|821614_822082_+|terminase	terminase small subunit	terminase	A0A141E1Y3	Streptococcus_phage	70.8	1.1e-52
AZZ64185.1|822059_823367_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	75.7	2.0e-184
AZZ64186.1|823378_824881_+|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.5	1.9e-141
AZZ64187.1|824861_826424_+|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	44.2	2.5e-48
AZZ64188.1|826427_826613_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ64189.1|826682_826997_+	hypothetical protein	NA	M1PLI3	Streptococcus_phage	72.8	6.8e-38
AZZ64190.1|826999_827266_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	70.5	1.9e-25
AZZ64191.1|827409_827943_+	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	80.7	6.8e-14
AZZ64192.1|827952_828333_+|head	head decoration protein	head	A0A0K2CNR0	Brevibacillus_phage	32.5	1.8e-05
AZZ64193.1|828335_829418_+|capsid	minor capsid protein E	capsid	A0A2H4J022	uncultured_Caudovirales_phage	57.1	3.4e-105
AZZ64194.1|829427_829670_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ64195.1|829683_830037_+	hypothetical protein	NA	A0A2H4J002	uncultured_Caudovirales_phage	49.6	9.7e-25
AZZ64196.1|830033_830342_+	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	40.2	7.4e-13
AZZ64197.1|830322_830688_+	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	46.3	5.9e-17
AZZ64198.1|830684_831074_+|capsid	phage capsid protein	capsid	B5SP36	Lactococcus_phage	68.2	4.2e-45
AZZ65168.1|831128_831752_+|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	50.5	3.2e-39
AZZ64199.1|831805_832159_+	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	48.6	5.5e-20
AZZ65169.1|832233_832530_+	hypothetical protein	NA	A0A0S2MYH1	Enterococcus_phage	42.2	1.3e-09
AZZ64200.1|832544_836180_+|tail	phage tail protein	tail	C5IUK3	Streptococcus_phage	41.4	1.2e-85
AZZ64201.1|836211_836991_+|tail	phage tail protein	tail	A3F655	Streptococcus_phage	54.0	1.9e-65
AZZ64202.1|836987_839042_+	hypothetical protein	NA	A3F656	Streptococcus_phage	84.1	0.0e+00
AZZ64203.1|839038_840253_+	hypothetical protein	NA	A3F657	Streptococcus_phage	49.5	5.0e-44
AZZ64204.1|840239_840569_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ64205.1|840579_842475_+	hyaluronidase	NA	Q938J9	Temperate_phage	52.5	5.9e-76
AZZ64206.1|842488_842650_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ64207.1|842652_843270_+	hypothetical protein	NA	A3F662	Streptococcus_phage	94.6	9.8e-89
AZZ64208.1|843280_843577_+	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
AZZ64209.1|843573_843759_+	hypothetical protein	NA	Q938J5	Temperate_phage	96.7	6.6e-25
AZZ64210.1|843870_845205_+	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
AZZ64211.1|845280_845988_-	exotoxin type C	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
AZZ64212.1|846098_846857_-	DNAse	NA	NA	NA	NA	NA
AZZ64213.1|847096_847285_+	Paratox	NA	A3F673	Streptococcus_phage	76.3	2.1e-18
AZZ64214.1|847875_848490_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
847360:847455	attR	AACTCATGAACAAGACAAAAAGAAAAAACCTTGATGTAACAAGGTTTTAGTAAGTTATGATTACTTACGGTAAGCATTGATGGAGCTGGTGGGAGT	NA	NA	NA	NA
AZZ64215.1|848616_849402_-	ABC transporter permease	NA	NA	NA	NA	NA
AZZ64216.1|849411_850110_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
AZZ64217.1|850109_850481_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ64218.1|850665_853776_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.7	5.4e-119
AZZ64219.1|853855_854869_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AZZ64220.1|854931_856434_+	pyruvate kinase	NA	NA	NA	NA	NA
AZZ64221.1|856651_857209_+	signal peptidase I	NA	NA	NA	NA	NA
AZZ64222.1|857384_859199_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.7	1.2e-97
AZZ64223.1|859394_859730_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
AZZ64224.1|859836_860478_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AZZ64225.1|860487_861117_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	9.8e-28
AZZ64226.1|861132_861969_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ64227.1|862338_863112_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ64228.1|863481_864717_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
AZZ64229.1|864836_866159_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AZZ64230.1|866687_869006_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	2.7e-131
AZZ64231.1|869368_869617_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AZZ64232.1|869653_870265_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AZZ64233.1|870275_870464_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
AZZ64234.1|870476_871016_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AZZ64235.1|871056_871257_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
AZZ64236.1|871264_871756_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AZZ64237.1|871918_872560_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ64238.1|872702_873245_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ64239.1|873362_874064_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
AZZ64240.1|874078_876715_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
AZZ64241.1|876806_877403_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZZ64242.1|877413_878370_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
AZZ64243.1|878466_879807_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
AZZ64244.1|879922_880807_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 3
CP032666	Streptococcus pyogenes strain MGAS28085 chromosome, complete genome	1851471	1200807	1211411	1851471		Streptococcus_phage(57.14%)	9	NA	NA
AZZ64540.1|1200807_1201950_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
AZZ64541.1|1202184_1202625_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ64542.1|1202654_1203923_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AZZ64543.1|1204010_1205363_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	1.0e-29
AZZ64544.1|1205584_1205926_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
AZZ64545.1|1205986_1207153_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
AZZ64546.1|1207246_1207933_-	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
AZZ64547.1|1207929_1209093_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.9	4.5e-143
AZZ64548.1|1209200_1211411_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.8	2.5e-267
>prophage 4
CP032666	Streptococcus pyogenes strain MGAS28085 chromosome, complete genome	1851471	1489344	1495218	1851471		Streptococcus_phage(100.0%)	8	NA	NA
AZZ64793.1|1489344_1490172_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.9	1.7e-128
AZZ64794.1|1490245_1490602_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
AZZ64795.1|1490900_1491530_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZZ64796.1|1491576_1491969_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ64797.1|1491995_1492859_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
AZZ64798.1|1492863_1493187_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
AZZ64799.1|1493689_1494565_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
AZZ64800.1|1494582_1495218_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
>prophage 5
CP032666	Streptococcus pyogenes strain MGAS28085 chromosome, complete genome	1851471	1757924	1778149	1851471	integrase,holin	Streptococcus_phage(56.25%)	27	1761123:1761143	1775450:1775470
AZZ65030.1|1757924_1759145_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.8	1.6e-05
AZZ65197.1|1759155_1761138_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	1.3e-62
1761123:1761143	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
AZZ65198.1|1761232_1762378_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	44.9	3.5e-84
AZZ65031.1|1762632_1762776_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZZ65032.1|1763637_1764405_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	83.1	3.6e-72
AZZ65033.1|1764558_1764765_+	XRE family transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
AZZ65034.1|1764798_1764999_+	XRE family transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	56.7	3.4e-11
AZZ65035.1|1765019_1765427_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	69.4	1.3e-49
AZZ65036.1|1765838_1766366_+	hypothetical protein	NA	R9QNB1	Lactococcus_phage	40.2	9.7e-21
AZZ65037.1|1766592_1766787_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AZZ65038.1|1766986_1767178_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AZZ65039.1|1767318_1767771_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ65040.1|1767872_1768205_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ65199.1|1768204_1768396_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ65041.1|1768407_1768737_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ65042.1|1768739_1769012_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	3.6e-19
AZZ65043.1|1769012_1769879_+	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	73.8	6.1e-121
AZZ65044.1|1769890_1771285_+	virulence-associated protein E	NA	A0A1W6JQD6	Staphylococcus_phage	38.1	1.3e-48
AZZ65045.1|1771578_1771833_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ65046.1|1771829_1772003_+	DUF2758 domain-containing protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	8.6e-11
AZZ65047.1|1772183_1772693_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	63.5	1.9e-29
AZZ65048.1|1772766_1773255_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.9	1.4e-45
AZZ65049.1|1773479_1773662_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ65050.1|1773658_1774021_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
AZZ65051.1|1773995_1774379_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	41.7	3.7e-14
AZZ65052.1|1774543_1775197_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ65053.1|1775593_1778149_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	6.8e-43
1775450:1775470	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
>prophage 6
CP032666	Streptococcus pyogenes strain MGAS28085 chromosome, complete genome	1851471	1804559	1814547	1851471	integrase	Streptococcus_phage(75.0%)	15	1804133:1804147	1811695:1811709
1804133:1804147	attL	AATCCTTGAAGCTGT	NA	NA	NA	NA
AZZ65088.1|1804559_1804733_-	DUF2758 domain-containing protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
AZZ65089.1|1805019_1806633_-	phage resistance protein	NA	A0A1P8BMF9	Lactococcus_phage	52.9	3.2e-147
AZZ65090.1|1806622_1807144_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ65091.1|1807153_1807522_-	hypothetical protein	NA	A0A1X9I6M4	Streptococcus_phage	47.1	2.6e-12
AZZ65200.1|1807430_1807622_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ65092.1|1807621_1807954_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ65093.1|1807965_1808148_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ65094.1|1808368_1808638_-	phage antirepressor protein	NA	NA	NA	NA	NA
AZZ65095.1|1808667_1809234_-	phage repressor protein	NA	A0A0A7S0G2	Clostridium_phage	42.9	5.0e-23
AZZ65096.1|1809249_1809438_-	XRE family transcriptional regulator	NA	A0A1X9I5U7	Streptococcus_phage	59.7	1.7e-12
AZZ65097.1|1809606_1810050_+	XRE family transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	48.6	1.8e-07
AZZ65098.1|1810229_1811393_+|integrase	site-specific integrase	integrase	A0A1X9I6A9	Streptococcus_phage	70.5	2.8e-161
AZZ65099.1|1811549_1812161_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
1811695:1811709	attR	ACAGCTTCAAGGATT	NA	NA	NA	NA
AZZ65100.1|1812890_1813163_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ65101.1|1813179_1814547_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	63.7	1.0e-154
